The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043176	Bordetella holmesii strain D130 chromosome, complete genome	3699999	1096871	1204715	3699999	tRNA,protease,transposase	Ralstonia_virus(16.67%)	97	NA	NA
WP_005011985.1|1096871_1098092_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1098179_1098770_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1098766_1099069_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1099120_1100110_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1100230_1101112_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1101285_1102140_+	DMT family transporter	NA	NA	NA	NA	NA
WP_153569471.1|1102171_1103020_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1103147_1104368_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1104386_1104953_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1105150_1106302_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1106440_1107445_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1107601_1108573_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1108651_1109440_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1109511_1109748_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1109756_1110668_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_153569472.1|1110711_1112583_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1112743_1113541_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1113772_1114147_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1114223_1114547_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1114630_1114903_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1114917_1115373_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1115494_1116331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1116327_1117701_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1117777_1118734_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1118821_1119799_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1119923_1121579_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1121627_1122092_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1122088_1122550_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1122775_1123963_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1123959_1125264_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1125260_1126670_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1126863_1127983_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1128118_1129138_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1129146_1131852_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1131991_1132645_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1132707_1133070_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1133636_1135097_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1135359_1136433_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1136517_1137738_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1139495_1140616_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1140589_1142089_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1142102_1143206_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1143210_1144461_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1144457_1145903_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1145899_1146214_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1146215_1147334_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1147516_1148737_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1148836_1149703_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1149763_1150744_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1150890_1151811_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1151819_1152932_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1153013_1153835_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1153910_1154519_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1154656_1156033_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1156094_1156538_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1156604_1157261_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1157303_1158423_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1158592_1158874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1159584_1160373_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1160369_1161476_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1162150_1163509_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1163623_1163821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1163838_1164959_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1165052_1165607_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1166194_1167511_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1167523_1168537_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1169083_1170034_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1170113_1170413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1171773_1173432_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012067.1|1173717_1174668_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_153569473.1|1174647_1175850_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1175967_1177251_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1177254_1178196_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1178305_1178764_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1179144_1179765_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1180172_1182593_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1182700_1183438_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1183484_1184729_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1185051_1185324_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1185907_1186636_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1186657_1187575_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1187574_1188084_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1188200_1188872_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1188981_1190049_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1190068_1191913_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1192049_1193237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1193537_1194323_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1194346_1195466_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1195570_1196908_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1197017_1197959_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1198014_1199196_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1199354_1199645_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1199691_1200360_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1200356_1200644_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1201026_1201812_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1201844_1202579_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1203494_1204715_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043176	Bordetella holmesii strain D130 chromosome, complete genome	3699999	1209502	1267222	3699999	tRNA,protease,transposase	Ralstonia_virus(28.57%)	46	NA	NA
WP_005012808.1|1209502_1210453_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1210534_1211014_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1212225_1213425_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1213570_1213948_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1213971_1215753_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1215761_1216499_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1216783_1218343_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1218402_1219161_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1219257_1219914_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1220067_1220832_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1220846_1221026_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1221051_1222086_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1222082_1222496_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1222492_1223077_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1223429_1224788_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1224881_1225460_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1225584_1226705_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1226777_1228034_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1228137_1229343_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1229406_1229856_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1229988_1230234_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1230458_1230773_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1236026_1238132_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1238185_1240495_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1241848_1243516_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1243518_1244184_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1244316_1248123_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1248348_1249494_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1249612_1250542_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1250538_1251615_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1251611_1252418_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1252414_1253146_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1253522_1254761_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1254808_1255147_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1255394_1256345_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1256663_1256846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1256911_1258132_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005011985.1|1258225_1259446_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1259539_1260760_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1260819_1261083_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1261204_1262704_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1262751_1263027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1263124_1263322_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1263337_1263697_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1263769_1264792_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1264804_1267222_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP043176	Bordetella holmesii strain D130 chromosome, complete genome	3699999	1655593	1695967	3699999	tRNA,transposase,integrase	Leptospira_phage(28.57%)	39	1648035:1648051	1692652:1692668
1648035:1648051	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_101557770.1|1655593_1656713_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1657365_1658121_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1658297_1659092_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1659088_1659526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1659637_1659790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1660210_1661179_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1661335_1662343_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1662400_1662859_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1662932_1664279_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1664296_1664668_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1664667_1666137_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1666292_1667018_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013608.1|1667031_1669746_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1669997_1671362_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1671401_1672460_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1672487_1673306_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1673343_1673622_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1674885_1675185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1675754_1677158_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1677170_1677821_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1677962_1679183_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1679213_1680290_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1680436_1681567_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1681753_1683379_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1683385_1684201_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1684215_1685286_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1685337_1685997_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1686636_1687799_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1687840_1688155_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1688138_1688525_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1688563_1688830_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1689222_1689912_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1690011_1690173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1690323_1690488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1690614_1690851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1691040_1691289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1691402_1692773_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1692652:1692668	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1692773_1693514_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1694014_1695967_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 5
NZ_CP043176	Bordetella holmesii strain D130 chromosome, complete genome	3699999	1714261	1759237	3699999	tRNA,transposase,holin,integrase	Leptospira_phage(36.36%)	37	1757805:1757819	1764281:1764295
WP_005013656.1|1714261_1717123_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1717112_1718078_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1718834_1720310_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1720314_1720590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1720926_1722046_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013660.1|1722347_1723556_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1723552_1725835_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1725845_1728227_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|1728490_1729441_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013663.1|1729539_1731447_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1731461_1732352_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1732358_1733492_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1733491_1734313_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1734337_1735528_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1735829_1736111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1736276_1736597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1736636_1737723_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1737919_1738180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1738672_1739443_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1739439_1740450_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1740484_1741327_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1741789_1742575_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1743434_1744554_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1745620_1746625_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1746700_1747513_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1747740_1749912_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1749965_1751285_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1751373_1752594_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1752812_1753673_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1753669_1754893_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1755191_1755689_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1755727_1756510_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1756535_1756754_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1756828_1757098_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1757317_1757782_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1757805:1757819	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1757855_1758137_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1758253_1759237_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1764281:1764295	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 6
NZ_CP043176	Bordetella holmesii strain D130 chromosome, complete genome	3699999	1784513	1825904	3699999	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1784513_1785464_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1785460_1785976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1786333_1786954_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1787053_1787305_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1787392_1788871_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1788867_1792038_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1792050_1793247_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1793435_1794368_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1794436_1795168_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1795233_1795869_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1795854_1797033_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1797193_1797742_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1797822_1798182_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1798229_1799450_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1799525_1800647_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1800684_1801398_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1801408_1802629_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1802711_1803266_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_153569478.1|1803411_1804362_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1804321_1804483_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1804523_1805450_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1805463_1806336_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1806498_1807446_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1807784_1808366_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1808943_1809894_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1809873_1810626_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1810638_1811370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1811526_1813692_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1813781_1814051_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1814139_1814346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1814344_1814863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1814881_1815661_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1815828_1816845_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1816917_1817409_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1817419_1819135_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1820298_1821249_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1822900_1824142_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1824153_1824927_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1824953_1825904_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP043176	Bordetella holmesii strain D130 chromosome, complete genome	3699999	2153850	2213973	3699999	tRNA,protease,transposase	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2153850_2154339_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2154331_2155180_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2155271_2155769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2155906_2156266_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2156262_2156544_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2156543_2157026_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2157027_2158656_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2158652_2158997_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2158998_2161941_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2162386_2163358_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2163347_2164730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2164872_2165823_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2165782_2167024_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2167020_2168142_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2169633_2170101_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2170171_2170822_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2170908_2172048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2172216_2173221_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2173217_2174465_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2174817_2175684_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2175643_2177248_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2177259_2177946_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2177942_2178983_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2179098_2179770_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2179766_2180759_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2180755_2181694_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2181690_2182845_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2182853_2184305_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2184335_2184818_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2184819_2185713_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2185709_2186153_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2186165_2186540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2186682_2187081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2187207_2187495_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2187491_2187908_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2188083_2188716_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2188744_2189191_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2189477_2190629_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2190742_2191747_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2192730_2193438_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2193370_2194822_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2194827_2197986_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2197998_2198520_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2198509_2199334_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2199330_2199930_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2200038_2201895_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2202043_2203048_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2203256_2204519_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2204523_2204859_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2204855_2205785_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2205789_2206503_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2206606_2208064_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2208060_2208357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2208481_2209840_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2209940_2210741_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2210920_2212039_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2212111_2212483_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2212489_2213341_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2213361_2213973_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 8
NZ_CP043176	Bordetella holmesii strain D130 chromosome, complete genome	3699999	2309110	2430354	3699999	tRNA,protease,transposase,integrase	Leptospira_phage(12.5%)	106	2309093:2309152	2388617:2389860
2309093:2309152	attL	TGAATCGCCCCGGGTTTCTTAGACAGTCCCGTTCATCAAAAAGTAGCGCCGTTCGAACTC	NA	NA	NA	NA
WP_101557807.1|2309110_2310273_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2310385_2311354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2311350_2312271_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2312367_2316846_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2317224_2321559_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2322197_2322761_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2322772_2323018_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2323173_2323683_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2323728_2324709_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2324920_2327272_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2327318_2328149_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2328145_2328835_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2328827_2330108_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2330205_2331144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2331125_2332832_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2332909_2334013_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2334065_2334815_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2334821_2336336_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005014513.1|2336348_2336636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2336656_2337544_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2337694_2338201_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2338197_2339154_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2339341_2340688_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_025341181.1|2340655_2340886_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2340915_2341479_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2341633_2342404_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2342400_2343411_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2343725_2344172_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2344227_2344422_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2344423_2344765_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2344774_2346637_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2346676_2347183_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2347186_2347510_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2347511_2347916_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2347952_2349164_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2349185_2349734_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2349958_2350450_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2350664_2352695_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2352769_2353972_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2354514_2355450_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2356483_2356765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2356851_2357025_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2357136_2357481_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2357552_2358221_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2359636_2360680_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2360676_2360778_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2360869_2361989_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2362239_2362893_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
WP_032974133.1|2363008_2364229_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2364279_2366709_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2366874_2368173_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2368277_2368931_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2368933_2370244_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2370471_2371011_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2371489_2371756_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2371794_2372160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2372041_2373052_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2373048_2373819_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2373904_2374564_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2374531_2375023_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2375132_2375336_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2375653_2375974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2375957_2376293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2376347_2376560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2376635_2376974_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_017685558.1|2376961_2377306_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2377368_2378940_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2379733_2380045_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_005011899.1|2381218_2381413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2387495_2388657_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2389042_2390506_+	ribonuclease G	NA	NA	NA	NA	NA
2388617:2389860	attR	GAGTTCGAACGGCGCTACTTTTTGATGAACGGGACTGTCTAAGAAACCCGGGGCGATTCAGGAATCCCGGCCGGCTCTTCGCCTAATCCTCACTCCCCGTGTTCGAAATCACTTCCCGCTTCCTGCGCCCCGCTCATGCGGCAATCGCCTCGGAAACCGAAAAACCAATCTCGCTTCGGTCCTCACTACACCGACTGCGTTGCATCTGCGTTGCTGTCTGTGCTGCGAGGGGGCGAACTATAGCATAGAAAAAAATCGTGTGTCACGGCTTTGACACCTTTTTTATAAAAAACCTGTTTTTTCTTCCTCACGACGCCGTACAGGCTGGTCAGCAGGCGCATTTTCCTCCTCCACACCGGGGCTGTTGCCTGCGCCGCAGCGACTTACGCTACCCTAGCGCATCCCTATATATAGACACGGACAACAATGACTGAAAACATTCTGATCAACGTCACGCCTTTTGAAACCCGTGTTGCCATCGTCGCGCAGGGCGCGGTGCAGGAATTGCATGTCGAGCGCAGTGTTCAGCGCGGCCATGTGGGCAATATCTACCTGGGCCGGGTGGTTCGTGTGTTGCCAGGTATGCAGAGCGCGTTTATTGATATTGGTCTGGAACGTGCCGCCTTCATCCACATCGCCGATTTGAGAGAAAATCGGCAAGAGCGCAGCCAGGGCGTCAATCCGACCCCTATAGAGAAGCTGCTGTTCGAAGGGCAGACCTTGATGGTCCAGGTCATCAAGGATCCGCTGGGCACCAAAGGTGCCCGCCTGTCCACCCAGATCAGCATTGCCGGCCGCATGCTGGTTTATTTGCCGCATGACCCGCATATCGGGATTTCGCAGAAGATCGATTCCGAAGCCGAACGCACCCAGTTGCGCGAGCGCGTCCACGCCCTGGTGCCCGAGGGCGAGAAAGGCGGTTTCATCGTCCGTACCCAGGCCGAGGGTGCCAACGATGAAGAGCTGGCCGCGGATCTGGAGTATTTGCGCAAGCTTTGGGCCAGCGTACAGGCGGCCGCCCGCAGCCAGCCCGCCCCCACCATGTTGCACCAGGATTTGACCCTGGCGCAGCGCGTCTTGCGCGACATGGCCGGCCCCTCCACCGGCGTCATTCAGGTGGACTCACGCAGCACGACGGCGGCGCTGCTCGAGTGGGGCAAGACGTACACCCCCTCCGTGCTGTCGCGAATCCGCCATTACAGCGGCGAACGCCCCCTGTTTGACACGGCCAGCGTGGACGAGGA	NA	NA	NA	NA
WP_005014698.1|2390638_2392189_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2392185_2392335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2392500_2393621_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2394734_2395592_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2395644_2396142_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2396262_2397678_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2397687_2398872_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2398868_2400467_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_050557407.1|2400562_2401681_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_005014714.1|2401649_2401895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2402305_2402491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2402646_2403558_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2403679_2404522_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2404724_2406098_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2406407_2407919_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2408071_2408803_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2408909_2410211_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2410218_2411127_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2411123_2411717_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2411760_2412174_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2412170_2412641_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2412647_2413253_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2415054_2416839_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2416835_2418221_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2418206_2419169_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2419238_2419868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2419905_2421114_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2421235_2421805_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2421936_2423490_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_032974133.1|2423793_2425014_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014765.1|2425421_2426324_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2426320_2427190_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2427186_2428038_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2428034_2428859_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2429133_2430354_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 9
NZ_CP043176	Bordetella holmesii strain D130 chromosome, complete genome	3699999	2629700	2677326	3699999	tRNA,protease,transposase	Bacillus_phage(25.0%)	47	NA	NA
WP_005015146.1|2629700_2630453_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_005015148.1|2630495_2631215_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005015150.1|2631257_2632313_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_101557744.1|2633322_2634442_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015154.1|2635002_2635581_-	TIGR01841 family phasin	NA	NA	NA	NA	NA
WP_005012861.1|2635723_2636944_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005015155.1|2637248_2638226_+	tripartite tricarboxylate transporter substrate binding protein BugD	NA	NA	NA	NA	NA
WP_005015156.1|2638374_2639205_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015157.1|2639318_2640134_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_005015162.1|2640156_2641011_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_005015163.1|2641009_2641393_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005015164.1|2641499_2642873_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	1.8e-50
WP_005019837.1|2642944_2643436_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_005015166.1|2643435_2644188_-	membrane protein	NA	NA	NA	NA	NA
WP_005015167.1|2644535_2644739_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_005015168.1|2644768_2645191_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_005015169.1|2645202_2646300_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005015170.1|2646312_2647782_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_005015171.1|2647903_2648743_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
WP_005015172.1|2648764_2649622_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_005015173.1|2649694_2650813_-	porin	NA	NA	NA	NA	NA
WP_005015175.1|2650799_2651414_-	magnesium transporting ATPase P-type 1	NA	NA	NA	NA	NA
WP_101557744.1|2651443_2652564_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015176.1|2652607_2653237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015177.1|2653394_2654738_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_005015178.1|2654746_2655130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015179.1|2655289_2656441_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_005015180.1|2656539_2657490_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015181.1|2657633_2658659_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005015182.1|2658699_2658939_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_005019849.1|2659004_2660594_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	4.3e-64
WP_005015184.1|2660593_2661139_+	crossover junction endodeoxyribonuclease RuvC	NA	A0A088FT24	Mycobacterium_phage	30.8	3.5e-05
WP_005015187.1|2661222_2661795_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_005019851.1|2661798_2662566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153569480.1|2662597_2662933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015191.1|2662856_2663924_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.5	2.1e-06
WP_005015192.1|2663920_2665741_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	33.9	8.7e-77
WP_005015193.1|2665856_2667065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015194.1|2667297_2667999_+	response regulator	NA	W8CYM9	Bacillus_phage	36.6	2.8e-31
WP_005015195.1|2668011_2669490_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_005015196.1|2669505_2670558_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_005019853.1|2670554_2671892_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005015199.1|2672010_2673771_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	52.4	2.2e-170
WP_005015201.1|2673956_2674799_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_005015204.1|2674892_2675708_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_005015207.1|2675711_2675984_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_005012365.1|2676105_2677326_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
>prophage 10
NZ_CP043176	Bordetella holmesii strain D130 chromosome, complete genome	3699999	2939812	3016872	3699999	tRNA,transposase,integrase	Ralstonia_virus(21.43%)	56	2942667:2942726	2991254:2991824
WP_005019978.1|2939812_2940592_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2940614_2941562_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2941563_2941764_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2942098_2943218_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2942667:2942726	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2943539_2944256_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2944252_2945146_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2945309_2946530_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2946682_2947765_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2949444_2950428_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2950490_2951903_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2952020_2952863_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2953141_2953750_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2953765_2954386_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2954451_2955159_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2955163_2955886_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2955872_2956163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2956238_2957459_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2958183_2959035_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2959086_2960340_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2960516_2961305_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2961424_2962339_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2962471_2964364_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2964549_2965929_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2966373_2966670_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2970470_2971073_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2971206_2971665_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2971666_2972266_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2972274_2973084_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2973118_2973973_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2974092_2974680_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2974676_2976056_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2976560_2976707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2984378_2985719_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2985732_2986584_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2986595_2987861_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2987922_2989827_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2991802_2992657_-	hypothetical protein	NA	NA	NA	NA	NA
2991254:2991824	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2992649_2993444_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2993659_2994610_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2995212_2996010_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2996049_2996703_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2996683_2997748_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2997911_3000137_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|3000382_3002227_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|3002343_3003216_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|3003262_3004963_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3005025_3006225_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3006235_3007114_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3007220_3008258_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3008338_3008743_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3008754_3010212_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3010854_3011451_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3011611_3012070_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3012847_3013819_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3013940_3014360_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3015651_3016872_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
