The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043169	Bordetella holmesii strain F592 chromosome, complete genome	3696540	1095273	1203111	3696540	transposase,protease,tRNA	Ralstonia_virus(16.67%)	97	NA	NA
WP_005011985.1|1095273_1096494_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096581_1097172_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097168_1097471_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097522_1098512_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098632_1099514_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099687_1100542_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100573_1101422_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101549_1102770_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102788_1103355_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103552_1104704_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104842_1105847_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1106003_1106975_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107053_1107842_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107913_1108150_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108158_1109070_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109113_1110985_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111145_1111943_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112174_1112549_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112625_1112949_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113032_1113305_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113319_1113775_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113896_1114733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114729_1116103_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116179_1117136_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117223_1118201_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118325_1119981_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120029_1120494_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120490_1120952_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121177_1122365_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122361_1123666_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123662_1125072_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125265_1126385_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126520_1127540_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127548_1130254_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130393_1131047_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131109_1131472_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132038_1133499_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133761_1134835_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134919_1136140_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137897_1139018_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1138991_1140491_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140504_1141608_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141612_1142863_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142859_1144305_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144301_1144616_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144617_1145736_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145918_1147139_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147238_1148105_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148165_1149146_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149292_1150213_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150221_1151334_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151415_1152237_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152312_1152921_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153058_1154435_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154496_1154940_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1155006_1155663_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155705_1156825_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1156994_1157276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157986_1158775_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158771_1159878_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160552_1161911_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162025_1162223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162240_1163361_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163454_1164009_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164596_1165913_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165925_1166939_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167485_1168436_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168515_1168815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170175_1171834_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012067.1|1172017_1172968_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_153567917.1|1173049_1174252_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1174369_1175653_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1175656_1176598_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1176707_1177166_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1177546_1178167_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1178574_1180995_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1181102_1181840_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1181886_1183131_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1183453_1183726_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1184309_1185038_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1185059_1185977_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1185976_1186486_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1186602_1187274_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1187383_1188451_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1188470_1190315_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1190451_1191639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1191939_1192725_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1192748_1193868_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1193972_1195310_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1195419_1196361_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1196416_1197598_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1197756_1198047_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1198093_1198762_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1198758_1199046_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1199422_1200208_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1200240_1200975_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1201890_1203111_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043169	Bordetella holmesii strain F592 chromosome, complete genome	3696540	1207898	1264304	3696540	transposase,protease,tRNA	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|1207898_1208849_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1208930_1209410_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1210621_1211821_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1211966_1212344_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1212367_1214149_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1214157_1214895_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1215179_1216739_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1216798_1217557_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1217653_1218310_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1218463_1219228_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1219242_1219422_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1219447_1220482_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1220478_1220892_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1220888_1221473_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1221825_1223184_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1223277_1223856_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1223980_1225101_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1225173_1226430_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1226533_1227739_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1227802_1228252_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1228384_1228630_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1228854_1229169_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1234422_1236528_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1236581_1238891_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1240244_1241912_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1241914_1242580_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1242712_1246519_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1246744_1247890_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1248008_1248938_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1248934_1250011_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1250007_1250814_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1250810_1251542_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1251918_1253157_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1253204_1253543_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1253790_1254741_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1255059_1255242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1255307_1256528_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1256621_1257842_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1257901_1258165_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1258286_1259786_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1259833_1260109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1260206_1260404_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1260419_1260779_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1260851_1261874_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1261886_1264304_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP043169	Bordetella holmesii strain F592 chromosome, complete genome	3696540	1652675	1693048	3696540	integrase,transposase,tRNA	Leptospira_phage(28.57%)	39	1645117:1645133	1689734:1689750
1645117:1645133	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_101557770.1|1652675_1653795_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654447_1655203_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655379_1656174_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656170_1656608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1656719_1656872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657292_1658261_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658417_1659425_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659482_1659941_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1660014_1661361_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661378_1661750_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1661749_1663219_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663374_1664100_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664113_1666828_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667079_1668444_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668483_1669542_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669569_1670388_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670425_1670704_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1671967_1672267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672836_1674240_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674252_1674903_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1675044_1676265_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676295_1677372_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677518_1678649_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678835_1680461_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680467_1681283_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681297_1682368_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682419_1683079_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1683718_1684881_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1684922_1685237_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685220_1685607_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685645_1685912_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686304_1686994_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687093_1687255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687405_1687570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687696_1687933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688122_1688371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688484_1689855_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1689734:1689750	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1689855_1690596_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691095_1693048_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 5
NZ_CP043169	Bordetella holmesii strain F592 chromosome, complete genome	3696540	1711342	1755269	3696540	integrase,transposase,tRNA,holin	Leptospira_phage(33.33%)	37	1753837:1753851	1760313:1760327
WP_005019367.1|1711342_1714204_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714193_1715159_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715915_1717391_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717395_1717671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1718007_1719127_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1719001_1719250_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719428_1720637_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720633_1722916_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1722926_1725308_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725571_1727479_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727493_1728384_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728390_1729524_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729523_1730345_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730369_1731560_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1731861_1732143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732308_1732629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732668_1733755_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1733951_1734212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734704_1735475_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735471_1736482_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1736516_1737359_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1737821_1738607_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739466_1740586_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741652_1742657_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742732_1743545_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1743772_1745944_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1745997_1747317_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747405_1748626_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1748844_1749705_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749701_1750925_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751223_1751721_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1751759_1752542_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752567_1752786_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1752860_1753130_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753349_1753814_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1753837:1753851	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1753887_1754169_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754285_1755269_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760313:1760327	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 6
NZ_CP043169	Bordetella holmesii strain F592 chromosome, complete genome	3696540	1780545	1821936	3696540	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1780545_1781496_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1781492_1782008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1782365_1782986_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1783085_1783337_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1783424_1784903_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1784899_1788070_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1788082_1789279_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1789467_1790400_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1790468_1791200_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1791265_1791901_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1791886_1793065_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1793225_1793774_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1793854_1794214_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1794261_1795482_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795557_1796679_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1796716_1797430_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797440_1798661_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1798743_1799298_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1799443_1800394_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1800353_1800515_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800555_1801482_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801495_1802368_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802530_1803478_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1803816_1804398_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1804975_1805926_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1805905_1806658_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806670_1807402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807558_1809724_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1809813_1810083_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810171_1810378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810376_1810895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1810913_1811693_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1811860_1812877_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1812949_1813441_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813451_1815167_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1816330_1817281_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1818932_1820174_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820185_1820959_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1820985_1821936_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP043169	Bordetella holmesii strain F592 chromosome, complete genome	3696540	2150150	2210273	3696540	transposase,protease,tRNA	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2150150_2150639_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2150631_2151480_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2151571_2152069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2152206_2152566_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2152562_2152844_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2152843_2153326_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153327_2154956_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2154952_2155297_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155298_2158241_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2158686_2159658_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2159647_2161030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2161172_2162123_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2162082_2163324_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163320_2164442_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2165933_2166401_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166471_2167122_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2167208_2168348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168516_2169521_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169517_2170765_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2171117_2171984_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2171943_2173548_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173559_2174246_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2174242_2175283_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175398_2176070_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2176066_2177059_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2177055_2177994_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2177990_2179145_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2179153_2180605_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2180635_2181118_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2181119_2182013_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2182009_2182453_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182465_2182840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2182982_2183381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183507_2183795_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2183791_2184208_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184383_2185016_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2185044_2185491_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2185777_2186929_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2187042_2188047_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2189030_2189738_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2189670_2191122_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2191127_2194286_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194298_2194820_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2194809_2195634_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2195630_2196230_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196338_2198195_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198343_2199348_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199556_2200819_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2200823_2201159_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2201155_2202085_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2202089_2202803_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2202906_2204364_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204360_2204657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2204781_2206140_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2206240_2207041_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2207220_2208339_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2208411_2208783_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2208789_2209641_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2209661_2210273_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 8
NZ_CP043169	Bordetella holmesii strain F592 chromosome, complete genome	3696540	2305395	2426906	3696540	integrase,transposase,protease,tRNA	Leptospira_phage(15.15%)	106	2336925:2336984	2358232:2358506
WP_101557807.1|2305395_2306558_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306670_2307639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2307635_2308556_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2308652_2313131_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2313509_2317844_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318482_2319046_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319057_2319303_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319458_2319968_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2320013_2320994_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321205_2323557_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2323603_2324434_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324430_2325120_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325112_2326393_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_153567921.1|2326490_2327429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327410_2329117_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329194_2330298_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330350_2331100_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331106_2332621_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005014513.1|2332633_2332921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2332941_2333829_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2333979_2334486_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334482_2335439_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335626_2336973_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2336925:2336984	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2336940_2337171_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2337200_2337764_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2337918_2338689_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2338685_2339696_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2340010_2340457_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340512_2340707_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2340708_2341050_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2341059_2342922_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2342961_2343468_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343471_2343795_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2343796_2344201_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2344237_2345449_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345470_2346019_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2346243_2346735_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2346949_2348980_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2349054_2350257_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2350799_2351735_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2352768_2353050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2353136_2353310_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353421_2353766_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2353837_2354506_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2355921_2356965_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2356961_2357063_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2357154_2358274_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358524_2359178_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2358232:2358506	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2359293_2360514_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_153567922.1|2360564_2362994_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363159_2364458_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364562_2365216_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365218_2366529_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2366756_2367296_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2367774_2368041_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368079_2368445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368326_2369337_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2369333_2370104_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2370189_2370849_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2370816_2371308_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371417_2371621_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2371938_2372259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2372242_2372578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2372632_2372845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2372920_2373259_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2373255_2373591_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373653_2375225_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2376018_2376330_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2376522_2377643_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2377770_2377965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2384047_2385209_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2385594_2387058_+	ribonuclease G	NA	NA	NA	NA	NA
WP_153567930.1|2387190_2388741_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2388737_2388887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2389052_2390173_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2391286_2392144_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2392196_2392694_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2392814_2394230_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2394239_2395424_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2395420_2397019_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2398201_2398447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2398857_2399043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2399198_2400110_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2400231_2401074_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2401276_2402650_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2402959_2404471_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2404623_2405355_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405461_2406763_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2406770_2407679_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2407675_2408269_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408312_2408726_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2408722_2409193_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409199_2409805_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2411606_2413391_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413387_2414773_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2414758_2415721_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2415790_2416420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2416457_2417666_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2417787_2418357_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418488_2420042_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420345_2421566_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2421973_2422876_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2422872_2423742_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2423738_2424590_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2424586_2425411_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2425685_2426906_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 9
NZ_CP043169	Bordetella holmesii strain F592 chromosome, complete genome	3696540	2626252	2673879	3696540	transposase,protease,tRNA	Bacillus_phage(25.0%)	47	NA	NA
WP_005015146.1|2626252_2627005_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_005015148.1|2627047_2627767_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005015150.1|2627809_2628865_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_101557744.1|2629874_2630994_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015154.1|2631554_2632133_-	TIGR01841 family phasin	NA	NA	NA	NA	NA
WP_005012861.1|2632275_2633496_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005015155.1|2633800_2634778_+	tripartite tricarboxylate transporter substrate binding protein BugD	NA	NA	NA	NA	NA
WP_005015156.1|2634926_2635757_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015157.1|2635870_2636686_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_005015162.1|2636708_2637563_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_005015163.1|2637561_2637945_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005015164.1|2638051_2639425_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	1.8e-50
WP_005019837.1|2639496_2639988_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_005015166.1|2639987_2640740_-	membrane protein	NA	NA	NA	NA	NA
WP_005015167.1|2641087_2641291_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_005015168.1|2641320_2641743_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_005015169.1|2641754_2642852_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005015170.1|2642864_2644334_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_005015171.1|2644455_2645295_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
WP_005019846.1|2645316_2646174_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_005015173.1|2646246_2647365_-	porin	NA	NA	NA	NA	NA
WP_005015175.1|2647351_2647966_-	magnesium transporting ATPase P-type 1	NA	NA	NA	NA	NA
WP_101557744.1|2647995_2649116_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015176.1|2649159_2649789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015177.1|2649946_2651290_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_005015178.1|2651298_2651682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015179.1|2651841_2652993_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_032969170.1|2653091_2654042_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015181.1|2654185_2655211_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005015182.1|2655251_2655491_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_005019849.1|2655556_2657146_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	4.3e-64
WP_005015184.1|2657145_2657691_+	crossover junction endodeoxyribonuclease RuvC	NA	A0A088FT24	Mycobacterium_phage	30.8	3.5e-05
WP_005015187.1|2657774_2658347_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_005019851.1|2658350_2659118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015190.1|2659149_2659485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015191.1|2659408_2660476_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.5	2.1e-06
WP_005015192.1|2660472_2662293_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	33.9	8.7e-77
WP_005015193.1|2662408_2663617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015194.1|2663850_2664552_+	response regulator	NA	W8CYM9	Bacillus_phage	36.6	2.8e-31
WP_005015195.1|2664564_2666043_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_005015196.1|2666058_2667111_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_005019853.1|2667107_2668445_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005015199.1|2668563_2670324_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	52.4	2.2e-170
WP_005015201.1|2670509_2671352_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_005015204.1|2671445_2672261_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_005015207.1|2672264_2672537_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_005012365.1|2672658_2673879_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
>prophage 10
NZ_CP043169	Bordetella holmesii strain F592 chromosome, complete genome	3696540	2936365	3013425	3696540	integrase,transposase,tRNA	Ralstonia_virus(21.43%)	56	2939220:2939279	2987807:2988377
WP_005019978.1|2936365_2937145_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937167_2938115_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938116_2938317_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2938651_2939771_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2939220:2939279	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2940092_2940809_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2940805_2941699_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2941862_2943083_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943235_2944318_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2945997_2946981_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2947043_2948456_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948573_2949416_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2949694_2950303_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950318_2950939_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2951004_2951712_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2951716_2952439_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952425_2952716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2952791_2954012_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2954736_2955588_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955639_2956893_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957069_2957858_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2957977_2958892_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2959024_2960917_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_153567925.1|2961102_2962482_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2962926_2963223_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2967023_2967626_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2967759_2968218_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968219_2968819_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2968827_2969637_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969671_2970526_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970645_2971233_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971229_2972609_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973113_2973260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2980931_2982272_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982285_2983137_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983148_2984414_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984475_2986380_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988355_2989210_-	hypothetical protein	NA	NA	NA	NA	NA
2987807:2988377	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2989202_2989997_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990212_2991163_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2991765_2992563_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992602_2993256_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993236_2994301_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994464_2996690_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2996935_2998780_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2998896_2999769_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2999815_3001516_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001578_3002778_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3002788_3003667_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3003773_3004811_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3004891_3005296_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005307_3006765_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007407_3008004_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008164_3008623_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009400_3010372_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010493_3010913_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012204_3013425_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
