The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043174	Bordetella holmesii strain F061 chromosome, complete genome	3696827	917596	970702	3696827	transposase,protease,tRNA	Ralstonia_virus(21.43%)	52	NA	NA
WP_005012353.1|917596_918601_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005012355.1|918628_919498_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012356.1|919664_920741_+	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	1.9e-26
WP_005012357.1|920718_922479_+	putative 2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005012358.1|922510_922975_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_111118761.1|923018_923258_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_005012362.1|924375_925503_+	TIGR03364 family FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005012363.1|925544_926039_-	DUF2214 family protein	NA	NA	NA	NA	NA
WP_005012364.1|926083_926767_-	Fe2+-dependent dioxygenase	NA	A0A1D8KSK5	Synechococcus_phage	39.5	3.9e-14
WP_005018941.1|926776_928960_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005012365.1|929099_930320_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
WP_005015207.1|930441_930714_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_005015204.1|930717_931533_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_005015201.1|931626_932469_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_005015199.1|932654_934415_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	52.4	2.2e-170
WP_005019853.1|934533_935871_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005015196.1|935867_936920_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_005015195.1|936935_938414_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_005015194.1|938426_939128_-	response regulator	NA	W8CYM9	Bacillus_phage	36.6	2.8e-31
WP_005015193.1|939360_940569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015192.1|940684_942505_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	33.9	8.7e-77
WP_005015191.1|942501_943569_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.5	2.1e-06
WP_005015190.1|943492_943828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005019851.1|943859_944627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015187.1|944630_945203_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_005015184.1|945286_945832_-	crossover junction endodeoxyribonuclease RuvC	NA	A0A088FT24	Mycobacterium_phage	30.8	3.5e-05
WP_005019849.1|945831_947421_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	4.3e-64
WP_005015182.1|947486_947726_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_005015181.1|947766_948792_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005015180.1|948935_949886_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015179.1|949984_951136_-	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_005015178.1|951295_951679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015177.1|951687_953031_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_005015176.1|953188_953818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557744.1|953861_954981_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015175.1|955011_955626_+	magnesium transporting ATPase P-type 1	NA	NA	NA	NA	NA
WP_005015173.1|955612_956731_+	porin	NA	NA	NA	NA	NA
WP_005019846.1|956803_957661_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_005015171.1|957682_958522_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
WP_005015170.1|958643_960113_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_005015169.1|960125_961223_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005015168.1|961234_961657_-	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_005015167.1|961686_961890_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_005015166.1|962237_962990_+	membrane protein	NA	NA	NA	NA	NA
WP_005019837.1|962989_963481_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_032974102.1|963552_964926_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	4.0e-50
WP_005015163.1|965032_965416_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005015162.1|965414_966269_+	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_005015157.1|966291_967107_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_005015156.1|967220_968051_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015155.1|968199_969177_-	tripartite tricarboxylate transporter substrate binding protein BugD	NA	NA	NA	NA	NA
WP_005012861.1|969481_970702_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
>prophage 2
NZ_CP043174	Bordetella holmesii strain F061 chromosome, complete genome	3696827	1164339	1273185	3696827	transposase,integrase,protease,tRNA	Leptospira_phage(15.62%)	99	1246001:1246060	1267308:1267583
WP_005014796.1|1164339_1165797_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	30.0	7.5e-39
WP_005014794.1|1165807_1166452_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_005014792.1|1166485_1167451_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_005014790.1|1167468_1168518_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_005019734.1|1168602_1169862_+	aspartate kinase	NA	NA	NA	NA	NA
WP_005014784.1|1170113_1170584_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_005014781.1|1170685_1172092_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	28.2	1.5e-20
WP_005014780.1|1172107_1174201_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	55.8	2.4e-107
WP_005014779.1|1174200_1174863_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014777.1|1174879_1177240_-	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
WP_005011985.1|1177385_1178606_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014769.1|1178880_1179705_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014767.1|1179701_1180553_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014766.1|1180549_1181419_-	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014765.1|1181415_1182318_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005011985.1|1182725_1183946_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014763.1|1184249_1185803_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014760.1|1185934_1186504_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014759.1|1186625_1187834_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014755.1|1187871_1188501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014754.1|1188570_1189533_+	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014753.1|1189518_1190904_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014750.1|1190900_1192685_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014748.1|1194486_1195092_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014747.1|1195098_1195569_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014744.1|1195565_1195979_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014741.1|1196022_1196616_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014740.1|1196612_1197521_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014730.1|1197528_1198830_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014728.1|1198936_1199668_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014726.1|1199820_1201332_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014723.1|1201641_1203015_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014721.1|1203217_1204060_+	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014720.1|1204181_1205093_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005014716.1|1205248_1205434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014714.1|1205844_1206090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014709.1|1207272_1208871_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014706.1|1208867_1210052_-	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014705.1|1210061_1211477_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014704.1|1211597_1212095_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014703.1|1212147_1213005_-	DMT family transporter	NA	NA	NA	NA	NA
WP_101557770.1|1214118_1215238_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_017685964.1|1215404_1215554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014698.1|1215550_1217101_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_005019713.1|1217233_1218697_-	ribonuclease G	NA	NA	NA	NA	NA
WP_101557807.1|1219081_1220244_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005011899.1|1226326_1226521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1226648_1227768_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014621.1|1227961_1228273_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_005014618.1|1229066_1230638_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014613.1|1230700_1231036_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014610.1|1231032_1231371_-	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014607.1|1231446_1231659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|1231713_1232049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014600.1|1232032_1232353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014599.1|1232670_1232874_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014598.1|1232983_1233475_+	DUF924 family protein	NA	NA	NA	NA	NA
WP_050427733.1|1233442_1234102_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005013542.1|1234187_1234958_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341473.1|1234954_1235965_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_135238891.1|1235846_1236212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557809.1|1236250_1236517_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005014595.1|1236995_1237535_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_005014590.1|1237762_1239073_+	trigger factor	NA	NA	NA	NA	NA
WP_005014589.1|1239075_1239729_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014587.1|1239833_1241132_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014581.1|1241297_1243727_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_032974133.1|1243777_1244998_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014574.1|1245113_1245767_-	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
1246001:1246060	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_101557770.1|1246016_1247137_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879527.1|1247228_1247330_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005014572.1|1247326_1248370_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_005014566.1|1249785_1250454_-	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014564.1|1250525_1250870_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014560.1|1250981_1251155_-	OsmC family protein	NA	NA	NA	NA	NA
WP_005014556.1|1251241_1251523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032826331.1|1252556_1253492_+	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014553.1|1254034_1255237_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_017685984.1|1255311_1257342_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014551.1|1257556_1258048_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_005014547.1|1258272_1258821_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014546.1|1258842_1260054_+	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014545.1|1260090_1260495_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014544.1|1260496_1260820_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014543.1|1260823_1261330_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014539.1|1261369_1263232_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014536.1|1263241_1263583_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014534.1|1263584_1263779_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_076879495.1|1263834_1264281_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_025341421.1|1264595_1265606_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_032968029.1|1265602_1266373_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_101558036.1|1266527_1267091_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_025341181.1|1267120_1267351_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_005019683.1|1267318_1268665_-	TonB-dependent receptor	NA	NA	NA	NA	NA
1267308:1267583	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCATCGCCCCGATAGGTATTGGGCGGCCCCAGTCGGCCGCTACGCAGCAAATACTTGATGTCGTTCGTTTCATCCACGCGCACCACAGCCGCCTTGAATTTCCATCCATTGGAAAATCGGTGGGTGAGGTCGGCGAACCAAGTGTTCTGGGTTTTATACGCGTGATTCCATTTGGCGCTCAGATTGGTCGAGCGTGAATACTCCGGCATCGACCCGTCT	NA	NA	NA	NA
WP_005014518.1|1268852_1269809_-	FecR family protein	NA	NA	NA	NA	NA
WP_005014516.1|1269805_1270312_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014514.1|1270462_1271350_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014513.1|1271370_1271658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014511.1|1271670_1273185_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
>prophage 3
NZ_CP043174	Bordetella holmesii strain F061 chromosome, complete genome	3696827	1394019	1443120	3696827	transposase,tRNA,protease	Ralstonia_virus(25.0%)	48	NA	NA
WP_005014292.1|1394019_1394631_+|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
WP_005014290.1|1394651_1395503_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014289.1|1395509_1395881_-	lipoprotein	NA	NA	NA	NA	NA
WP_005014286.1|1395953_1397072_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014285.1|1397251_1398052_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014283.1|1398152_1399511_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014281.1|1399635_1399932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014278.1|1399928_1401386_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014277.1|1401489_1402203_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014275.1|1402207_1403137_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005014274.1|1403133_1403469_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014271.1|1403473_1404736_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005012353.1|1404944_1405949_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014269.1|1406097_1407954_+	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005014267.1|1408062_1408662_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014265.1|1408658_1409483_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014263.1|1409472_1409994_+	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014260.1|1410006_1413165_-	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_032954285.1|1413170_1414622_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014256.1|1414554_1415262_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_005012353.1|1416245_1417250_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014253.1|1417363_1418515_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005014250.1|1418801_1419248_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014248.1|1419276_1419909_-	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014247.1|1420084_1420501_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_076879494.1|1420497_1420785_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014242.1|1420911_1421310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014241.1|1421452_1421827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014239.1|1421839_1422283_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014237.1|1422279_1423173_-	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014235.1|1423174_1423657_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014231.1|1423687_1425139_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014229.1|1425147_1426302_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014228.1|1426298_1427237_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014227.1|1427233_1428226_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014226.1|1428222_1428894_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014223.1|1429009_1430050_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014221.1|1430046_1430733_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014215.1|1430744_1432349_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014213.1|1432308_1433175_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014212.1|1433527_1434775_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005012353.1|1434771_1435776_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014211.1|1435944_1437084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014210.1|1437170_1437821_-	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014203.1|1437891_1438359_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014202.1|1439850_1440972_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014200.1|1440968_1442210_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_005012067.1|1442169_1443120_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP043174	Bordetella holmesii strain F061 chromosome, complete genome	3696827	1761019	1871624	3696827	holin,transposase,integrase	Ralstonia_virus(25.0%)	99	1808807:1808866	1862585:1862923
WP_005013764.1|1761019_1761970_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013763.1|1761960_1763145_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005013762.1|1763224_1764142_-	FecR family protein	NA	NA	NA	NA	NA
WP_005013761.1|1764143_1764638_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005013759.1|1764780_1765761_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	29.2	5.6e-14
WP_076879523.1|1765744_1766485_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_025341443.1|1767725_1767932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013757.1|1767939_1768569_-	MarC family protein	NA	NA	NA	NA	NA
WP_005013756.1|1768863_1771068_-	TonB-dependent alcaligin siderophore receptor FauA	NA	NA	NA	NA	NA
WP_005013755.1|1771178_1772402_-	alcaligin siderophore export MFS transporter Bcr	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
WP_005013754.1|1772524_1773499_-	alcaligin siderophore biosynthesis transcriptional regulator AlcR	NA	NA	NA	NA	NA
WP_005013753.1|1773566_1774760_-	alcaligin siderophore biosynthesis protein AlcE	NA	NA	NA	NA	NA
WP_005013752.1|1774774_1775575_-	alcaligin siderophore biosynthesis protein AlcD	NA	NA	NA	NA	NA
WP_005013751.1|1775571_1777428_-	alcaligin siderophore biosynthesis protein AlcC	NA	NA	NA	NA	NA
WP_005013750.1|1777424_1778030_-	alcaligin siderophore biosynthesis protein AlcB	NA	NA	NA	NA	NA
WP_003814013.1|1778048_1779434_-	alcaligin siderophore biosynthesis protein AlcA	NA	NA	NA	NA	NA
WP_003814011.1|1781475_1782258_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_005013747.1|1782356_1783307_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814010.1|1783333_1784107_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_003814009.1|1784118_1785360_+	MFS transporter	NA	NA	NA	NA	NA
WP_005012808.1|1787011_1787962_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814007.1|1789125_1790841_+	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005013744.1|1790851_1791343_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_005013742.1|1791415_1792432_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003814004.1|1792599_1793379_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013740.1|1793397_1793916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005019401.1|1793914_1794121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013738.1|1794209_1794479_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005013736.1|1794568_1796734_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005019399.1|1796890_1797622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013735.1|1797634_1798387_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005012808.1|1798366_1799317_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_026087954.1|1799894_1800476_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005013732.1|1800814_1801762_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013731.1|1801924_1802797_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013730.1|1802810_1803737_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013729.1|1803777_1803939_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013727.1|1803898_1804849_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013726.1|1804994_1805549_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013725.1|1805631_1806852_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013724.1|1806862_1807576_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013723.1|1807613_1808735_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
1808807:1808866	attL	TGGTTCATCGAGGAATACCGGGGAATGCAGACCGGATCTTGAGGAAGAAGTACTCCTGAT	NA	NA	NA	NA
WP_005011985.1|1808810_1810031_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013722.1|1810078_1810438_-	LysE family transporter	NA	NA	NA	NA	NA
WP_005013721.1|1810518_1811067_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013720.1|1811227_1812406_+	MFS transporter	NA	NA	NA	NA	NA
WP_005013719.1|1812391_1813027_-	chorismate lyase	NA	NA	NA	NA	NA
WP_005013718.1|1813092_1813824_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013717.1|1813892_1814825_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013715.1|1815013_1816210_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013714.1|1816222_1819393_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013712.1|1819389_1820868_+	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013711.1|1820955_1821207_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013710.1|1821306_1821927_-	SCO family protein	NA	NA	NA	NA	NA
WP_005013708.1|1822284_1822800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1822796_1823747_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013707.1|1823856_1825911_-	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013706.1|1826030_1826885_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.8	1.4e-29
WP_005019390.1|1826881_1827508_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_032974136.1|1827504_1829259_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_005013703.1|1829804_1832516_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_005013702.1|1832528_1834193_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_005013701.1|1834208_1835984_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.4	3.5e-38
WP_153566129.1|1836105_1836279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013700.1|1836397_1836610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013699.1|1836782_1837763_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013698.1|1837779_1838574_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_157933265.1|1838607_1839075_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013696.1|1839691_1840345_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005013695.1|1840426_1841362_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013694.1|1841623_1841770_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_005013693.1|1841860_1842262_+	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_005013692.1|1842337_1843222_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019382.1|1843314_1844019_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013691.1|1844057_1846139_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013690.1|1846271_1847183_-	phosphoglycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	30.7	3.7e-20
WP_005013689.1|1847247_1847679_-	TonB family protein	NA	NA	NA	NA	NA
WP_005013688.1|1847781_1848780_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_005013686.1|1849023_1850007_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_005013685.1|1850123_1850405_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013684.1|1850478_1850943_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005019379.1|1851162_1851432_-	YunC family protein	NA	NA	NA	NA	NA
WP_005013682.1|1851506_1851725_+	SlyX family protein	NA	NA	NA	NA	NA
WP_005013681.1|1851750_1852533_+	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013680.1|1852571_1853069_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013679.1|1853367_1854591_+	MFS transporter	NA	NA	NA	NA	NA
WP_005013678.1|1854587_1855448_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1855666_1856887_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013677.1|1856975_1858295_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005013676.1|1858348_1860520_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013675.1|1860747_1861560_-	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005012353.1|1861635_1862640_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_101557815.1|1863705_1864826_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
1862585:1862923	attR	ATCAGGAGTACTTCTTCCTCAAGATCCGGTCTGCATTCCCCGGTATTCCTCGATGAACCATAAATCAGGGTGTGCATGCCCTCGGCCTCGAAAGCCAGGGCCGAATCCACATACTCCGACGTGGTGCCTGCCACCCGCGCGATCTCGACTCCGTCGCGGCTGATGACGACGTCGCCCTGCGGCTCGCCGACGCGCACCCAACGCAGAGTCACGCTTTTGTTATCCGTGGCCGTGCGCGTCACCAGTCTGCGCACCGCCACGGGTTCTGCCAGCGACGTGCCCGCCATGTCGTACGCGCGCGGCTCGGGCAATGCGCCCATGTGGCTCAACACGGTCGGC	NA	NA	NA	NA
WP_005013673.1|1865685_1866471_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_005013672.1|1866933_1867776_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_025341421.1|1867810_1868821_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|1868817_1869588_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_005013671.1|1870080_1870341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1870536_1871624_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
>prophage 5
NZ_CP043174	Bordetella holmesii strain F061 chromosome, complete genome	3696827	1885042	1929247	3696827	transposase,integrase,tRNA	Ralstonia_virus(20.0%)	47	1895005:1895064	1933461:1934031
WP_161992024.1|1885042_1885291_-|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_101557770.1|1885164_1886285_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013659.1|1886621_1886897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005019369.1|1886901_1888377_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013657.1|1889133_1890099_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019367.1|1890088_1892950_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013655.1|1892952_1893468_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_005013654.1|1893528_1894740_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.4	2.2e-36
1895005:1895064	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_005019364.1|1895919_1896660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013652.1|1896752_1897223_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013651.1|1897241_1897946_-	dipeptidase PepE	NA	NA	NA	NA	NA
WP_005013650.1|1897958_1898501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013649.1|1898522_1898990_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_005013648.1|1899099_1899732_+	DedA family protein	NA	NA	NA	NA	NA
WP_005013647.1|1899752_1900211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013645.1|1900252_1900702_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	62.8	2.3e-47
WP_005013644.1|1901574_1902246_-	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
WP_005013643.1|1902242_1902884_-	ectoine/hydroxyectoine ABC transporter permease subunit EhuC	NA	NA	NA	NA	NA
WP_005013642.1|1902894_1903782_-	ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB	NA	NA	NA	NA	NA
WP_005013641.1|1903950_1905114_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013640.1|1905182_1906160_-	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_005013639.1|1906279_1906702_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005013638.1|1906748_1906958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013637.1|1907005_1908781_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_005013636.1|1908809_1909079_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_005013635.1|1909141_1909540_-	PTS IIa component	NA	NA	NA	NA	NA
WP_005013634.1|1909553_1910510_-	glutathione synthase	NA	NA	NA	NA	NA
WP_076879490.1|1910675_1911224_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.3	3.8e-12
WP_005013632.1|1911244_1913197_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
WP_005013631.1|1913695_1914436_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013629.1|1914436_1915807_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_005013628.1|1915920_1916169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1916358_1916595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1916721_1916886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013626.1|1917036_1917198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013625.1|1917297_1917987_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_101557809.1|1918379_1918646_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080687433.1|1918684_1919071_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_157933264.1|1919054_1919369_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_101557807.1|1919410_1920572_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005013621.1|1921212_1921872_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_110097765.1|1921923_1922994_-	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005019353.1|1923008_1923824_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_005019351.1|1923830_1925456_-	membrane protein	NA	NA	NA	NA	NA
WP_005013618.1|1925642_1926773_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005013617.1|1926919_1927996_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005011985.1|1928026_1929247_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
1933461:1934031	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCACCATGGTTACGCCGGCCCAACAGAGCTCGGCCAGGCGCTCGGCGTGGTGGCCCAAGGCGGCATGTGGATGGGTCGATCTCTGGTAGGCCGCCTGTTACGCACGGCCCGAAATCGCGCCGGCACACCCGCGGATTGGGGCCACGCTCTGTTGACCGCACGGGAAGACACCGTCGCGCGCCACGCCTCTGCCGGTCAATCCAACGCGCAGATCGCCGAACAGCTCGGCATTACCGAACGCACCGTCAAAGCGCATCTGTCCGCGGTCTTTGAGAAAGTCGGCGTGGCAGATCGCCTGCAGTTAGCGCTATTGGTCCATGGCGTCACACCCGCCAAAACCGGCCATTGACTCAACGGCACCGCACCTCAATCGCCTGCCGGATCCATCAACGGCGGGCCTGCTCGTACAAGGGCAAAACCCGCTCTGACGCCTGCTTCAGATCCGCGATGCGTGTGCTGGCCGAGGGATGCGTGGAGAGAAACTCCGGCGAGGCCTGTCCAGTCTGGGCCGCTG	NA	NA	NA	NA
>prophage 6
NZ_CP043174	Bordetella holmesii strain F061 chromosome, complete genome	3696827	1944866	1996466	3696827	transposase,tRNA	Leptospira_phage(20.0%)	52	NA	NA
WP_025341429.1|1944866_1945874_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_005013598.1|1946030_1946999_+	homoserine kinase	NA	NA	NA	NA	NA
WP_153566127.1|1947419_1947572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013597.1|1947683_1948121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013596.1|1948117_1948912_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_153569465.1|1949088_1949844_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_101557770.1|1950495_1951616_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013592.1|1951659_1952283_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_005013591.1|1952279_1953641_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013590.1|1953640_1954396_-	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013589.1|1954460_1954865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1955089_1955629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013587.1|1955850_1957059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1957108_1958059_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013586.1|1958281_1958542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013585.1|1958803_1959211_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_005013584.1|1959207_1961547_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013583.1|1961552_1962677_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013582.1|1962724_1962856_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013581.1|1962870_1963566_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013580.1|1963809_1964343_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013579.1|1964378_1965926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013578.1|1965930_1967154_-	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013577.1|1967140_1967920_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005019317.1|1967950_1968889_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013573.1|1969007_1969730_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005013572.1|1969871_1970570_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013571.1|1970866_1971748_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013570.1|1971769_1972930_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013569.1|1972940_1973546_-	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|1973804_1975025_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013568.1|1975080_1977378_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005013567.1|1977517_1978438_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013566.1|1978444_1978996_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013565.1|1979041_1980103_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013564.1|1980443_1981139_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013563.1|1981110_1982634_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_017685641.1|1982869_1984495_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013561.1|1984968_1985187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013559.1|1985338_1986238_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013558.1|1986354_1987647_-	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013556.1|1987737_1988112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013555.1|1988121_1988619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1988648_1988780_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013552.1|1989038_1989374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1989995_1991495_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013550.1|1991601_1991847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013549.1|1991907_1992279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080601033.1|1992283_1993027_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_101557831.1|1993027_1994148_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_101557920.1|1994315_1995397_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_025341421.1|1995455_1996466_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
>prophage 7
NZ_CP043174	Bordetella holmesii strain F061 chromosome, complete genome	3696827	2307748	2375439	3696827	transposase,protease,tRNA	Ralstonia_virus(16.67%)	59	NA	NA
WP_005011985.1|2307748_2308969_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012942.1|2309596_2310025_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_005012941.1|2310053_2310500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012939.1|2310632_2312549_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_005012937.1|2312720_2315243_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_005012934.1|2315237_2315891_-	serine/threonine protein phosphatase 1	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	47.7	6.3e-54
WP_005012933.1|2316068_2317244_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_005012931.1|2317240_2317447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012930.1|2317493_2318480_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_005012927.1|2318484_2318940_-	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	48.3	2.1e-35
WP_080687431.1|2320109_2320565_-	2,5-diketo-D-gluconic acid reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.9e-20
WP_005012922.1|2320633_2322433_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.4	8.7e-45
WP_005012921.1|2322486_2322852_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_005012919.1|2322858_2323074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012916.1|2323164_2324247_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_005012915.1|2324374_2324587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012914.1|2324734_2324977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012913.1|2325071_2325275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012912.1|2325426_2325609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012910.1|2325665_2325950_-	CsbD family protein	NA	NA	NA	NA	NA
WP_005012903.1|2325997_2326591_-	lipoprotein	NA	NA	NA	NA	NA
WP_005012901.1|2326882_2327353_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012900.1|2327349_2327802_-	low affinity iron permease family protein	NA	G1JW61	Mycobacterium_phage	36.3	8.9e-07
WP_005012896.1|2327895_2328174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012894.1|2328303_2328552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012893.1|2328680_2330642_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	29.9	2.3e-27
WP_005012891.1|2330676_2331423_-	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	31.2	7.3e-22
WP_005012888.1|2331818_2332028_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	57.1	8.6e-13
WP_005012887.1|2333908_2334913_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012885.1|2334943_2335933_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012883.1|2335960_2336704_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012882.1|2336990_2337245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685460.1|2337626_2338355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685459.1|2338385_2338952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012873.1|2339174_2339573_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012872.1|2339630_2339972_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	43.3	1.3e-13
WP_005012871.1|2339989_2342407_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_005012870.1|2342419_2343442_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012869.1|2343514_2343874_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012868.1|2343889_2344087_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012866.1|2344507_2346007_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_005012863.1|2346128_2346392_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012861.1|2346451_2347672_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005011985.1|2347765_2348986_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012855.1|2349051_2349234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2349552_2350503_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012854.1|2350750_2351089_+	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012853.1|2351136_2352375_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012851.1|2352751_2353483_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012850.1|2353479_2354286_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012848.1|2354282_2355359_-	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012847.1|2355355_2356285_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012844.1|2356403_2357549_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012843.1|2357774_2361581_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012841.1|2361713_2362379_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012840.1|2362381_2364049_-	MCE family protein	NA	NA	NA	NA	NA
WP_005012839.1|2365402_2367712_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012838.1|2367765_2369871_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012835.1|2375124_2375439_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
>prophage 8
NZ_CP043174	Bordetella holmesii strain F061 chromosome, complete genome	3696827	2379192	2441003	3696827	transposase	Leptospira_phage(17.65%)	56	NA	NA
WP_101557770.1|2379192_2380312_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012829.1|2380437_2381016_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_005012828.1|2381109_2382468_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012827.1|2382820_2383405_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012826.1|2383401_2383815_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012823.1|2383811_2384846_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012822.1|2384871_2385051_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012820.1|2385065_2385830_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005019095.1|2385983_2386640_+	adenylate kinase	NA	NA	NA	NA	NA
WP_005012817.1|2386736_2387495_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005012815.1|2387554_2389114_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012814.1|2389398_2390136_+	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012813.1|2390144_2391926_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012812.1|2391949_2392327_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012811.1|2392472_2393672_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012810.1|2394883_2395363_+	sensor protein	NA	NA	NA	NA	NA
WP_005012808.1|2395444_2396395_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012807.1|2396448_2396595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012806.1|2396796_2397060_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_005012805.1|2397185_2397956_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_005012804.1|2397998_2398994_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012803.1|2400825_2401107_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_005011985.1|2401182_2402403_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012801.1|2403318_2404053_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019092.1|2404085_2404871_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012798.1|2405247_2405535_+	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005012797.1|2405531_2406200_+	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012796.1|2406246_2406537_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012795.1|2406695_2407877_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012790.1|2407932_2408874_+	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012789.1|2408983_2410321_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_101557770.1|2410424_2411545_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012786.1|2411568_2412354_-	acyltransferase	NA	NA	NA	NA	NA
WP_005012784.1|2412654_2413842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012781.1|2413978_2415823_-	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012779.1|2415842_2416910_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012777.1|2417019_2417691_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012775.1|2417807_2418317_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012772.1|2418316_2419234_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012771.1|2419255_2419984_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012769.1|2420567_2420840_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005019089.1|2421162_2422407_-	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012762.1|2422453_2423191_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005012761.1|2423298_2425719_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_026087875.1|2426126_2426747_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012755.1|2427127_2427586_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005012753.1|2427695_2428637_+	AEC family transporter	NA	NA	NA	NA	NA
WP_005012751.1|2428640_2429924_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012749.1|2430041_2431262_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012747.1|2431410_2433069_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012745.1|2434429_2434729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2434808_2435759_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005019086.1|2436305_2437319_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012730.1|2437331_2438648_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_076879487.1|2439235_2439790_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_101557770.1|2439883_2441003_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
>prophage 9
NZ_CP043174	Bordetella holmesii strain F061 chromosome, complete genome	3696827	2446418	2504612	3696827	transposase,protease,tRNA	Leptospira_phage(21.43%)	53	NA	NA
WP_101557770.1|2446418_2447539_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080688213.1|2447581_2448238_+	cytochrome B	NA	NA	NA	NA	NA
WP_005012704.1|2448304_2448748_-	cytochrome c	NA	NA	NA	NA	NA
WP_005012700.1|2448809_2450186_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005019071.1|2450323_2450932_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012695.1|2451007_2451829_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005012692.1|2451910_2453023_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012689.1|2453031_2453952_-	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012688.1|2454098_2455079_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012685.1|2455139_2456006_+	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012682.1|2456105_2457326_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005019066.1|2457508_2458627_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012678.1|2458628_2458943_+	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019055.1|2458939_2460385_+	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012675.1|2460381_2461632_-	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005012673.1|2461636_2462740_-	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005019053.1|2462753_2464253_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_101557770.1|2464226_2465346_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012670.1|2467104_2468325_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_005012669.1|2468409_2469483_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012668.1|2469745_2471206_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005019040.1|2471772_2472135_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012664.1|2472197_2472851_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005012663.1|2472990_2475696_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012662.1|2475704_2476724_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_101557744.1|2476858_2477979_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012661.1|2478172_2479582_-	threonine synthase	NA	NA	NA	NA	NA
WP_005019036.1|2479578_2480883_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012659.1|2480879_2482067_-	alanine transaminase	NA	NA	NA	NA	NA
WP_005012658.1|2482292_2482754_+	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012657.1|2482750_2483215_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012656.1|2483263_2484919_+	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012655.1|2485043_2486021_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005019033.1|2486108_2487065_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012644.1|2487141_2488515_-	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005012643.1|2488511_2489348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012642.1|2489469_2489925_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012641.1|2489939_2490212_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012639.1|2490295_2490619_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012637.1|2490695_2491070_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012636.1|2491301_2492099_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012634.1|2492259_2494131_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012631.1|2494174_2495086_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012627.1|2495094_2495331_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012626.1|2495402_2496191_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012624.1|2496269_2497241_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012623.1|2497397_2498402_+	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012620.1|2498540_2499692_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012619.1|2499889_2500456_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012613.1|2500474_2501695_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012610.1|2501822_2502671_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_005019028.1|2502702_2503557_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005012607.1|2503730_2504612_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 10
NZ_CP043174	Bordetella holmesii strain F061 chromosome, complete genome	3696827	2936642	3013702	3696827	transposase,integrase,tRNA	Ralstonia_virus(21.43%)	56	2939497:2939556	2988084:2988654
WP_005019978.1|2936642_2937422_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937444_2938392_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938393_2938594_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2938928_2940048_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2939497:2939556	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2940369_2941086_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2941082_2941976_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2942139_2943360_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943512_2944595_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2946274_2947258_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2947320_2948733_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948850_2949693_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2949971_2950580_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950595_2951216_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2951281_2951989_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2951993_2952716_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952702_2952993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2953068_2954289_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2955013_2955865_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955916_2957170_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957346_2958135_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2958254_2959169_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2959301_2961194_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961379_2962759_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2963203_2963500_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2967300_2967903_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2968036_2968495_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968496_2969096_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2969104_2969914_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969948_2970803_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970922_2971510_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971506_2972886_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973390_2973537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2981208_2982549_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982562_2983414_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983425_2984691_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984752_2986657_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988632_2989487_-	hypothetical protein	NA	NA	NA	NA	NA
2988084:2988654	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2989479_2990274_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990489_2991440_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2992042_2992840_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992879_2993533_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993513_2994578_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994741_2996967_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2997212_2999057_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2999173_3000046_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|3000092_3001793_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001855_3003055_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3003065_3003944_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3004050_3005088_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3005168_3005573_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005584_3007042_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007684_3008281_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008441_3008900_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009677_3010649_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010770_3011190_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012481_3013702_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
