The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043171	Bordetella holmesii strain F589 chromosome, complete genome	3695230	631716	692514	3695230	tRNA,transposase	Ralstonia_virus(36.36%)	50	NA	NA
WP_005012861.1|631716_632937_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005018655.1|635946_636681_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	42.4	2.6e-40
WP_005011985.1|636849_638070_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005020417.1|638444_639431_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005020418.1|639434_642158_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	6.6e-20
WP_005018662.1|642158_643286_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005018665.1|643298_644711_+	TolC family protein	NA	NA	NA	NA	NA
WP_005018670.1|644885_645542_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005018673.1|645562_646609_+	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	39.5	1.4e-58
WP_005018676.1|646605_648195_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_005018678.1|648130_648640_-	GtrA family protein	NA	NA	NA	NA	NA
WP_017685335.1|648565_649459_+	ChbG/HpnK family deacetylase	NA	NA	NA	NA	NA
WP_005018681.1|649448_650345_-	alpha/beta fold hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	33.1	6.5e-09
WP_005020419.1|650391_651024_-	LysE family translocator	NA	NA	NA	NA	NA
WP_005018686.1|651048_651933_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005018689.1|652060_653542_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005018691.1|653614_653959_+	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_005018693.1|654044_654509_+	universal stress protein	NA	NA	NA	NA	NA
WP_005018697.1|655672_657787_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.1	6.0e-61
WP_005018699.1|657819_658617_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005013747.1|658828_659779_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005018702.1|659811_660258_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_005018704.1|660306_660996_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_005018707.1|661083_661578_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_005018709.1|661609_662926_-	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_005018710.1|662942_663863_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_005018713.1|663897_664359_-	protein TolR	NA	NA	NA	NA	NA
WP_005018715.1|664358_665033_-	protein TolQ	NA	NA	NA	NA	NA
WP_005018717.1|665035_665458_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005018720.1|665511_667242_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	28.6	1.2e-11
WP_005018723.1|667307_667877_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005018726.1|667857_668544_+	response regulator	NA	NA	NA	NA	NA
WP_005018729.1|668563_670069_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005018732.1|670297_670747_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_005018735.1|670752_672273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|672326_673547_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005018738.1|673643_674573_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005018740.1|674731_675637_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005011985.1|675836_677057_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005018744.1|677112_678618_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_005018747.1|678639_679095_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_005018750.1|679451_680024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005018752.1|680023_680335_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_005018754.1|680648_681410_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_005018757.1|681378_682173_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_005018762.1|682351_682687_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_005018764.1|682703_683261_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_005018766.1|683322_684435_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_005018783.1|684575_685052_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_101557886.1|691393_692514_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
>prophage 2
NZ_CP043171	Bordetella holmesii strain F589 chromosome, complete genome	3695230	774239	847447	3695230	tRNA,transposase,protease,integrase	Klosneuvirus(22.22%)	55	791422:791437	854079:854094
WP_005020050.1|774239_776861_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.5	2.8e-84
WP_005015899.1|776847_777099_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_005015897.1|777598_777859_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_005015895.1|778150_778744_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_005015892.1|778743_779607_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_153568012.1|779655_780876_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	2.7e-183
WP_005015887.1|780929_783809_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	1.1e-137
WP_005015883.1|784128_784554_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.9	2.4e-22
WP_005015881.1|784583_785732_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_005015878.1|785728_786217_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005015875.1|786229_787516_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_032826677.1|787548_788844_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005015870.1|788847_789486_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_005015868.1|789491_790649_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_005015867.1|790673_792029_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
791422:791437	attL	AGGCGGTCGAGAAGTT	NA	NA	NA	NA
WP_005015866.1|792025_793099_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_003810707.1|793282_793519_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_005015862.1|793606_794713_+	GTPase HflX	NA	NA	NA	NA	NA
WP_005020041.1|794678_795983_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_005020040.1|796000_796888_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_005016668.1|796949_798170_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
WP_005015849.1|799461_799881_-	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005015847.1|800002_800974_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015844.1|801751_802210_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015841.1|802370_802967_+	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015836.1|803609_805067_-	magnesium transporter	NA	NA	NA	NA	NA
WP_025341225.1|805078_805483_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015832.1|805563_806601_-	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_005015829.1|806707_807586_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015826.1|807596_808796_-	amidohydrolase	NA	NA	NA	NA	NA
WP_005015825.1|808858_810559_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015820.1|810605_811478_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015818.1|811594_813439_+|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015817.1|813684_815910_+	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015815.1|816073_817138_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015813.1|817118_817772_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005020039.1|817811_818609_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015810.1|819211_820162_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015806.1|820377_821172_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015804.1|821164_822019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015801.1|823994_825899_+	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015799.1|825960_827226_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015796.1|827237_828089_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015794.1|828102_829443_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_153566140.1|837113_837260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015791.1|837764_839144_-	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_005015790.1|839140_839728_-	HutD family protein	NA	NA	NA	NA	NA
WP_005015786.1|839847_840702_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015783.1|840736_841546_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015780.1|841554_842154_+	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015778.1|842155_842614_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015774.1|842747_843350_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015771.1|843476_843665_+	AsmA family protein	NA	NA	NA	NA	NA
WP_080691268.1|843728_845561_+	AsmA family protein	NA	NA	NA	NA	NA
WP_076879504.1|847150_847447_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
854079:854094	attR	AGGCGGTCGAGAAGTT	NA	NA	NA	NA
>prophage 3
NZ_CP043171	Bordetella holmesii strain F589 chromosome, complete genome	3695230	1136496	1180501	3695230	tRNA,transposase,protease	Bacillus_phage(25.0%)	44	NA	NA
WP_005012365.1|1136496_1137717_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
WP_005015207.1|1137838_1138111_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_005015204.1|1138114_1138930_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_005015201.1|1139023_1139866_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_005015199.1|1140051_1141812_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	52.4	2.2e-170
WP_005019853.1|1141930_1143268_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005015196.1|1143264_1144317_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_005015195.1|1144332_1145811_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_005015194.1|1145823_1146525_-	response regulator	NA	W8CYM9	Bacillus_phage	36.6	2.8e-31
WP_005015193.1|1146758_1147967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015192.1|1148082_1149903_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	33.9	8.7e-77
WP_005015191.1|1149899_1150967_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.5	2.1e-06
WP_005015190.1|1150890_1151226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005019851.1|1151257_1152025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015187.1|1152028_1152601_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_005015184.1|1152684_1153230_-	crossover junction endodeoxyribonuclease RuvC	NA	A0A088FT24	Mycobacterium_phage	30.8	3.5e-05
WP_005019849.1|1153229_1154819_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	4.3e-64
WP_005015182.1|1154884_1155124_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_005015181.1|1155164_1156190_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005015180.1|1156333_1157284_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015179.1|1157382_1158534_-	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_005015178.1|1158693_1159077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015177.1|1159085_1160429_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_005015176.1|1160586_1161216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557744.1|1161259_1162379_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015175.1|1162409_1163024_+	magnesium transporting ATPase P-type 1	NA	NA	NA	NA	NA
WP_005015173.1|1163010_1164129_+	porin	NA	NA	NA	NA	NA
WP_005019846.1|1164201_1165059_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_005015171.1|1165080_1165920_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
WP_005015170.1|1166041_1167511_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_005015169.1|1167523_1168621_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005015168.1|1168632_1169055_-	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_005015167.1|1169084_1169288_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_005015166.1|1169635_1170388_+	membrane protein	NA	NA	NA	NA	NA
WP_005019837.1|1170387_1170879_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_005015164.1|1170950_1172324_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	1.8e-50
WP_005015163.1|1172430_1172814_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005015162.1|1172812_1173667_+	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_005015157.1|1173689_1174505_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_005015156.1|1174618_1175449_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015155.1|1175597_1176575_-	tripartite tricarboxylate transporter substrate binding protein BugD	NA	NA	NA	NA	NA
WP_005012861.1|1176879_1178100_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005015154.1|1178242_1178821_+	TIGR01841 family phasin	NA	NA	NA	NA	NA
WP_101557744.1|1179380_1180501_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
>prophage 4
NZ_CP043171	Bordetella holmesii strain F589 chromosome, complete genome	3695230	1370422	1479268	3695230	tRNA,transposase,protease,integrase	Leptospira_phage(15.62%)	99	1452084:1452143	1473391:1473666
WP_005014796.1|1370422_1371880_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	30.0	7.5e-39
WP_005014794.1|1371890_1372535_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_005014792.1|1372568_1373534_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_005014790.1|1373551_1374601_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_005019734.1|1374685_1375945_+	aspartate kinase	NA	NA	NA	NA	NA
WP_005014784.1|1376196_1376667_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_005014781.1|1376768_1378175_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	28.2	1.5e-20
WP_005014780.1|1378190_1380284_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	55.8	2.4e-107
WP_005014779.1|1380283_1380946_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014777.1|1380962_1383323_-	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
WP_005011985.1|1383468_1384689_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014769.1|1384963_1385788_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014767.1|1385784_1386636_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014766.1|1386632_1387502_-	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014765.1|1387498_1388401_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005011985.1|1388808_1390029_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014763.1|1390332_1391886_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014760.1|1392017_1392587_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014759.1|1392708_1393917_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014755.1|1393954_1394584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014754.1|1394653_1395616_+	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014753.1|1395601_1396987_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014750.1|1396983_1398768_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014748.1|1400569_1401175_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014747.1|1401181_1401652_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014744.1|1401648_1402062_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014741.1|1402105_1402699_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014740.1|1402695_1403604_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014730.1|1403611_1404913_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014728.1|1405019_1405751_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014726.1|1405903_1407415_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014723.1|1407724_1409098_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014721.1|1409300_1410143_+	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014720.1|1410264_1411176_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005014716.1|1411331_1411517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014714.1|1411927_1412173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014709.1|1413355_1414954_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014706.1|1414950_1416135_-	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_153568005.1|1416144_1417560_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014704.1|1417680_1418178_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014703.1|1418230_1419088_-	DMT family transporter	NA	NA	NA	NA	NA
WP_101557770.1|1420201_1421321_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_017685964.1|1421487_1421637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014698.1|1421633_1423184_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_005019713.1|1423316_1424780_-	ribonuclease G	NA	NA	NA	NA	NA
WP_101557807.1|1425164_1426327_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005011899.1|1432409_1432604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1432731_1433851_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014621.1|1434044_1434356_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_005014618.1|1435149_1436721_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014613.1|1436783_1437119_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014610.1|1437115_1437454_-	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014607.1|1437529_1437742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|1437796_1438132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014600.1|1438115_1438436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014599.1|1438753_1438957_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014598.1|1439066_1439558_+	DUF924 family protein	NA	NA	NA	NA	NA
WP_050427733.1|1439525_1440185_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005013542.1|1440270_1441041_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341473.1|1441037_1442048_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_135238891.1|1441929_1442295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557809.1|1442333_1442600_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005014595.1|1443078_1443618_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_005014590.1|1443845_1445156_+	trigger factor	NA	NA	NA	NA	NA
WP_005014589.1|1445158_1445812_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014587.1|1445916_1447215_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014581.1|1447380_1449810_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_032974133.1|1449860_1451081_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014574.1|1451196_1451850_-	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
1452084:1452143	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_101557770.1|1452099_1453220_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879527.1|1453311_1453413_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005014572.1|1453409_1454453_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_005014566.1|1455868_1456537_-	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014564.1|1456608_1456953_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014560.1|1457064_1457238_-	OsmC family protein	NA	NA	NA	NA	NA
WP_005014556.1|1457324_1457606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032826331.1|1458639_1459575_+	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014553.1|1460117_1461320_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_017685984.1|1461394_1463425_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014551.1|1463639_1464131_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_005014547.1|1464355_1464904_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014546.1|1464925_1466137_+	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014545.1|1466173_1466578_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014544.1|1466579_1466903_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014543.1|1466906_1467413_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014539.1|1467452_1469315_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014536.1|1469324_1469666_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014534.1|1469667_1469862_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_076879495.1|1469917_1470364_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_025341421.1|1470678_1471689_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_032968029.1|1471685_1472456_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_101558036.1|1472610_1473174_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_025341181.1|1473203_1473434_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_005019683.1|1473401_1474748_-	TonB-dependent receptor	NA	NA	NA	NA	NA
1473391:1473666	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCATCGCCCCGATAGGTATTGGGCGGCCCCAGTCGGCCGCTACGCAGCAAATACTTGATGTCGTTCGTTTCATCCACGCGCACCACAGCCGCCTTGAATTTCCATCCATTGGAAAATCGGTGGGTGAGGTCGGCGAACCAAGTGTTCTGGGTTTTATACGCGTGATTCCATTTGGCGCTCAGATTGGTCGAGCGTGAATACTCCGGCATCGACCCGTCT	NA	NA	NA	NA
WP_005014518.1|1474935_1475892_-	FecR family protein	NA	NA	NA	NA	NA
WP_005014516.1|1475888_1476395_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014514.1|1476545_1477433_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014513.1|1477453_1477741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014511.1|1477753_1479268_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
>prophage 5
NZ_CP043171	Bordetella holmesii strain F589 chromosome, complete genome	3695230	1600102	1649203	3695230	tRNA,transposase,protease	Ralstonia_virus(25.0%)	48	NA	NA
WP_005014292.1|1600102_1600714_+|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
WP_005014290.1|1600734_1601586_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014289.1|1601592_1601964_-	lipoprotein	NA	NA	NA	NA	NA
WP_005014286.1|1602036_1603155_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014285.1|1603334_1604135_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014283.1|1604235_1605594_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014281.1|1605718_1606015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014278.1|1606011_1607469_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014277.1|1607572_1608286_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014275.1|1608290_1609220_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005014274.1|1609216_1609552_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014271.1|1609556_1610819_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005012353.1|1611027_1612032_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014269.1|1612180_1614037_+	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005014267.1|1614145_1614745_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014265.1|1614741_1615566_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014263.1|1615555_1616077_+	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014260.1|1616089_1619248_-	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_032954285.1|1619253_1620705_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014256.1|1620637_1621345_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_005012353.1|1622328_1623333_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014253.1|1623446_1624598_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005014250.1|1624884_1625331_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014248.1|1625359_1625992_-	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014247.1|1626167_1626584_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_076879494.1|1626580_1626868_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014242.1|1626994_1627393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014241.1|1627535_1627910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014239.1|1627922_1628366_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014237.1|1628362_1629256_-	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014235.1|1629257_1629740_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014231.1|1629770_1631222_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014229.1|1631230_1632385_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014228.1|1632381_1633320_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014227.1|1633316_1634309_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014226.1|1634305_1634977_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014223.1|1635092_1636133_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014221.1|1636129_1636816_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014215.1|1636827_1638432_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014213.1|1638391_1639258_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014212.1|1639610_1640858_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005012353.1|1640854_1641859_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014211.1|1642027_1643167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014210.1|1643253_1643904_-	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014203.1|1643974_1644442_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014202.1|1645933_1647055_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014200.1|1647051_1648293_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_005012067.1|1648252_1649203_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP043171	Bordetella holmesii strain F589 chromosome, complete genome	3695230	1967102	2077707	3695230	transposase,holin,integrase	Ralstonia_virus(25.0%)	99	2014890:2014949	2068668:2069006
WP_005013764.1|1967102_1968053_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013763.1|1968043_1969228_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005013762.1|1969307_1970225_-	FecR family protein	NA	NA	NA	NA	NA
WP_005013761.1|1970226_1970721_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005013759.1|1970863_1971844_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	29.2	5.6e-14
WP_076879523.1|1971827_1972568_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_025341443.1|1973808_1974015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013757.1|1974022_1974652_-	MarC family protein	NA	NA	NA	NA	NA
WP_005013756.1|1974946_1977151_-	TonB-dependent alcaligin siderophore receptor FauA	NA	NA	NA	NA	NA
WP_005013755.1|1977261_1978485_-	alcaligin siderophore export MFS transporter Bcr	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
WP_005013754.1|1978607_1979582_-	alcaligin siderophore biosynthesis transcriptional regulator AlcR	NA	NA	NA	NA	NA
WP_005013753.1|1979649_1980843_-	alcaligin siderophore biosynthesis protein AlcE	NA	NA	NA	NA	NA
WP_005013752.1|1980857_1981658_-	alcaligin siderophore biosynthesis protein AlcD	NA	NA	NA	NA	NA
WP_005013751.1|1981654_1983511_-	alcaligin siderophore biosynthesis protein AlcC	NA	NA	NA	NA	NA
WP_005013750.1|1983507_1984113_-	alcaligin siderophore biosynthesis protein AlcB	NA	NA	NA	NA	NA
WP_003814013.1|1984131_1985517_-	alcaligin siderophore biosynthesis protein AlcA	NA	NA	NA	NA	NA
WP_003814011.1|1987558_1988341_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_005013747.1|1988439_1989390_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814010.1|1989416_1990190_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_003814009.1|1990201_1991443_+	MFS transporter	NA	NA	NA	NA	NA
WP_005012808.1|1993094_1994045_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814007.1|1995208_1996924_+	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005013744.1|1996934_1997426_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_005013742.1|1997498_1998515_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003814004.1|1998682_1999462_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013740.1|1999480_1999999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005019401.1|1999997_2000204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013738.1|2000292_2000562_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005013736.1|2000651_2002817_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005019399.1|2002973_2003705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013735.1|2003717_2004470_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005012808.1|2004449_2005400_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_026087954.1|2005977_2006559_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005013732.1|2006897_2007845_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013731.1|2008007_2008880_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013730.1|2008893_2009820_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013729.1|2009860_2010022_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013727.1|2009981_2010932_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013726.1|2011077_2011632_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013725.1|2011714_2012935_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013724.1|2012945_2013659_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013723.1|2013696_2014818_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
2014890:2014949	attL	TGGTTCATCGAGGAATACCGGGGAATGCAGACCGGATCTTGAGGAAGAAGTACTCCTGAT	NA	NA	NA	NA
WP_005011985.1|2014893_2016114_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013722.1|2016161_2016521_-	LysE family transporter	NA	NA	NA	NA	NA
WP_005013721.1|2016601_2017150_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013720.1|2017310_2018489_+	MFS transporter	NA	NA	NA	NA	NA
WP_005013719.1|2018474_2019110_-	chorismate lyase	NA	NA	NA	NA	NA
WP_005013718.1|2019175_2019907_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013717.1|2019975_2020908_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013715.1|2021096_2022293_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013714.1|2022305_2025476_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013712.1|2025472_2026951_+	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013711.1|2027038_2027290_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013710.1|2027389_2028010_-	SCO family protein	NA	NA	NA	NA	NA
WP_005013708.1|2028367_2028883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2028879_2029830_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013707.1|2029939_2031994_-	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013706.1|2032113_2032968_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.8	1.4e-29
WP_005019390.1|2032964_2033591_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013704.1|2033587_2035342_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_005013703.1|2035887_2038599_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_005013702.1|2038611_2040276_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_005013701.1|2040291_2042067_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.4	3.5e-38
WP_153566129.1|2042188_2042362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013700.1|2042480_2042693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013699.1|2042865_2043846_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013698.1|2043862_2044657_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_157933265.1|2044690_2045158_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013696.1|2045774_2046428_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005013695.1|2046509_2047445_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013694.1|2047706_2047853_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_005013693.1|2047943_2048345_+	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_005013692.1|2048420_2049305_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019382.1|2049397_2050102_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013691.1|2050140_2052222_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013690.1|2052354_2053266_-	phosphoglycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	30.7	3.7e-20
WP_005013689.1|2053330_2053762_-	TonB family protein	NA	NA	NA	NA	NA
WP_005013688.1|2053864_2054863_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_005013686.1|2055106_2056090_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_005013685.1|2056206_2056488_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013684.1|2056561_2057026_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005019379.1|2057245_2057515_-	YunC family protein	NA	NA	NA	NA	NA
WP_005013682.1|2057589_2057808_+	SlyX family protein	NA	NA	NA	NA	NA
WP_005013681.1|2057833_2058616_+	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013680.1|2058654_2059152_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013679.1|2059450_2060674_+	MFS transporter	NA	NA	NA	NA	NA
WP_005013678.1|2060670_2061531_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2061749_2062970_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013677.1|2063058_2064378_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005013676.1|2064431_2066603_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013675.1|2066830_2067643_-	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005012353.1|2067718_2068723_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_101557815.1|2069788_2070909_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
2068668:2069006	attR	ATCAGGAGTACTTCTTCCTCAAGATCCGGTCTGCATTCCCCGGTATTCCTCGATGAACCATAAATCAGGGTGTGCATGCCCTCGGCCTCGAAAGCCAGGGCCGAATCCACATACTCCGACGTGGTGCCTGCCACCCGCGCGATCTCGACTCCGTCGCGGCTGATGACGACGTCGCCCTGCGGCTCGCCGACGCGCACCCAACGCAGAGTCACGCTTTTGTTATCCGTGGCCGTGCGCGTCACCAGTCTGCGCACCGCCACGGGTTCTGCCAGCGACGTGCCCGCCATGTCGTACGCGCGCGGCTCGGGCAATGCGCCCATGTGGCTCAACACGGTCGGC	NA	NA	NA	NA
WP_005013673.1|2071768_2072554_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_005013672.1|2073016_2073859_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_025341421.1|2073893_2074904_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2074900_2075671_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_005013671.1|2076163_2076424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|2076619_2077707_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
>prophage 7
NZ_CP043171	Bordetella holmesii strain F589 chromosome, complete genome	3695230	2091125	2135332	3695230	tRNA,transposase,integrase	Ralstonia_virus(20.0%)	47	2101088:2101147	2139546:2140116
WP_161992024.1|2091125_2091374_-|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_101557770.1|2091247_2092368_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013659.1|2092704_2092980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005019369.1|2092984_2094460_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013657.1|2095216_2096182_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019367.1|2096171_2099033_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013655.1|2099035_2099551_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_005013654.1|2099611_2100823_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.4	2.2e-36
2101088:2101147	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_005019364.1|2102002_2102743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013652.1|2102835_2103306_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013651.1|2103324_2104029_-	dipeptidase PepE	NA	NA	NA	NA	NA
WP_005013650.1|2104041_2104584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013649.1|2104605_2105073_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_005013648.1|2105182_2105815_+	DedA family protein	NA	NA	NA	NA	NA
WP_005013647.1|2105835_2106294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013645.1|2106335_2106785_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	62.8	2.3e-47
WP_005013644.1|2107657_2108329_-	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
WP_005013643.1|2108325_2108967_-	ectoine/hydroxyectoine ABC transporter permease subunit EhuC	NA	NA	NA	NA	NA
WP_005013642.1|2108977_2109865_-	ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB	NA	NA	NA	NA	NA
WP_005013641.1|2110033_2111197_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013640.1|2111265_2112243_-	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_005013639.1|2112362_2112785_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005013638.1|2112831_2113041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013637.1|2113088_2114864_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_005013636.1|2114892_2115162_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_005013635.1|2115224_2115623_-	PTS IIa component	NA	NA	NA	NA	NA
WP_005013634.1|2115636_2116593_-	glutathione synthase	NA	NA	NA	NA	NA
WP_076879490.1|2116758_2117307_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.3	3.8e-12
WP_005013632.1|2117327_2119280_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
WP_005013631.1|2119780_2120521_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013629.1|2120521_2121892_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_005013628.1|2122005_2122254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|2122443_2122680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|2122806_2122971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013626.1|2123121_2123283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013625.1|2123382_2124072_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_101557809.1|2124464_2124731_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080687433.1|2124769_2125156_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_157933264.1|2125139_2125454_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_101557807.1|2125495_2126657_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005013621.1|2127297_2127957_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_110097765.1|2128008_2129079_-	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005019353.1|2129093_2129909_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_005019351.1|2129915_2131541_-	membrane protein	NA	NA	NA	NA	NA
WP_005013618.1|2131727_2132858_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005013617.1|2133004_2134081_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005011985.1|2134111_2135332_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
2139546:2140116	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCACCATGGTTACGCCGGCCCAACAGAGCTCGGCCAGGCGCTCGGCGTGGTGGCCCAAGGCGGCATGTGGATGGGTCGATCTCTGGTAGGCCGCCTGTTACGCACGGCCCGAAATCGCGCCGGCACACCCGCGGATTGGGGCCACGCTCTGTTGACCGCACGGGAAGACACCGTCGCGCGCCACGCCTCTGCCGGTCAATCCAACGCGCAGATCGCCGAACAGCTCGGCATTACCGAACGCACCGTCAAAGCGCATCTGTCCGCGGTCTTTGAGAAAGTCGGCGTGGCAGATCGCCTGCAGTTAGCGCTATTGGTCCATGGCGTCACACCCGCCAAAACCGGCCATTGACTCAACGGCACCGCACCTCAATCGCCTGCCGGATCCATCAACGGCGGGCCTGCTCGTACAAGGGCAAAACCCGCTCTGACGCCTGCTTCAGATCCGCGATGCGTGTGCTGGCCGAGGGATGCGTGGAGAGAAACTCCGGCGAGGCCTGTCCAGTCTGGGCCGCTG	NA	NA	NA	NA
>prophage 8
NZ_CP043171	Bordetella holmesii strain F589 chromosome, complete genome	3695230	2150951	2202551	3695230	tRNA,transposase	Leptospira_phage(20.0%)	52	NA	NA
WP_025341429.1|2150951_2151959_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_005013598.1|2152115_2153084_+	homoserine kinase	NA	NA	NA	NA	NA
WP_153566127.1|2153504_2153657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013597.1|2153768_2154206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013596.1|2154202_2154997_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013595.1|2155173_2155929_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_101557770.1|2156580_2157701_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013592.1|2157744_2158368_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_005013591.1|2158364_2159726_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013590.1|2159725_2160481_-	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013589.1|2160545_2160950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|2161174_2161714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013587.1|2161935_2163144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2163193_2164144_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013586.1|2164366_2164627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013585.1|2164888_2165296_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_005013584.1|2165292_2167632_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013583.1|2167637_2168762_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013582.1|2168809_2168941_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013581.1|2168955_2169651_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013580.1|2169894_2170428_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013579.1|2170463_2172011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013578.1|2172015_2173239_-	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013577.1|2173225_2174005_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005019317.1|2174035_2174974_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013573.1|2175092_2175815_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005013572.1|2175956_2176655_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013571.1|2176951_2177833_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013570.1|2177854_2179015_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013569.1|2179025_2179631_-	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2179889_2181110_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013568.1|2181165_2183463_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005013567.1|2183602_2184523_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013566.1|2184529_2185081_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013565.1|2185126_2186188_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013564.1|2186528_2187224_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013563.1|2187195_2188719_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_017685641.1|2188954_2190580_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013561.1|2191053_2191272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013559.1|2191423_2192323_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013558.1|2192439_2193732_-	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013556.1|2193822_2194197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013555.1|2194206_2194704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|2194733_2194865_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013552.1|2195123_2195459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|2196080_2197580_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013550.1|2197686_2197932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013549.1|2197992_2198364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080601033.1|2198368_2199112_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_101557831.1|2199112_2200233_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_101557920.1|2200400_2201482_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_025341421.1|2201540_2202551_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
>prophage 9
NZ_CP043171	Bordetella holmesii strain F589 chromosome, complete genome	3695230	2506768	2556586	3695230	tRNA,transposase	Ralstonia_virus(25.0%)	54	NA	NA
WP_005011985.1|2506768_2507989_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005019139.1|2508602_2509436_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_005012970.1|2509443_2510691_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_005012967.1|2510813_2511251_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012964.1|2511272_2512499_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_005019132.1|2512637_2513099_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	43.4	2.0e-17
WP_005011985.1|2513833_2515054_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012942.1|2515681_2516110_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_005012941.1|2516138_2516585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012939.1|2516717_2518634_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_005012937.1|2518805_2521328_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_005012934.1|2521322_2521976_-	serine/threonine protein phosphatase 1	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	47.7	6.3e-54
WP_005012933.1|2522153_2523329_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_005012931.1|2523325_2523532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012930.1|2523578_2524565_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_005012927.1|2524569_2525025_-	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	48.3	2.1e-35
WP_101557744.1|2525048_2526169_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_080687431.1|2526192_2526648_-	2,5-diketo-D-gluconic acid reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.9e-20
WP_005012922.1|2526716_2528516_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.4	8.7e-45
WP_005012921.1|2528569_2528935_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_005012919.1|2528941_2529157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012916.1|2529247_2530330_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_005012915.1|2530457_2530670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012914.1|2530817_2531060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012913.1|2531154_2531358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012912.1|2531509_2531692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012910.1|2531748_2532033_-	CsbD family protein	NA	NA	NA	NA	NA
WP_005012903.1|2532080_2532674_-	lipoprotein	NA	NA	NA	NA	NA
WP_005012901.1|2532965_2533436_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012900.1|2533432_2533885_-	low affinity iron permease family protein	NA	G1JW61	Mycobacterium_phage	36.3	8.9e-07
WP_005012896.1|2533978_2534257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012894.1|2534386_2534635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012893.1|2534763_2536725_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	29.9	2.3e-27
WP_005012891.1|2536759_2537506_-	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	31.2	7.3e-22
WP_005012888.1|2537901_2538111_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	57.1	8.6e-13
WP_005012887.1|2539991_2540996_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012885.1|2541026_2542016_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012883.1|2542043_2542787_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012882.1|2543073_2543328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685460.1|2543709_2544438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685459.1|2544468_2545035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012873.1|2545257_2545656_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012872.1|2545713_2546055_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	43.3	1.3e-13
WP_005012871.1|2546072_2548490_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_005012870.1|2548502_2549525_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012869.1|2549597_2549957_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012868.1|2549972_2550170_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_131285595.1|2550267_2550543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012866.1|2550590_2552090_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_005012863.1|2552211_2552475_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012861.1|2552534_2553755_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005011985.1|2553848_2555069_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012855.1|2555134_2555317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2555635_2556586_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP043171	Bordetella holmesii strain F589 chromosome, complete genome	3695230	2571485	2617628	3695230	transposase,protease	uncultured_Mediterranean_phage(15.38%)	39	NA	NA
WP_005012839.1|2571485_2573795_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012838.1|2573848_2575954_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012835.1|2581207_2581522_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012834.1|2581746_2581992_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012833.1|2582124_2582574_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005019101.1|2582637_2583843_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_080601032.1|2583946_2585203_-	chloride channel protein	NA	NA	NA	NA	NA
WP_101557770.1|2585275_2586395_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012829.1|2586520_2587099_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_005012828.1|2587192_2588551_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012827.1|2588903_2589488_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012826.1|2589484_2589898_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012823.1|2589894_2590929_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012822.1|2590954_2591134_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012820.1|2591148_2591913_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005019095.1|2592066_2592723_+	adenylate kinase	NA	NA	NA	NA	NA
WP_005012817.1|2592819_2593578_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005012815.1|2593637_2595197_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012814.1|2595481_2596219_+	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012813.1|2596227_2598009_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012812.1|2598032_2598410_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012811.1|2598555_2599755_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012810.1|2600966_2601446_+	sensor protein	NA	NA	NA	NA	NA
WP_005012808.1|2601527_2602478_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012807.1|2602531_2602678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012806.1|2602879_2603143_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_005012805.1|2603268_2604039_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_005012804.1|2604081_2605077_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012803.1|2606908_2607190_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_005011985.1|2607265_2608486_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012801.1|2609401_2610136_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019092.1|2610168_2610954_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012798.1|2611330_2611618_+	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005012797.1|2611614_2612283_+	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012796.1|2612329_2612620_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012795.1|2612778_2613960_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012790.1|2614015_2614957_+	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012789.1|2615066_2616404_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_101557770.1|2616507_2617628_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
>prophage 11
NZ_CP043171	Bordetella holmesii strain F589 chromosome, complete genome	3695230	2640891	2684062	3695230	tRNA,transposase,protease	Leptospira_phage(30.77%)	36	NA	NA
WP_005012067.1|2640891_2641842_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005019086.1|2642388_2643402_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012730.1|2643414_2644731_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_076879487.1|2645318_2645873_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_101557770.1|2645966_2647086_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012717.1|2647104_2647302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012715.1|2647416_2648775_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012713.1|2649449_2650556_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012711.1|2650552_2651341_-	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012709.1|2652051_2652333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2652501_2653622_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080688213.1|2653664_2654321_+	cytochrome B	NA	NA	NA	NA	NA
WP_005012704.1|2654387_2654831_-	cytochrome c	NA	NA	NA	NA	NA
WP_005012700.1|2654892_2656269_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005019071.1|2656406_2657015_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012695.1|2657090_2657912_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005012692.1|2657993_2659106_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012689.1|2659114_2660035_-	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012688.1|2660181_2661162_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012685.1|2661222_2662089_+	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012682.1|2662188_2663409_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005019066.1|2663591_2664710_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012678.1|2664711_2665026_+	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019055.1|2665022_2666468_+	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012675.1|2666464_2667715_-	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005012673.1|2667719_2668823_-	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005019053.1|2668836_2670336_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_101557770.1|2670309_2671429_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012670.1|2673187_2674408_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_005012669.1|2674492_2675566_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012668.1|2675828_2677289_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005019040.1|2677855_2678218_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012664.1|2678280_2678934_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005012663.1|2679073_2681779_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012662.1|2681787_2682807_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_101557744.1|2682941_2684062_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
