The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	0	47865	4581492	transposase	Streptococcus_phage(14.29%)	51	NA	NA
WP_001018417.1|556_1519_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000362028.1|2133_2691_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_120795375.1|2670_2790_-	protein YkiC	NA	NA	NA	NA	NA
WP_000860444.1|2814_4011_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_153676249.1|4170_5397_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000012218.1|5460_5904_+	transferase	NA	NA	NA	NA	NA
WP_000596084.1|5905_6679_+	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_001141271.1|6866_7142_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000842106.1|7176_8286_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	8.9e-32
WP_000419081.1|8379_9213_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001096705.1|9436_9976_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_000107627.1|10077_11289_-	3-(3-hydroxy-phenyl)propionate transporter	NA	NA	NA	NA	NA
WP_001013499.1|11866_12880_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_000044314.1|12876_13827_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_074442156.1|13823_14183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153676250.1|14390_15407_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	2.2e-186
WP_001254938.1|17753_18905_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_000770246.1|19325_20219_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001065553.1|20547_21411_+	GTPase family protein	NA	NA	NA	NA	NA
WP_000197389.1|21502_22324_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001548158.1|22727_22955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|22954_23398_+	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001547765.1|23420_23888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194654.1|23964_24204_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000211838.1|24301_24760_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000811693.1|24775_25252_+	RadC family protein	NA	NA	NA	NA	NA
WP_000691994.1|25260_25482_+	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000070395.1|25500_25818_+	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000854672.1|25838_26180_+	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000893278.1|26751_28005_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001285288.1|28016_29120_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_001352368.1|29873_31082_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001339197.1|32055_33264_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000189532.1|33636_34881_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|34972_35431_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|35691_37149_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001326471.1|37205_37742_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001295202.1|37674_37941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059892.1|38246_38699_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263489.1|38708_39107_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554758.1|39109_39403_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|39454_40510_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207552.1|40580_41366_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001334802.1|41310_43050_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|43273_43771_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000056849.1|43946_44696_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000729703.1|44905_45166_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615983.1|45168_45447_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|45602_46343_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|46313_47081_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|47286_47865_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 2
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	54603	62235	4581492		Bradyrhizobium_phage(25.0%)	9	NA	NA
WP_001340895.1|54603_55335_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_000917883.1|55399_55867_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001326702.1|55863_56586_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|56619_57375_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|57446_58805_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000016007.1|58852_59476_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001230983.1|59479_60280_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|60520_61435_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|61431_62235_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
>prophage 3
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	68747	69779	4581492		Planktothrix_phage(100.0%)	1	NA	NA
WP_000594006.1|68747_69779_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
>prophage 4
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	82784	86900	4581492		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294757.1|82784_86267_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|86303_86900_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
>prophage 5
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	95728	96487	4581492		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|95728_96487_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 6
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	109084	110509	4581492	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|109084_110509_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 7
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	114438	114783	4581492		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|114438_114783_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 8
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	120817	121615	4581492		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158931.1|120817_121615_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	2.7e-14
>prophage 9
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	126856	133662	4581492	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_001350480.1|126856_129286_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.1	1.3e-38
WP_001294700.1|129359_129890_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396036.1|129904_130609_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|130786_131242_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937424.1|131278_132205_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174643.1|132243_133662_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 10
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	143520	144423	4581492		Sodalis_phage(100.0%)	1	NA	NA
WP_000339954.1|143520_144423_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	7.4e-61
>prophage 11
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	147685	154308	4581492		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150637.1|147685_148612_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|148720_149383_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|149423_149960_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_001306211.1|150165_152556_+	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_001189647.1|152757_154308_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 12
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	162054	163479	4581492		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|162054_163479_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 13
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	171852	172404	4581492		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|171852_172404_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 14
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	203782	205507	4581492		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001295534.1|203782_205507_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.4e-36
>prophage 15
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	218209	218908	4581492		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916281.1|218209_218908_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	3.6e-23
>prophage 16
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	225356	230779	4581492		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035670.1|225356_227708_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
WP_001117011.1|227872_230779_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 17
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	239914	241314	4581492		Microcystis_phage(50.0%)	2	NA	NA
WP_000257192.1|239914_240757_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
WP_000624375.1|240834_241314_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 18
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	249201	254772	4581492		Vibrio_phage(50.0%)	4	NA	NA
WP_000787103.1|249201_250716_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_000347117.1|250746_251889_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349936.1|252017_253235_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_153676267.1|253308_254772_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	26.6	1.3e-30
>prophage 19
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	260239	261388	4581492		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|260239_261388_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 20
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	265831	268648	4581492	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286857.1|265831_268648_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 21
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	272383	282801	4581492	transposase	uncultured_Caudovirales_phage(20.0%)	10	NA	NA
WP_000681354.1|272383_273550_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.5	3.4e-90
WP_000935262.1|274078_274288_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001300563.1|274481_275594_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001118476.1|275740_276871_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	37.1	1.4e-27
WP_000516135.1|276959_278876_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843565.1|279252_279657_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102368.1|279682_280396_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|280544_281111_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001295414.1|281145_281733_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130185.1|281847_282801_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 22
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	294570	296684	4581492		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_001219559.1|294570_295995_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	1.2e-09
WP_001188654.1|295994_296684_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	34.8	3.3e-29
>prophage 23
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	300020	305376	4581492		Bacillus_phage(33.33%)	3	NA	NA
WP_000409451.1|300020_301958_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|302168_303836_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093814.1|304143_305376_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	3.6e-82
>prophage 24
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	313139	314462	4581492		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477807.1|313139_314462_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.4e-79
>prophage 25
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	320401	323277	4581492		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|320401_320563_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|320689_321295_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175940.1|321687_323277_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
>prophage 26
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	331172	332452	4581492		Salmonella_phage(50.0%)	2	NA	NA
WP_000098818.1|331172_331712_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|331714_332452_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 27
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	335677	341033	4581492		Tupanvirus(50.0%)	4	NA	NA
WP_000106030.1|335677_336700_-	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
WP_000091570.1|336838_337753_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000410113.1|337967_339329_+	MFS transporter	NA	NA	NA	NA	NA
WP_000919536.1|339377_341033_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 28
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	371204	371759	4581492		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151855.1|371204_371759_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 29
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	378324	379785	4581492		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208205.1|378324_379785_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	4.7e-49
>prophage 30
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	390052	392505	4581492		Escherichia_phage(100.0%)	2	NA	NA
WP_038404959.1|390052_390667_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	52.9	8.9e-50
WP_000790589.1|391902_392505_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.8	3.1e-55
>prophage 31
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	395867	396848	4581492		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000991438.1|395867_396848_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.6	4.7e-101
>prophage 32
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	421047	425996	4581492	transposase	uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_000684852.1|421047_422004_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	8.2e-18
WP_000175457.1|422004_422772_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|423328_423586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|424844_425996_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 33
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	437249	438269	4581492		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001309160.1|437249_438269_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.1e-44
>prophage 34
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	443395	452477	4581492	tRNA	Klebsiella_phage(33.33%)	6	NA	NA
WP_001294571.1|443395_444898_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.2	3.6e-84
WP_001295681.1|445058_446141_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584122.1|446140_447241_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|447507_449019_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786400.1|449178_449622_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416366.1|449621_452477_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	3.0e-140
>prophage 35
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	461058	465829	4581492		Paramecium_bursaria_Chlorella_virus(100.0%)	4	NA	NA
WP_000013046.1|461058_461994_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|462006_462468_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|462540_462927_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471889.1|463132_465829_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
>prophage 36
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	470793	473554	4581492		Vibrio_phage(50.0%)	2	NA	NA
WP_000187778.1|470793_472932_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106233.1|473089_473554_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
>prophage 37
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	477844	484332	4581492		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|477844_478843_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596014.1|478875_479871_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001313531.1|479857_480880_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205825.1|480893_482396_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265913.1|482535_483492_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|483801_484332_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
>prophage 38
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	520035	521199	4581492		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943959.1|520035_521199_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	6.4e-81
>prophage 39
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	525131	538162	4581492	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
WP_000076344.1|525131_527573_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	3.8e-67
WP_001177639.1|527611_528037_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|528241_529540_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|529643_529841_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|529922_530927_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312486.1|530929_532189_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460362.1|532274_533555_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|533630_533939_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|534024_534975_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122505.1|534967_536815_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000990333.1|536824_538162_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 40
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	542077	542623	4581492		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|542077_542623_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 41
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	550606	551584	4581492		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|550606_551584_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 42
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	556504	557038	4581492		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|556504_557038_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 43
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	561555	563539	4581492		Vibrio_phage(50.0%)	2	NA	NA
WP_000729122.1|561555_563202_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|563245_563539_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 44
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	577815	581027	4581492	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856829.1|577815_579273_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
WP_001295074.1|579509_581027_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 45
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	602222	603725	4581492		Burkholderia_virus(100.0%)	1	NA	NA
WP_001298520.1|602222_603725_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 46
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	609061	609850	4581492		Cedratvirus(100.0%)	1	NA	NA
WP_001193409.1|609061_609850_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	6.5e-13
>prophage 47
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	615462	617012	4581492		Bacillus_virus(50.0%)	2	NA	NA
WP_001075514.1|615462_616221_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-16
WP_000611405.1|616331_617012_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
>prophage 48
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	623246	629615	4581492		Bacillus_virus(50.0%)	5	NA	NA
WP_000235257.1|623246_624779_+	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.4	4.4e-13
WP_000507106.1|624757_625738_+	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_001311314.1|625748_626444_+	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001171687.1|626427_627357_+	allose kinase	NA	NA	NA	NA	NA
WP_001066019.1|627629_629615_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	4.2e-149
>prophage 49
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	634860	637008	4581492		Escherichia_phage(100.0%)	1	NA	NA
WP_014639053.1|634860_637008_+	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	25.2	3.6e-29
>prophage 50
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	646631	648590	4581492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078242.1|646631_648590_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.2	5.7e-90
>prophage 51
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	654165	655515	4581492		Moraxella_phage(100.0%)	1	NA	NA
WP_000108043.1|654165_655515_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	2.3e-159
>prophage 52
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	659332	662945	4581492		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|659332_659869_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|660122_662945_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
>prophage 53
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	667123	669671	4581492		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_001147328.1|667123_668203_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918362.1|668255_669671_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 54
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	676256	676865	4581492		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|676256_676865_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 55
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	686073	687189	4581492		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|686073_687189_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 56
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	706461	710145	4581492		Dickeya_phage(100.0%)	1	NA	NA
WP_000095994.1|706461_710145_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 57
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	726436	728026	4581492		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187559.1|726436_728026_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	2.9e-68
>prophage 58
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	733415	735179	4581492		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|733415_733688_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940106.1|733874_734465_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362388.1|734507_735179_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 59
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	744395	752724	4581492		Vibrio_phage(50.0%)	2	NA	NA
WP_000653934.1|744395_748619_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	6.5e-67
WP_000263098.1|748695_752724_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 60
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	758938	759889	4581492		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000023081.1|758938_759889_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 61
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	768477	770322	4581492		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591359.1|768477_770322_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 62
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	787668	794915	4581492		Serratia_phage(33.33%)	5	NA	NA
WP_000184811.1|787668_789966_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|790016_790337_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|790351_791431_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001174077.1|791739_794241_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424840.1|794252_794915_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 63
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	812213	816716	4581492		Erwinia_phage(50.0%)	5	NA	NA
WP_001293341.1|812213_813545_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|813611_814538_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|814630_815116_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|815200_815446_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|815870_816716_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 64
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	828290	833151	4581492		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033722.1|828290_828989_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|828985_830359_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270260.1|830464_831139_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|831287_832271_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_000122641.1|832530_833151_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
>prophage 65
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	848138	851189	4581492		Escherichia_phage(100.0%)	1	NA	NA
WP_014639055.1|848138_851189_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	6.5e-08
>prophage 66
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	858506	861286	4581492		Escherichia_phage(50.0%)	3	NA	NA
WP_000059678.1|858506_859292_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_000621656.1|859325_860222_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000718893.1|860389_861286_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 67
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	877621	880092	4581492		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|877621_878671_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001188777.1|878682_880092_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 68
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	884208	886995	4581492		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|884208_886995_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 69
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	900827	901442	4581492		Streptococcus_phage(100.0%)	1	NA	NA
WP_001308167.1|900827_901442_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	2.8e-19
>prophage 70
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	910421	913708	4581492		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|910421_911198_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|911200_911716_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|911719_911989_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|912067_913708_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 71
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	926240	928070	4581492		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|926240_928070_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 72
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	933786	937645	4581492		Bacillus_phage(100.0%)	3	NA	NA
WP_000383406.1|933786_935949_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001213584.1|936032_936749_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130691.1|936748_937645_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 73
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	947924	949580	4581492		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395863.1|947924_949580_+	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	2.3e-44
>prophage 74
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	957655	963799	4581492		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612043.1|957655_958786_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145183.1|958790_959465_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|959442_960324_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226601.1|960342_961410_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	2.3e-101
WP_000006621.1|961409_962672_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001340422.1|962668_963799_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.9e-27
>prophage 75
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	967841	973255	4581492		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|967841_968171_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|968301_969567_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001295254.1|969702_971187_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238899.1|971233_973255_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.2e-113
>prophage 76
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	996754	1002607	4581492		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056271.1|996754_997645_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	2.5e-05
WP_000211858.1|997669_998635_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387770.1|998639_1000145_-	ribose ABC transporter ATP-binding protein RbsA	NA	G3M9Y6	Bacillus_virus	27.7	5.1e-14
WP_001301979.1|1000152_1000572_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102319.1|1000738_1002607_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 77
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1005775	1006768	4581492		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845104.1|1005775_1006768_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 78
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1018722	1026330	4581492		Chrysochromulina_ericina_virus(25.0%)	6	NA	NA
WP_046613183.1|1018722_1020093_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334099.1|1020254_1022084_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_000867146.1|1022397_1023438_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|1023524_1024484_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251998.1|1024483_1025374_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|1025556_1026330_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 79
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1037313	1038651	4581492		Moraxella_phage(100.0%)	1	NA	NA
WP_000019348.1|1037313_1038651_+	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 80
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1048849	1056218	4581492		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|1048849_1049107_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|1049070_1049430_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|1049446_1049587_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|1049816_1049897_-	protein YsdD	NA	NA	NA	NA	NA
WP_000059111.1|1050193_1051597_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|1051601_1052702_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|1052701_1053775_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072067.1|1053803_1056218_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 81
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1060924	1062073	4581492		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|1060924_1062073_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 82
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1066500	1067454	4581492		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|1066500_1066914_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|1067025_1067454_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 83
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1073806	1082827	4581492		Aeromonas_phage(25.0%)	10	NA	NA
WP_001087145.1|1073806_1075522_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
WP_000828527.1|1075518_1077012_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.6	2.3e-30
WP_000511289.1|1077058_1077508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000703959.1|1077615_1077963_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|1077952_1078315_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148061.1|1078311_1078809_+	radical SAM protein	NA	NA	NA	NA	NA
WP_000828746.1|1078816_1080001_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_001054909.1|1080280_1080370_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001300753.1|1080934_1081033_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168475.1|1081138_1082827_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	3.2e-57
>prophage 84
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1090133	1091468	4581492		Moraxella_phage(100.0%)	1	NA	NA
WP_001403836.1|1090133_1091468_+	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	1.1e-65
>prophage 85
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1103586	1104978	4581492		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|1103586_1104978_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 86
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1109414	1116163	4581492		Bordetella_phage(25.0%)	6	NA	NA
WP_000280488.1|1109414_1111523_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|1111541_1111817_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|1111871_1112495_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000870036.1|1112752_1114435_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	1.5e-22
WP_000924289.1|1114431_1115049_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001350563.1|1115338_1116163_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	78.9	1.0e-96
>prophage 87
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1119536	1124099	4581492		Xanthomonas_phage(25.0%)	7	NA	NA
WP_000976073.1|1119536_1119995_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	1.2e-48
WP_000050139.1|1119972_1121193_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001350561.1|1121364_1122033_+	RadC family protein	NA	NA	NA	NA	NA
WP_000091955.1|1122249_1122486_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|1122506_1122674_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114543.1|1122771_1123581_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_046613194.1|1123619_1124099_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	3.7e-27
>prophage 88
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1138982	1149711	4581492		Synechococcus_phage(16.67%)	10	NA	NA
WP_000587764.1|1138982_1139915_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
WP_000842820.1|1140218_1141076_+	protein YibB	NA	NA	NA	NA	NA
WP_001213834.1|1141350_1142547_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000646007.1|1142556_1143582_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982115.1|1143820_1144855_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000483847.1|1144841_1145801_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|1145804_1147088_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_001350558.1|1147097_1148642_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|1148886_1149318_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|1149459_1149711_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 89
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1174036	1175881	4581492		Tupanvirus(100.0%)	1	NA	NA
WP_000582468.1|1174036_1175881_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.7	5.6e-15
>prophage 90
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1200155	1201697	4581492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146473.1|1200155_1201697_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	3.3e-16
>prophage 91
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1207015	1208011	4581492		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182650.1|1207015_1208011_-	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 92
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1211848	1213849	4581492	transposase	Macacine_betaherpesvirus(50.0%)	3	NA	NA
WP_085947770.1|1211848_1213218_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001135732.1|1213297_1213450_+	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_000014594.1|1213636_1213849_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 93
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1217503	1219837	4581492		Escherichia_phage(100.0%)	1	NA	NA
WP_000013950.1|1217503_1219837_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	2.7e-70
>prophage 94
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1230049	1232034	4581492		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196486.1|1230049_1231033_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
WP_000107012.1|1231029_1232034_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
>prophage 95
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1277937	1278585	4581492		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|1277937_1278585_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 96
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1283155	1285290	4581492		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065769.1|1283155_1283581_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
WP_000922639.1|1283593_1284883_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000008957.1|1284936_1285290_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 97
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1288635	1290678	4581492		Indivirus(100.0%)	1	NA	NA
WP_001298719.1|1288635_1290678_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 98
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1304275	1307011	4581492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149156.1|1304275_1307011_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
>prophage 99
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1310385	1316037	4581492		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_000015298.1|1310385_1314621_-	rhs element protein RhsB	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	7.3e-26
WP_001190062.1|1314823_1315225_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173631.1|1315230_1316037_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.6e-17
>prophage 100
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1323930	1328062	4581492		Dickeya_phage(50.0%)	4	NA	NA
WP_001100469.1|1323930_1324596_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
WP_000130621.1|1324816_1325062_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106551.1|1325163_1327362_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.4	8.5e-119
WP_000964718.1|1327435_1328062_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 101
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1331065	1333884	4581492		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617723.1|1331065_1331734_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042003.1|1331726_1332785_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|1333029_1333884_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 102
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1339606	1341089	4581492		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082101.1|1339606_1340374_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416891.1|1340375_1341089_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	7.0e-14
>prophage 103
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1344632	1346443	4581492		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907807.1|1344632_1345703_+	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.2	1.4e-18
WP_000073622.1|1345699_1346443_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.9	1.3e-10
>prophage 104
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1367230	1369678	4581492		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|1367230_1369678_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 105
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1375733	1376960	4581492		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105504.1|1375733_1376960_+	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	4.0e-134
>prophage 106
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1381339	1383733	4581492		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|1381339_1383733_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 107
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1389767	1390646	4581492		Sodalis_phage(100.0%)	1	NA	NA
WP_000039062.1|1389767_1390646_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 108
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1397228	1400995	4581492		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|1397228_1397948_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253696.1|1397944_1399297_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001265681.1|1399372_1400995_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 109
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1417899	1418736	4581492		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|1417899_1418736_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 110
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1442983	1452524	4581492		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601847.1|1442983_1443547_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
WP_000963792.1|1443632_1444853_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001295162.1|1444919_1447010_-	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242755.1|1447060_1447693_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|1447994_1448399_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274680.1|1448453_1449323_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|1449376_1449595_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057356.1|1449588_1450611_-	hydrolase	NA	NA	NA	NA	NA
WP_000634798.1|1450610_1452524_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
>prophage 111
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1458094	1466653	4581492		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_001209680.1|1458094_1458481_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
WP_000820714.1|1458480_1458840_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_000903373.1|1458847_1459135_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|1459260_1459635_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138045.1|1459731_1460271_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|1460298_1462413_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|1462483_1463668_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000773156.1|1463959_1466653_+	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	8.7e-41
>prophage 112
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1475483	1477436	4581492		Vibrio_phage(100.0%)	1	NA	NA
WP_001326512.1|1475483_1477436_-	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	9.2e-32
>prophage 113
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1498651	1500123	4581492	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004473.1|1498651_1499599_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|1499613_1500123_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 114
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1510617	1511376	4581492		Bacillus_virus(100.0%)	1	NA	NA
WP_000078349.1|1510617_1511376_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
>prophage 115
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1521274	1522159	4581492		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258895.1|1521274_1522159_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.9e-24
>prophage 116
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1532724	1533768	4581492		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|1532724_1533768_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 117
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1550544	1553069	4581492	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|1550544_1551612_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|1551701_1553069_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 118
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1557035	1557533	4581492	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|1557035_1557533_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 119
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1561237	1565985	4581492		Burkholderia_virus(50.0%)	5	NA	NA
WP_000108454.1|1561237_1562728_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	6.4e-09
WP_000054239.1|1562775_1563465_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000209011.1|1563461_1564337_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000979882.1|1564333_1564798_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000445111.1|1564857_1565985_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
>prophage 120
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1579759	1594554	4581492		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001299745.1|1579759_1580689_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809774.1|1580784_1583121_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001300411.1|1583350_1584004_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047091.1|1584000_1584729_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620405.1|1584725_1585358_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|1585571_1585844_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|1585840_1586695_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|1586740_1587232_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|1587349_1587637_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809057.1|1587659_1589093_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|1589140_1589866_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|1589872_1590430_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|1590398_1590974_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030005.1|1590970_1591537_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001295557.1|1591557_1592544_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922901.1|1592557_1593535_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|1593744_1594554_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 121
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1598622	1600100	4581492		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|1598622_1598901_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047336.1|1599128_1600100_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 122
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1606874	1609747	4581492	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|1606874_1608809_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|1608898_1609747_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 123
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1613829	1620468	4581492		Dickeya_phage(50.0%)	4	NA	NA
WP_000207680.1|1613829_1615173_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|1615803_1616256_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031057.1|1616283_1617771_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133044.1|1617795_1620468_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 124
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1625949	1627839	4581492		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|1625949_1627839_+	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 125
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1633541	1641335	4581492		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189333.1|1633541_1633844_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	53.8	7.8e-15
WP_000449030.1|1633894_1634338_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|1634317_1634836_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001300423.1|1634963_1635599_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147574.1|1635671_1636712_+	permease	NA	NA	NA	NA	NA
WP_000646033.1|1636825_1637401_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158034.1|1637410_1638001_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246830.1|1638020_1638416_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249104.1|1638373_1640410_-	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000809262.1|1640474_1641335_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
>prophage 126
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1662039	1663185	4581492		Streptococcus_phage(100.0%)	1	NA	NA
WP_001300387.1|1662039_1663185_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 127
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1671374	1673669	4581492		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|1671374_1673669_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 128
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1694247	1695213	4581492		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|1694247_1695213_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 129
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1708067	1724263	4581492	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_001082856.1|1708067_1711160_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	2.5e-156
WP_000212475.1|1711343_1712327_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450594.1|1712545_1712878_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000627220.1|1712919_1714410_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-33
WP_000094721.1|1714716_1716237_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_000018003.1|1716390_1717014_-	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_001066494.1|1717301_1718066_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000228937.1|1718319_1718826_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437376.1|1718904_1720746_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	1.1e-34
WP_000918827.1|1720940_1722686_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|1722796_1723012_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264352.1|1723249_1724263_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 130
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1730662	1731901	4581492	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708487.1|1730662_1731901_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
>prophage 131
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1737038	1738472	4581492		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|1737038_1738472_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 132
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1746376	1760286	4581492	transposase	Shigella_phage(16.67%)	15	NA	NA
WP_153676254.1|1746376_1747603_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	1.1e-173
WP_001272145.1|1747824_1748376_-	fimbrial-like protein	NA	NA	NA	NA	NA
WP_001295626.1|1748659_1748950_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_001076997.1|1749323_1749977_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|1750238_1750409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295627.1|1750466_1751240_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000188362.1|1751355_1752171_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442860.1|1752208_1753369_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|1753374_1754046_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|1754193_1755675_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|1755879_1756509_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|1756509_1756932_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444737.1|1756956_1757784_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|1757783_1758365_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195296.1|1758393_1760286_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
>prophage 133
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1764113	1764506	4581492		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|1764113_1764506_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 134
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1767816	1777167	4581492		Bacillus_virus(33.33%)	6	NA	NA
WP_001281881.1|1767816_1770075_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000965722.1|1770308_1771046_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000095187.1|1772643_1774863_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848528.1|1774905_1775163_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000691619.1|1775213_1776140_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013149.1|1776339_1777167_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 135
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1783243	1784128	4581492		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018764.1|1783243_1784128_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	2.2e-65
>prophage 136
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1802595	1803612	4581492	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_153676250.1|1802595_1803612_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	2.2e-186
>prophage 137
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1845929	1847084	4581492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|1845929_1847084_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 138
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1875379	1876612	4581492		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|1875379_1876612_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 139
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1884748	1890122	4581492		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_000195062.1|1884748_1887622_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.2e-263
WP_000951964.1|1887888_1888632_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001336277.1|1888688_1890122_-	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.3	2.0e-31
>prophage 140
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1894046	1909439	4581492	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000806638.1|1894046_1894943_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715214.1|1894967_1895678_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813200.1|1895683_1897417_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.9e-60
WP_010723217.1|1897507_1898605_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003071.1|1898615_1900133_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192820.1|1900176_1900725_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|1900779_1900851_+	protein YqfH	NA	NA	NA	NA	NA
WP_001010156.1|1900847_1900973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|1900974_1902423_-	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001350545.1|1902858_1904778_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838430.1|1904777_1905266_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012163.1|1905301_1906669_-	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001336279.1|1906704_1908021_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280192.1|1908038_1909439_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 141
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1933898	1937417	4581492	transposase	Clostridium_phage(50.0%)	2	NA	NA
WP_001301085.1|1933898_1934654_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
WP_085947917.1|1936144_1937417_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 142
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1950485	1952980	4581492		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603502.1|1950485_1951247_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
WP_000256438.1|1951561_1952980_+	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 143
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1962610	1969383	4581492		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|1962610_1963324_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082201.1|1963392_1964082_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|1964766_1965297_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957910.1|1965309_1967556_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|1967706_1968582_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|1968588_1969383_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 144
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	1974859	1990407	4581492	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_001138201.1|1974859_1977748_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	5.3e-68
WP_001285993.1|1977740_1981283_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.9	1.5e-08
WP_000775955.1|1981282_1983109_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
WP_000237947.1|1983170_1984502_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|1984733_1985987_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000678646.1|1986565_1987663_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117728.1|1987901_1988708_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000184261.1|1988758_1989202_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001300698.1|1989201_1990407_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	3.0e-73
>prophage 145
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2001933	2002779	4581492		Bacillus_phage(100.0%)	1	NA	NA
WP_001214598.1|2001933_2002779_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.6e-10
>prophage 146
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2007547	2008396	4581492		Vibrio_phage(100.0%)	1	NA	NA
WP_000100421.1|2007547_2008396_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	1.0e-40
>prophage 147
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2015930	2020045	4581492		Hokovirus(50.0%)	2	NA	NA
WP_000186450.1|2015930_2018687_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_000046812.1|2018743_2020045_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	5.2e-39
>prophage 148
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2024077	2028997	4581492		Only_Syngen_Nebraska_virus(33.33%)	5	NA	NA
WP_000210878.1|2024077_2025715_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|2025802_2027101_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_001268460.1|2027160_2028033_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001288228.1|2028046_2028187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001199973.1|2028325_2028997_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 149
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2033409	2034195	4581492		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021334.1|2033409_2034195_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.2e-20
>prophage 150
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2058263	2060296	4581492		Hokovirus(50.0%)	2	NA	NA
WP_001090361.1|2058263_2059691_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173673.1|2059690_2060296_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 151
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2063408	2076590	4581492		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|2063408_2064170_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|2064163_2064790_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|2064929_2066069_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081586.1|2066131_2067124_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|2067217_2068582_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|2068670_2069447_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|2069451_2070090_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001393459.1|2070181_2071348_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_000848004.1|2071344_2072253_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001272547.1|2072418_2073216_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_001141337.1|2073266_2073923_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272928.1|2074028_2076590_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 152
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2094415	2095429	4581492		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001300815.1|2094415_2095429_+	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.4	9.3e-28
>prophage 153
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2102904	2103870	4581492		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287420.1|2102904_2103870_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 154
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2109336	2114722	4581492	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132231.1|2109336_2109834_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_000963138.1|2109913_2110975_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.1	7.5e-113
WP_000140508.1|2111043_2111544_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047184.1|2111671_2114302_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|2114536_2114722_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 155
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2127664	2132959	4581492		Bacillus_virus(20.0%)	5	NA	NA
WP_000985494.1|2127664_2128867_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777963.1|2129220_2130180_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	1.0e-132
WP_000246534.1|2130189_2132334_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
WP_000080947.1|2132306_2132717_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|2132713_2132959_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 156
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2136895	2140947	4581492		Clostridium_phage(50.0%)	4	NA	NA
WP_000522415.1|2136895_2137345_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|2137345_2138008_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001295173.1|2138028_2139429_-	GABA permease	NA	NA	NA	NA	NA
WP_001087611.1|2139666_2140947_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.9e-33
>prophage 157
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2150392	2150602	4581492		Salmonella_phage(100.0%)	1	NA	NA
WP_072097107.1|2150392_2150602_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	68.1	1.3e-08
>prophage 158
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2157289	2157748	4581492		Bordetella_phage(100.0%)	1	NA	NA
WP_000211841.1|2157289_2157748_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.1	5.0e-13
>prophage 159
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2161503	2164993	4581492		uncultured_Caudovirales_phage(50.0%)	6	NA	NA
WP_000065803.1|2161503_2161818_+	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	64.7	3.8e-12
WP_000702495.1|2162042_2162510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824222.1|2162533_2162977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144029.1|2162976_2163213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000189409.1|2163253_2163955_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000197391.1|2164171_2164993_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.7	1.4e-45
>prophage 160
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2176254	2178759	4581492	integrase	Escherichia_phage(50.0%)	2	2173797:2173809	2178918:2178930
2173797:2173809	attL	TAACAATTTCCAT	NA	NA	NA	NA
WP_000101723.1|2176254_2177496_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.0	4.8e-103
WP_000162574.1|2178276_2178759_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
2178918:2178930	attR	ATGGAAATTGTTA	NA	NA	NA	NA
>prophage 161
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2192504	2193575	4581492		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168037.1|2192504_2193575_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 162
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2199481	2202055	4581492		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|2199481_2202055_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 163
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2207898	2209197	4581492		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|2207898_2209197_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 164
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2214490	2220749	4581492	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|2214490_2214910_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|2215116_2216154_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|2216201_2216891_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|2217195_2217579_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|2217634_2218222_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001300638.1|2218324_2219206_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219203.1|2219414_2220749_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 165
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2226520	2230262	4581492		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|2226520_2228320_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002541.1|2228335_2229310_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|2229581_2230262_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 166
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2233721	2233982	4581492		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|2233721_2233982_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 167
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2238101	2249391	4581492		Bacillus_phage(50.0%)	7	NA	NA
WP_000970102.1|2238101_2241989_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.3e-130
WP_001311037.1|2242546_2243974_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_001215861.1|2244138_2244852_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001295369.1|2244841_2246176_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|2246236_2246575_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883122.1|2246619_2247810_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|2248137_2249391_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 168
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2255283	2256795	4581492		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000493470.1|2255283_2256795_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.5e-08
>prophage 169
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2272113	2278570	4581492		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|2272113_2273328_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|2273355_2273742_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|2273758_2274082_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384413.1|2274177_2274693_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196613.1|2274709_2276560_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124469.1|2276561_2276897_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|2276908_2277109_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133592.1|2277286_2278570_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
>prophage 170
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2288780	2289212	4581492		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|2288780_2289212_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 171
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2298009	2304492	4581492		Escherichia_phage(66.67%)	7	NA	NA
WP_000937912.1|2298009_2299380_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	2.4e-42
WP_001299507.1|2299541_2301008_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138270.1|2301076_2302654_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755173.1|2302746_2303286_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_001295476.1|2303301_2303820_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000076001.1|2304130_2304322_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017552.1|2304339_2304492_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 172
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2310739	2314741	4581492		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028612.1|2310739_2311378_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	1.8e-29
WP_001336050.1|2311377_2312415_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.4e-71
WP_001295473.1|2312739_2313366_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|2313451_2314741_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 173
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2335993	2336707	4581492		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|2335993_2336707_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 174
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2353995	2354946	4581492		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|2353995_2354946_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 175
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2373600	2378720	4581492		Deep-sea_thermophilic_phage(33.33%)	6	NA	NA
WP_000102886.1|2373600_2374470_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000405996.1|2374683_2375109_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_001350539.1|2375095_2375545_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838944.1|2375605_2376181_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001350538.1|2376276_2377176_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	33.1	1.6e-26
WP_001327042.1|2377415_2378720_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
>prophage 176
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2382198	2382990	4581492		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000517431.1|2382198_2382990_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 177
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2386007	2398661	4581492		Streptococcus_phage(40.0%)	12	NA	NA
WP_000021036.1|2386007_2387105_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_001336044.1|2387238_2388150_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.3	3.8e-57
WP_000745534.1|2388338_2389073_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_000719962.1|2389105_2389480_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096674.1|2389584_2390436_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|2390478_2390988_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623140.1|2391028_2392756_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	1.3e-16
WP_000487600.1|2392800_2393058_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|2393441_2394413_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254839.1|2394597_2395359_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001300494.1|2395588_2396575_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443661.1|2396645_2398661_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.7e-150
>prophage 178
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2425704	2426439	4581492		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|2425704_2426439_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 179
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2430256	2431177	4581492		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|2430256_2431177_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 180
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2434871	2442448	4581492		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283490.1|2434871_2436566_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
WP_000955028.1|2436635_2437580_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001296867.1|2437653_2438799_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_012738268.1|2438854_2442448_-	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	1.1e-09
>prophage 181
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2450309	2461439	4581492	tail,integrase	Enterobacteria_phage(46.67%)	16	2446619:2446635	2463449:2463465
2446619:2446635	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001163428.1|2450309_2450510_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000206809.1|2450641_2450947_-	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001242717.1|2450946_2451309_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000008183.1|2451299_2451836_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_000081278.1|2451963_2452788_-	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000135673.1|2452853_2453216_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000128175.1|2453573_2453942_+	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_001393497.1|2453938_2454433_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000066913.1|2454432_2454708_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_011443597.1|2454757_2455276_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_001106835.1|2455302_2455743_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_047792215.1|2456041_2456323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153676257.1|2457668_2458589_-	glycosyltransferase	NA	S5FKN0	Shigella_phage	91.2	4.8e-156
WP_153676268.1|2458585_2458918_-	GtrA family protein	NA	U5P0S6	Shigella_phage	87.3	2.0e-48
WP_000958671.1|2459037_2460195_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000368140.1|2460506_2461439_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
2463449:2463465	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 182
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2479262	2480348	4581492		Pandoravirus(100.0%)	1	NA	NA
WP_001333535.1|2479262_2480348_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
>prophage 183
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2488884	2490021	4581492		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699148.1|2488884_2490021_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.5	6.5e-22
>prophage 184
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2496497	2498015	4581492		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|2496497_2498015_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 185
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2502226	2504087	4581492		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293613.1|2502226_2503000_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000156149.1|2503196_2504087_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	43.9	8.9e-67
>prophage 186
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2514646	2517874	4581492		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203392.1|2514646_2515297_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	35.4	3.1e-08
WP_001012899.1|2515383_2517216_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813859.1|2517274_2517874_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 187
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2556710	2561714	4581492		Tupanvirus(50.0%)	4	NA	NA
WP_000860273.1|2556710_2558693_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
WP_000461657.1|2558692_2559661_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_001295286.1|2559664_2560804_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.5e-29
WP_000879112.1|2561111_2561714_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
>prophage 188
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2565317	2569828	4581492	transposase	Oenococcus_phage(50.0%)	5	NA	NA
WP_001319848.1|2565317_2566523_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
WP_000100890.1|2566579_2567869_+	MFS transporter	NA	NA	NA	NA	NA
WP_000992954.1|2567886_2568690_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_000150333.1|2568730_2568916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000140592.1|2568928_2569828_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.0	2.4e-67
>prophage 189
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2575720	2581867	4581492		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000779105.1|2575720_2576797_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.0e-08
WP_000301050.1|2577259_2577910_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000135040.1|2577963_2578218_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332037.1|2578217_2579348_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_001075164.1|2579581_2581867_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
>prophage 190
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2587311	2589939	4581492		Bacillus_virus(100.0%)	1	NA	NA
WP_001281284.1|2587311_2589939_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	6.2e-92
>prophage 191
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2604862	2609705	4581492		Bacillus_phage(50.0%)	2	NA	NA
WP_000559125.1|2604862_2606689_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
WP_000876011.1|2606855_2609705_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 192
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2613981	2619759	4581492		Enterobacteria_phage(25.0%)	5	NA	NA
WP_000865568.1|2613981_2615085_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.3	5.2e-117
WP_000406064.1|2615196_2616252_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000710375.1|2616325_2617390_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000884971.1|2617389_2618040_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	33.0	8.3e-06
WP_000422182.1|2618115_2619759_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.2e-13
>prophage 193
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2628979	2629597	4581492		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|2628979_2629597_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 194
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2642669	2650317	4581492		Vibrio_phage(50.0%)	7	NA	NA
WP_000050793.1|2642669_2643677_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	4.1e-84
WP_000494183.1|2643815_2644100_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578061.1|2644224_2645985_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	2.4e-100
WP_001234850.1|2646133_2646829_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213361.1|2646856_2648047_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_000202798.1|2648379_2648724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194927.1|2648727_2650317_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
>prophage 195
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2656071	2660372	4581492		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|2656071_2656638_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_000594599.1|2657049_2657763_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198828.1|2657801_2658788_-	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_001091940.1|2658905_2660372_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.3e-43
>prophage 196
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2674919	2675777	4581492		Catovirus(100.0%)	1	NA	NA
WP_000873894.1|2674919_2675777_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	4.0e-24
>prophage 197
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2679847	2683633	4581492		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489247.1|2679847_2681839_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
WP_000425438.1|2681870_2682707_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|2682964_2683633_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 198
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2687327	2688848	4581492		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|2687327_2688848_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 199
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2709227	2718668	4581492		Enterobacteria_phage(83.33%)	9	NA	NA
WP_000569315.1|2709227_2710154_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783123.1|2710158_2710890_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|2710870_2710978_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|2711037_2711769_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|2711990_2713676_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|2713672_2714392_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|2714438_2714909_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|2714948_2715410_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001333512.1|2717531_2718668_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 200
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2730301	2732335	4581492	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001350533.1|2730301_2732335_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 201
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2742982	2746539	4581492		Paenibacillus_phage(50.0%)	4	NA	NA
WP_001351783.1|2742982_2743801_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000434038.1|2743852_2744599_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000012001.1|2744572_2745538_-	kinase	NA	NA	NA	NA	NA
WP_000846217.1|2745534_2746539_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
>prophage 202
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2756431	2764954	4581492	transposase,tRNA	Phage_TP(33.33%)	10	NA	NA
WP_000878218.1|2756431_2757298_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|2757294_2757594_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000903596.1|2757690_2758137_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807348.1|2758218_2759118_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	2.8e-12
WP_001318299.1|2759523_2759841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000468310.1|2760309_2760528_+	prophage transcriptional regulator OgrK	NA	Q6DW12	Phage_TP	100.0	4.7e-38
WP_000476011.1|2760800_2762162_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_001350529.1|2762308_2762641_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|2762831_2763554_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675150.1|2763550_2764954_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 203
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2778803	2780156	4581492		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469708.1|2778803_2780156_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.6	2.7e-06
>prophage 204
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2784881	2795272	4581492		Catovirus(20.0%)	8	NA	NA
WP_001295424.1|2784881_2785523_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234768.1|2785614_2786196_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.0e-31
WP_001252331.1|2786217_2788071_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_000454701.1|2788344_2789928_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_000978094.1|2790586_2791726_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_000482901.1|2791731_2792175_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000137196.1|2792177_2794340_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000794699.1|2794432_2795272_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
>prophage 205
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2799515	2806221	4581492		Synechococcus_phage(25.0%)	6	NA	NA
WP_000048190.1|2799515_2800637_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_000043654.1|2800639_2801605_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	51.1	1.3e-87
WP_001393539.1|2801607_2802087_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000699693.1|2802083_2803307_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000079274.1|2803309_2804746_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	9.7e-47
WP_001350528.1|2804850_2806221_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	1.7e-32
>prophage 206
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2811933	2818248	4581492		Enterobacteria_phage(40.0%)	5	NA	NA
WP_001116026.1|2811933_2813328_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
WP_000183060.1|2813502_2814396_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699460.1|2814768_2815854_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_000783975.1|2816809_2817691_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001100981.1|2817690_2818248_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
>prophage 207
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2822726	2823317	4581492		Klosneuvirus(100.0%)	1	NA	NA
WP_000601187.1|2822726_2823317_+	LPS biosynthesis protein	NA	A0A1V0SJ47	Klosneuvirus	32.6	2.6e-06
>prophage 208
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2826529	2829351	4581492		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000043484.1|2826529_2827936_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
WP_000704857.1|2828184_2829351_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.0e-110
>prophage 209
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2836706	2837606	4581492		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|2836706_2837606_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 210
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2845250	2846417	4581492		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000830156.1|2845250_2846417_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	2.9e-227
>prophage 211
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2850759	2850981	4581492		Klebsiella_phage(100.0%)	1	NA	NA
WP_000692323.1|2850759_2850981_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 212
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2860475	2861492	4581492	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001310555.1|2860475_2861492_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
>prophage 213
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2884898	2885429	4581492		Escherichia_phage(100.0%)	1	NA	NA
WP_001079074.1|2884898_2885429_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 214
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2888973	2889645	4581492		Bacillus_phage(100.0%)	1	NA	NA
WP_001395354.1|2888973_2889645_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	2.4e-32
>prophage 215
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2894717	2901474	4581492		Burkholderia_phage(50.0%)	7	NA	NA
WP_000365562.1|2894717_2895413_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001157239.1|2895479_2896898_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000786005.1|2896878_2897349_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
WP_001212226.1|2897337_2898258_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922686.1|2898430_2899348_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|2899426_2899609_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001350521.1|2899779_2901474_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
>prophage 216
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2917307	2917976	4581492		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334583.1|2917307_2917976_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	7.3e-82
>prophage 217
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2929982	2930735	4581492		Bacillus_virus(100.0%)	1	NA	NA
WP_001272991.1|2929982_2930735_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 218
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2942727	2944242	4581492		Cedratvirus(100.0%)	1	NA	NA
WP_001187819.1|2942727_2944242_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
>prophage 219
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2954329	2959973	4581492		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_001297437.1|2954329_2955991_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_046613383.1|2956036_2957638_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.4	1.1e-14
WP_000204337.1|2957656_2958517_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036361.1|2958519_2959569_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	7.9e-06
WP_000763867.1|2959583_2959973_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 220
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2965225	2966959	4581492	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025322.1|2965225_2966959_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 221
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2973575	2975626	4581492		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019590.1|2973575_2974319_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
WP_000252980.1|2974359_2974755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639274.1|2974807_2975626_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
>prophage 222
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2979644	2986708	4581492		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|2979644_2980166_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024932.1|2980167_2980770_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_010723105.1|2980840_2980906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|2981044_2981656_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|2981664_2982675_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571480.1|2982821_2983607_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|2983603_2984359_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001300644.1|2984437_2985370_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|2985385_2986708_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 223
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	2990706	2992182	4581492		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|2990706_2992182_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 224
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3000238	3004708	4581492		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944256.1|3000238_3000901_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011658.1|3000924_3001581_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|3001682_3001913_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168747.1|3002051_3002426_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879289.1|3002429_3003302_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976476.1|3003314_3003656_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812724.1|3004051_3004708_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
>prophage 225
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3012204	3014253	4581492		Moraxella_phage(100.0%)	1	NA	NA
WP_001055791.1|3012204_3014253_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 226
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3020780	3020990	4581492		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|3020780_3020990_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 227
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3026630	3028187	4581492		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|3026630_3028187_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 228
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3034831	3040006	4581492	tRNA	Bacillus_phage(50.0%)	4	NA	NA
WP_000128841.1|3034831_3036742_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.7	6.5e-91
WP_001220966.1|3036799_3037495_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290576.1|3037534_3038116_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_000758422.1|3038320_3040006_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 229
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3054301	3058875	4581492		Bacillus_phage(100.0%)	3	NA	NA
WP_000766132.1|3054301_3055792_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
WP_153676259.1|3055972_3057445_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_000219687.1|3057591_3058875_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 230
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3062193	3063048	4581492		Indivirus(100.0%)	1	NA	NA
WP_001186371.1|3062193_3063048_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	2.5e-10
>prophage 231
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3071858	3075943	4581492		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000723710.1|3071858_3072839_+	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.5	2.3e-07
WP_000719096.1|3072975_3073734_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_046613300.1|3073850_3075209_+	MFS transporter	NA	NA	NA	NA	NA
WP_001135066.1|3075301_3075943_-	bifunctional pyrazinamidase/nicotinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
>prophage 232
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3080869	3082831	4581492		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|3080869_3082831_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 233
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3088429	3089083	4581492		Bacillus_phage(100.0%)	1	NA	NA
WP_001300558.1|3088429_3089083_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	5.1e-11
>prophage 234
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3095847	3097068	4581492		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|3095847_3097068_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 235
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3104544	3105372	4581492		Bacillus_virus(100.0%)	1	NA	NA
WP_000175026.1|3104544_3105372_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.7e-72
>prophage 236
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3111701	3113963	4581492		Tupanvirus(100.0%)	1	NA	NA
WP_000077872.1|3111701_3113963_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
>prophage 237
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3125257	3144851	4581492	tRNA	Tupanvirus(11.11%)	19	NA	NA
WP_001144202.1|3125257_3127186_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
WP_001700733.1|3127189_3127732_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|3127828_3128026_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|3128078_3128435_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|3128557_3128602_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_046613291.1|3128885_3129869_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	43.2	8.4e-34
WP_046613289.1|3129883_3132271_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|3132275_3132575_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000956528.1|3132675_3133656_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154168.1|3133718_3134270_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029474.1|3134269_3135019_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209795.1|3135096_3135561_+	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_001300634.1|3135807_3136521_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_046613287.1|3136583_3138020_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270809.1|3138023_3138215_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082229.1|3138346_3139393_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|3139549_3140383_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_046613285.1|3140715_3143094_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.6	3.6e-171
WP_000553704.1|3143150_3144851_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	3.0e-31
>prophage 238
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3163441	3168525	4581492		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367160.1|3163441_3163810_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_000089364.1|3163818_3165306_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948863.1|3165315_3166062_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	3.9e-07
WP_000907979.1|3166036_3167308_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000577988.1|3167304_3168525_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
>prophage 239
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3176814	3179081	4581492		Escherichia_phage(50.0%)	3	NA	NA
WP_001310861.1|3176814_3177483_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
WP_001069979.1|3177479_3178265_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587525.1|3178268_3179081_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 240
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3184585	3186415	4581492		Orpheovirus(50.0%)	2	NA	NA
WP_000493966.1|3184585_3185227_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	4.3e-23
WP_000098896.1|3185266_3186415_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
>prophage 241
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3191868	3193393	4581492		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_000007283.1|3191868_3192450_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101193.1|3192577_3193393_-	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 242
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3202195	3203694	4581492		Indivirus(50.0%)	2	NA	NA
WP_000250656.1|3202195_3203092_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
WP_001296937.1|3203172_3203694_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 243
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3210605	3211880	4581492	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|3210605_3211880_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 244
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3231756	3233568	4581492		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|3231756_3233568_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 245
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3243644	3244946	4581492		Bacillus_phage(100.0%)	1	NA	NA
WP_000732512.1|3243644_3244946_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	3.2e-17
>prophage 246
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3262707	3274932	4581492		Escherichia_phage(57.14%)	12	NA	NA
WP_000148710.1|3262707_3263322_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|3263364_3264219_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|3264220_3264838_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|3264848_3267272_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041675.1|3267332_3269759_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001300836.1|3269957_3270263_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|3270370_3271081_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|3271083_3271644_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|3271678_3272020_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|3272154_3272481_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|3272686_3273901_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836066.1|3273912_3274932_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
>prophage 247
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3279164	3298605	4581492	tail,lysis	Enterobacteria_phage(38.1%)	33	NA	NA
WP_000379575.1|3279164_3279320_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448564.1|3279486_3279894_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|3279977_3280208_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_011443592.1|3280504_3280654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|3281090_3281423_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|3281625_3281931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|3281955_3282195_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|3282194_3282482_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|3282553_3282709_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|3282925_3283177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|3283243_3283522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|3283523_3284573_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_001047135.1|3284586_3285339_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|3285616_3285706_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|3285760_3285973_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000839590.1|3287241_3287457_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|3287461_3287773_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|3287769_3288303_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|3288299_3288797_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|3289159_3289372_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|3289382_3289571_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|3289573_3289639_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|3289717_3289873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001368374.1|3290830_3291064_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453612.1|3291452_3292022_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001027733.1|3291972_3292935_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000885611.1|3292934_3293510_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000078177.1|3293607_3294198_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|3294514_3294748_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|3294816_3294930_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|3295534_3296818_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527743.1|3296906_3298367_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000214712.1|3298401_3298605_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 248
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3303969	3308046	4581492		Bacillus_phage(50.0%)	6	NA	NA
WP_000592814.1|3303969_3304860_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
WP_000901367.1|3305078_3305174_-	protein MgtS	NA	NA	NA	NA	NA
WP_153676261.1|3305300_3306167_-	MFS transporter	NA	NA	NA	NA	NA
WP_000087187.1|3306482_3307382_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_000803657.1|3307412_3307631_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|3307662_3308046_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 249
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3315765	3316713	4581492		Bacillus_virus(100.0%)	1	NA	NA
WP_000878968.1|3315765_3316713_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	29.6	7.3e-19
>prophage 250
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3324594	3326130	4581492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194860.1|3324594_3326130_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	23.6	7.2e-16
>prophage 251
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3348274	3355210	4581492		Bacillus_phage(50.0%)	3	NA	NA
WP_000628576.1|3348274_3349960_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	2.2e-10
WP_000832437.1|3349997_3352370_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_010723101.1|3352414_3355210_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	5.7e-19
>prophage 252
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3360476	3364283	4581492		Bacillus_virus(50.0%)	2	NA	NA
WP_000426292.1|3360476_3361859_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_001360132.1|3361883_3364283_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 253
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3368599	3370505	4581492		Planktothrix_phage(100.0%)	2	NA	NA
WP_000193547.1|3368599_3369586_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
WP_001285536.1|3369578_3370505_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.1e-14
>prophage 254
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3373778	3375219	4581492		Tupanvirus(50.0%)	2	NA	NA
WP_000642433.1|3373778_3374789_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
WP_000781370.1|3374934_3375219_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 255
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3381588	3381879	4581492		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|3381588_3381879_+	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 256
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3388755	3390300	4581492		Escherichia_phage(100.0%)	1	NA	NA
WP_000702535.1|3388755_3390300_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 257
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3404534	3406637	4581492		Salmonella_phage(100.0%)	1	NA	NA
WP_000689363.1|3404534_3406637_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	5.3e-134
>prophage 258
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3413769	3423943	4581492	transposase	Mycoplasma_phage(20.0%)	10	NA	NA
WP_000220396.1|3413769_3414783_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
WP_000047424.1|3414800_3415946_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000760626.1|3416190_3417597_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|3417675_3418092_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000813794.1|3418137_3418314_-	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_000494244.1|3418535_3418766_+	YncJ family protein	NA	NA	NA	NA	NA
WP_001303492.1|3418857_3420819_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	3.5e-23
WP_000429155.1|3420891_3421428_-	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_001326689.1|3421480_3422695_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000826416.1|3422734_3423943_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	1.7e-206
>prophage 259
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3435749	3436698	4581492		Moraxella_phage(50.0%)	2	NA	NA
WP_000731833.1|3435749_3435923_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|3436167_3436698_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 260
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3440636	3444539	4581492		Klosneuvirus(100.0%)	1	NA	NA
WP_000139543.1|3440636_3444539_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 261
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3457090	3521028	4581492	lysis,transposase,integrase,tRNA,tail	Escherichia_phage(40.62%)	59	3499978:3499996	3528000:3528018
WP_001254932.1|3457090_3458242_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_153676262.1|3458405_3459672_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.7	2.2e-172
WP_010723099.1|3462363_3462429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001123464.1|3462532_3463123_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039887.1|3463104_3464055_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632280.1|3464155_3465469_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206197.1|3465495_3466701_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|3466700_3467123_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_046613373.1|3467112_3468540_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969784.1|3468541_3469330_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|3469329_3470097_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206388.1|3470093_3471164_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189201.1|3471171_3471669_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|3471683_3472430_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|3472438_3472726_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001112359.1|3472737_3473601_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186469.1|3473951_3475997_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535469.1|3476244_3478518_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|3478575_3480075_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067514.1|3480310_3481216_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001300734.1|3481387_3481714_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|3481721_3481907_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900941.1|3481903_3484543_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762236.1|3484750_3485740_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_001298828.1|3485850_3486273_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|3486269_3486536_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628244.1|3486809_3490334_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837921.1|3490700_3491834_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_001300461.1|3491974_3492409_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_120795384.1|3493187_3493301_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836770.1|3493369_3493603_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000086527.1|3493918_3494509_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001698950.1|3494606_3495182_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_071885698.1|3495181_3498544_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_046613426.1|3498866_3499847_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	4.4e-184
3499978:3499996	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000091628.1|3501612_3501972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001350510.1|3501952_3502216_-	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_001228696.1|3504005_3504191_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_000450663.1|3504278_3504839_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_000788970.1|3504861_3505608_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000899748.1|3505614_3506472_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000693797.1|3506484_3506907_-	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000712069.1|3506929_3507226_-	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000948459.1|3507349_3507826_+	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_001169151.1|3508279_3508435_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_046613436.1|3508431_3508920_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|3509361_3509583_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|3509582_3509753_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|3509827_3510103_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105143.1|3510204_3512805_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000166319.1|3512797_3513607_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|3513663_3513858_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|3513850_3514060_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|3514138_3514354_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|3514355_3515591_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157406.1|3515642_3516578_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123737.1|3516706_3518080_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|3518557_3519541_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|3519795_3521028_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
3528000:3528018	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
>prophage 262
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3527354	3527870	4581492		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|3527354_3527870_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 263
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3531696	3532713	4581492	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_010723085.1|3531696_3532713_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
>prophage 264
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3561914	3563180	4581492		Klosneuvirus(100.0%)	1	NA	NA
WP_000069229.1|3561914_3563180_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.0e-24
>prophage 265
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3576095	3581752	4581492		Bacillus_virus(50.0%)	5	NA	NA
WP_000573407.1|3576095_3576902_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000565727.1|3576969_3577323_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|3577690_3578479_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_001335988.1|3578622_3579750_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000484984.1|3579817_3581752_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
>prophage 266
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3589569	3590160	4581492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|3589569_3590160_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 267
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3595084	3666326	4581492	lysis,protease,transposase,integrase,head,terminase,portal,tail	Enterobacteria_phage(84.44%)	77	3628263:3628278	3670567:3670582
WP_001297122.1|3595084_3597682_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_001031530.1|3598061_3598313_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422045.1|3598348_3599398_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559286.1|3599617_3600376_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
WP_001278906.1|3600372_3600963_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291217.1|3601002_3601878_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001326916.1|3602088_3603984_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|3604011_3604632_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|3604628_3605510_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|3605647_3605692_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194610.1|3605783_3607346_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|3607345_3608941_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001340286.1|3608944_3610303_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	3.3e-36
WP_000209520.1|3610314_3611508_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|3611507_3612314_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|3612694_3612874_+	general stress protein	NA	NA	NA	NA	NA
WP_001056490.1|3612959_3613460_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079505.1|3613505_3614012_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000737226.1|3614071_3614710_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000028545.1|3615066_3615810_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000808667.1|3615839_3616379_+	septation protein A	NA	NA	NA	NA	NA
WP_000108160.1|3616483_3616882_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_001360141.1|3616921_3617641_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000967595.1|3617864_3618161_+	YciI family protein	NA	NA	NA	NA	NA
WP_001143750.1|3619194_3622203_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.4	0.0e+00
WP_001235704.1|3622366_3622918_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	81.8	1.7e-76
WP_097427053.1|3622933_3623149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153676263.1|3624185_3624662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001470895.1|3624840_3625023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000121907.1|3625369_3626236_-	2-hydroxy-6-oxonona-2,4-dienedioate hydrolase	NA	NA	NA	NA	NA
WP_000543457.1|3626253_3627198_-	3-carboxyethylcatechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_001007407.1|3627199_3628864_-	bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase	NA	NA	NA	NA	NA
3628263:3628278	attL	TCTACCACAATCCACT	NA	NA	NA	NA
WP_001310587.1|3628940_3629888_+	DNA-binding transcriptional activator MhpR	NA	NA	NA	NA	NA
WP_000805902.1|3629964_3631047_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
WP_000177853.1|3631169_3634151_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	100.0	0.0e+00
WP_000291549.1|3634202_3635456_+	lactose permease	NA	NA	NA	NA	NA
WP_001335915.1|3635521_3636133_+	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
WP_001301263.1|3636235_3637417_-	cyanate transporter CynX	NA	NA	NA	NA	NA
WP_000118199.1|3637422_3638850_-	cyanase	NA	K7PGW9	Enterobacteria_phage	99.7	2.3e-181
WP_001018610.1|3638917_3639250_-|head	head decoration protein	head	E4WL24	Enterobacteria_phage	100.0	9.0e-57
WP_000929806.1|3639259_3640603_-	S49 family peptidase	NA	E4WL22	Enterobacteria_phage	100.0	1.3e-215
WP_000701345.1|3640583_3642176_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	100.0	1.3e-310
WP_000235412.1|3642172_3642379_-|head,tail	head-tail joining protein	head,tail	E4WL20	Enterobacteria_phage	100.0	5.8e-30
WP_001027236.1|3642378_3644301_-|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	100.0	0.0e+00
WP_000453624.1|3644275_3644821_-|terminase	terminase small subunit	terminase	E4WL18	Enterobacteria_phage	100.0	1.2e-95
WP_000509882.1|3645068_3645797_-	hypothetical protein	NA	M9NZE9	Enterobacteria_phage	100.0	8.7e-121
WP_001446081.1|3646187_3646784_+	hypothetical protein	NA	M9NZJ1	Enterobacteria_phage	100.0	9.7e-110
WP_001064347.1|3646855_3647374_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	100.0	2.9e-94
WP_012305470.1|3647572_3648031_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	100.0	2.2e-77
WP_001070143.1|3648027_3648522_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	100.0	1.3e-91
WP_000286101.1|3648499_3648724_-	hypothetical protein	NA	M9NZI9	Enterobacteria_phage	100.0	1.9e-34
WP_001047620.1|3649202_3650012_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	100.0	2.3e-154
WP_085903671.1|3650011_3650128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048813386.1|3650124_3650331_-	hypothetical protein	NA	M9NZE6	Enterobacteria_phage	100.0	2.4e-36
WP_001231139.1|3650327_3650969_-	protein ninG	NA	M9NYX8	Enterobacteria_phage	100.0	2.4e-114
WP_000063208.1|3650961_3651630_-	serine/threonine protein phosphatase	NA	M9P0E4	Enterobacteria_phage	100.0	2.3e-131
WP_000106777.1|3651626_3651797_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	100.0	1.1e-23
WP_000586532.1|3651796_3652252_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	100.0	5.7e-86
WP_000838083.1|3653255_3653945_-	hypothetical protein	NA	M9NYX7	Enterobacteria_phage	100.0	8.8e-131
WP_000072106.1|3653941_3654850_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	100.0	1.2e-159
WP_000555791.1|3654935_3655478_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	100.0	1.6e-95
WP_000608751.1|3655508_3655730_-	helix-turn-helix domain-containing protein	NA	M9NZA8	Enterobacteria_phage	100.0	3.5e-33
WP_000244936.1|3655793_3656558_+	helix-turn-helix transcriptional regulator	NA	M9NZE3	Enterobacteria_phage	100.0	1.9e-134
WP_000432054.1|3656694_3657561_+	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	100.0	3.5e-153
WP_000362427.1|3657591_3657801_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	87.5	7.0e-23
WP_032180615.1|3658361_3658655_+	hypothetical protein	NA	M9P0E2	Enterobacteria_phage	99.0	2.0e-47
WP_001281305.1|3658810_3659020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000607102.1|3659176_3659386_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	100.0	4.7e-35
WP_000448252.1|3659396_3660233_+	zf-TFIIB domain-containing protein	NA	M9NYX5	Enterobacteria_phage	100.0	6.2e-155
WP_000005775.1|3660337_3661306_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	100.0	1.8e-97
WP_000995354.1|3661313_3661595_+	host nuclease inhibitor GamL	NA	M9NZI3	Enterobacteria_phage	100.0	1.3e-48
WP_000059964.1|3661604_3662522_+	recombinase RecT	NA	M9NZA6	Enterobacteria_phage	100.0	1.1e-171
WP_000187057.1|3662518_3663199_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	100.0	1.3e-131
WP_000831730.1|3663195_3663624_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	100.0	9.5e-75
WP_000148438.1|3663620_3663773_+	DUF1317 family protein	NA	NA	NA	NA	NA
WP_024168593.1|3664657_3664897_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	100.0	1.1e-37
WP_000627155.1|3665132_3666326_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	100.0	1.3e-235
3670567:3670582	attR	AGTGGATTGTGGTAGA	NA	NA	NA	NA
>prophage 268
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3670331	3672346	4581492		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|3670331_3671336_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110948.1|3671332_3672346_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	5.8e-14
>prophage 269
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3682533	3693074	4581492		Citrobacter_phage(25.0%)	9	NA	NA
WP_000068077.1|3682533_3683151_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_001287378.1|3683755_3684169_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|3684312_3685221_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001295622.1|3686527_3687433_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001307143.1|3687545_3688004_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555857.1|3688053_3688896_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001160108.1|3690151_3690829_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571681.1|3690828_3691539_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702650.1|3691535_3693074_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 270
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3704328	3704559	4581492		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146444.1|3704328_3704559_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 271
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3707658	3711666	4581492		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
WP_046613400.1|3707658_3708513_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.6	4.1e-45
WP_001257044.1|3708548_3709358_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200374.1|3709361_3709754_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456467.1|3709750_3710584_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|3710583_3711666_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 272
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3714802	3717554	4581492		Tupanvirus(50.0%)	2	NA	NA
WP_001298109.1|3714802_3715750_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3715874_3717554_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
>prophage 273
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3744216	3745904	4581492		Salmonella_phage(50.0%)	2	NA	NA
WP_000457616.1|3744216_3745485_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
WP_000897378.1|3745484_3745904_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 274
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3754448	3755537	4581492		Escherichia_phage(100.0%)	1	NA	NA
WP_071524883.1|3754448_3755537_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	41.9	8.3e-75
>prophage 275
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3762602	3778235	4581492	tail,transposase,integrase,portal,plate	Shigella_phage(35.29%)	24	3773281:3773293	3781658:3781670
WP_000332303.1|3762602_3763334_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|3763554_3763959_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032082692.1|3764011_3764122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000943927.1|3765076_3765241_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_000557907.1|3765474_3766308_-	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000905001.1|3766414_3766969_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_010723096.1|3767377_3767791_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000548498.1|3767762_3768365_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_000554707.1|3768364_3769153_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.7e-51
WP_000383574.1|3769156_3769741_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_001350503.1|3769731_3770523_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_001350502.1|3770449_3770923_-|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_000605606.1|3770922_3771105_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000104929.1|3771116_3772484_-	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_001250269.1|3772473_3772653_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515837.1|3772828_3773386_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
3773281:3773293	attL	AGTCAGCCGCTTC	NA	NA	NA	NA
WP_000649480.1|3773429_3773630_-	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000848748.1|3773720_3774395_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_001005353.1|3774569_3774878_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_010723095.1|3774815_3775157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011443584.1|3775273_3775585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939945.1|3775621_3775867_+	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_000169527.1|3777677_3777977_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077626120.1|3778061_3778235_+|integrase	integrase	integrase	O21927	Phage_21	76.0	6.8e-16
3781658:3781670	attR	AGTCAGCCGCTTC	NA	NA	NA	NA
>prophage 276
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3781529	3782780	4581492		Phage_21(100.0%)	1	NA	NA
WP_000444484.1|3781529_3782780_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
>prophage 277
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3785916	3787287	4581492		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423744.1|3785916_3787287_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	2.7e-107
>prophage 278
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3792308	3794286	4581492		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000531594.1|3792308_3793445_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799401.1|3793428_3794286_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
>prophage 279
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3797543	3801284	4581492		Vibrio_phage(50.0%)	4	NA	NA
WP_000952737.1|3797543_3798383_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.7e-23
WP_000291270.1|3798398_3799310_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251348.1|3799338_3800583_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033694.1|3800582_3801284_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
>prophage 280
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3808572	3808830	4581492		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|3808572_3808830_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 281
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3821136	3822779	4581492		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267956.1|3821136_3822141_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	31.8	6.4e-05
WP_001257000.1|3822137_3822779_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 282
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3826051	3827233	4581492		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|3826051_3826288_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008535.1|3826498_3827233_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 283
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3839590	3840532	4581492		Brevibacillus_phage(100.0%)	1	NA	NA
WP_046613255.1|3839590_3840532_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 284
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3856415	3856661	4581492		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|3856415_3856661_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 285
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3861320	3862241	4581492		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|3861320_3862241_+	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 286
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3871549	3872083	4581492		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|3871549_3872083_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 287
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3876218	3877052	4581492		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|3876218_3877052_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 288
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3893217	3894282	4581492		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258765.1|3893217_3894282_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
>prophage 289
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3908919	3911193	4581492		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001028083.1|3908919_3909414_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
WP_001326838.1|3909434_3910763_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
WP_001273658.1|3911019_3911193_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 290
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3915488	3927803	4581492		Klosneuvirus(20.0%)	13	NA	NA
WP_000420621.1|3915488_3916409_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_000024560.1|3916408_3916714_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209894.1|3916865_3917465_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062091.1|3917461_3920008_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	1.2e-71
WP_001230242.1|3920007_3921180_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120125.1|3921309_3922002_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264933.1|3921974_3923003_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001300633.1|3923085_3925830_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	2.7e-37
WP_000829662.1|3925901_3926975_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|3927023_3927197_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309400.1|3927186_3927417_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|3927391_3927580_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|3927590_3927803_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 291
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3947845	3948505	4581492	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|3947845_3948505_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 292
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3952738	3954793	4581492		Bacillus_phage(100.0%)	1	NA	NA
WP_001295354.1|3952738_3954793_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
>prophage 293
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3967392	3969300	4581492		Tupanvirus(100.0%)	1	NA	NA
WP_000053099.1|3967392_3969300_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
>prophage 294
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	3985219	3996189	4581492	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_001090506.1|3985219_3985987_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000193841.1|3986029_3988642_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001307697.1|3988907_3990110_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|3990278_3991679_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|3992281_3993370_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|3993554_3994745_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109486.1|3994966_3995614_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|3995640_3996189_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 295
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4010894	4015436	4581492		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|4010894_4012643_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705764.1|4012679_4014944_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|4015151_4015436_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 296
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4020522	4021611	4581492		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057138.1|4020522_4021611_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 297
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4025709	4028924	4581492		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292822.1|4025709_4027992_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|4028183_4028924_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 298
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4035232	4058917	4581492	protease,tRNA	Escherichia_phage(16.67%)	16	NA	NA
WP_000213098.1|4035232_4035850_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850303.1|4035860_4038305_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000886683.1|4038543_4039836_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|4039926_4041270_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|4041280_4041892_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000076967.1|4042050_4046040_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|4046174_4046669_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|4047213_4048179_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043598.1|4048301_4050068_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_001202177.1|4050068_4051790_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
WP_001241678.1|4051831_4052536_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|4052820_4053039_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|4053723_4056000_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|4056030_4056351_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|4056673_4056898_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188144.1|4056970_4058917_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 299
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4068214	4069933	4581492		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815337.1|4068214_4069933_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
>prophage 300
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4073520	4076258	4581492		Roseobacter_phage(50.0%)	4	NA	NA
WP_001252135.1|4073520_4074351_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|4074347_4074671_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270734.1|4074796_4075312_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|4075529_4076258_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 301
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4079618	4088768	4581492		Streptococcus_phage(25.0%)	11	NA	NA
WP_001149682.1|4079618_4080746_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	1.0e-27
WP_000389260.1|4080786_4081275_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|4081334_4082180_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105430.1|4082176_4083130_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996005.1|4083139_4084273_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126072.1|4084367_4085480_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|4085830_4086307_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|4086394_4087297_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|4087357_4088080_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|4088063_4088351_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|4088510_4088768_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
>prophage 302
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4097334	4098537	4581492		Stx2-converting_phage(100.0%)	1	NA	NA
WP_014639044.1|4097334_4098537_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 303
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4109872	4111744	4581492		Planktothrix_phage(100.0%)	1	NA	NA
WP_001301279.1|4109872_4111744_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 304
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4114959	4123301	4581492		Synechococcus_phage(33.33%)	6	NA	NA
WP_001336208.1|4114959_4115622_-	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.5	2.8e-25
WP_001295295.1|4115752_4116652_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209309.1|4116657_4119090_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
WP_000114272.1|4119235_4120051_+	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000168797.1|4120202_4121468_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000961458.1|4121708_4123301_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 305
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4128298	4133523	4581492		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|4128298_4128814_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|4128866_4128932_-	protein YliM	NA	NA	NA	NA	NA
WP_001295297.1|4129166_4130054_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|4130352_4130856_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|4131259_4132006_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|4132144_4132804_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569083.1|4132800_4133523_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
>prophage 306
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4137207	4152019	4581492		Erwinia_phage(14.29%)	13	NA	NA
WP_000710619.1|4137207_4137468_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430057.1|4137732_4140015_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990177.1|4140056_4140734_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146343.1|4140807_4141074_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|4141338_4141599_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443530.1|4141827_4142913_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386551.1|4143053_4144016_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001340191.1|4144043_4146194_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_001145126.1|4146313_4146796_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
WP_000007101.1|4147027_4148392_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|4148620_4149292_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000976409.1|4149291_4150290_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996107.1|4150282_4152019_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 307
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4162616	4163525	4581492		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|4162616_4163525_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 308
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4170006	4171296	4581492		Klosneuvirus(100.0%)	1	NA	NA
WP_001295303.1|4170006_4171296_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
>prophage 309
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4181651	4188225	4581492		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891692.1|4181651_4182710_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
WP_000604034.1|4182712_4183402_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000101984.1|4183401_4184175_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|4184341_4184491_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|4184619_4185408_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096869.1|4185475_4186948_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001265438.1|4187208_4188225_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
>prophage 310
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4192578	4196098	4581492		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109196.1|4192578_4193631_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
WP_000784351.1|4193946_4194327_+	periplasmic protein	NA	NA	NA	NA	NA
WP_000951292.1|4194440_4195382_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000345410.1|4195378_4196098_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
>prophage 311
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4232537	4233329	4581492		Kaumoebavirus(100.0%)	1	NA	NA
WP_001113989.1|4232537_4233329_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.5	7.5e-09
>prophage 312
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4236707	4239757	4581492		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001032689.1|4236707_4238189_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
WP_000207142.1|4238338_4239757_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	3.1e-61
>prophage 313
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4245483	4258204	4581492		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
WP_000015200.1|4245483_4249677_-	rhs element protein RhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	5.5e-26
WP_000424924.1|4249919_4250126_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001272653.1|4250438_4250528_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000741129.1|4250527_4252201_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000087939.1|4252223_4254272_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	2.4e-27
WP_001300431.1|4254280_4254853_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001310640.1|4254845_4257530_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_000186076.1|4257526_4258204_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
>prophage 314
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4271502	4275316	4581492	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287154.1|4271502_4273167_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023093.1|4273369_4275316_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 315
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4280082	4281747	4581492		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|4280082_4281747_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 316
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4285842	4286922	4581492		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|4285842_4286922_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 317
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4294002	4297535	4581492		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631384.1|4294002_4294728_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207520.1|4294845_4295781_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000367875.1|4295864_4297535_+	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.6	4.0e-76
>prophage 318
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4304474	4307057	4581492	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001340834.1|4304474_4307057_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	1.0e-184
>prophage 319
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4314067	4316506	4581492		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231430.1|4314067_4315156_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|4315294_4316506_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 320
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4321319	4321966	4581492		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939747.1|4321319_4321703_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|4321756_4321966_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 321
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4337386	4339492	4581492		Morganella_phage(50.0%)	2	NA	NA
WP_000278509.1|4337386_4337815_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_153676265.1|4337935_4339492_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 322
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4342586	4344409	4581492		Streptococcus_phage(50.0%)	2	NA	NA
WP_000029814.1|4342586_4343807_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	3.6e-58
WP_000502945.1|4343779_4344409_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
>prophage 323
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4358956	4364999	4581492		Klosneuvirus(50.0%)	3	NA	NA
WP_000140647.1|4358956_4359772_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_000096692.1|4359768_4360902_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000077805.1|4361117_4364999_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
>prophage 324
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4377298	4380442	4581492		Leptospira_phage(100.0%)	1	NA	NA
WP_000573945.1|4377298_4380442_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
>prophage 325
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4383712	4385828	4581492		Bacillus_phage(50.0%)	2	NA	NA
WP_000770953.1|4383712_4384396_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253839.1|4384385_4385828_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
>prophage 326
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4397044	4401744	4581492	terminase,lysis	Enterobacteria_phage(77.78%)	9	NA	NA
WP_001027248.1|4397044_4397788_-|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
WP_000453566.1|4397762_4398308_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001421937.1|4398696_4398891_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|4399055_4399262_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079503.1|4399547_4399958_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_000738500.1|4400248_4400542_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|4400632_4400815_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|4401031_4401529_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000839596.1|4401528_4401744_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
>prophage 327
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4411231	4414362	4581492	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_000729160.1|4411231_4412098_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|4412099_4412312_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143542.1|4412419_4412941_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912385.1|4412976_4414362_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
>prophage 328
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4425939	4427085	4581492		Streptococcus_phage(100.0%)	1	NA	NA
WP_001333621.1|4425939_4427085_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
>prophage 329
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4433275	4435057	4581492		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096881.1|4433275_4435057_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
>prophage 330
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4441568	4449233	4581492		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_078045913.1|4441568_4445705_-	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.6e-22
WP_000561872.1|4446135_4448550_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001110573.1|4448546_4449233_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 331
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4452369	4453047	4581492		Bacillus_virus(100.0%)	1	NA	NA
WP_001157540.1|4452369_4453047_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
>prophage 332
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4457586	4460748	4581492		uncultured_virus(50.0%)	2	NA	NA
WP_000083955.1|4457586_4460091_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	2.9e-115
WP_000806442.1|4460406_4460748_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
>prophage 333
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4468992	4477554	4581492		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801813.1|4468992_4469952_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	3.8e-15
WP_001250103.1|4469948_4470911_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|4471146_4471791_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678201.1|4471971_4473846_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|4473955_4474561_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|4474560_4474890_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122013.1|4474942_4476874_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|4477002_4477554_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 334
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4484562	4487712	4581492		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|4484562_4487712_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 335
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4496548	4500095	4581492		Bacillus_phage(100.0%)	2	NA	NA
WP_001256201.1|4496548_4498330_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	2.3e-42
WP_001235592.1|4498322_4500095_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.0e-49
>prophage 336
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4503418	4504114	4581492		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817220.1|4503418_4504114_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	5.5e-88
>prophage 337
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4507242	4512289	4581492	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|4507242_4507515_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|4507723_4510078_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|4510265_4511540_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|4511665_4512289_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 338
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4533848	4542829	4581492	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|4533848_4534319_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150457.1|4534407_4535511_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	2.8e-54
WP_000543535.1|4535514_4535964_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001326929.1|4536114_4536654_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|4536952_4537837_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|4538013_4538361_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|4538489_4539461_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|4539471_4541319_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|4541346_4541679_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|4541701_4542829_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 339
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4549781	4559858	4581492		Bacillus_phage(60.0%)	7	NA	NA
WP_000893623.1|4549781_4551077_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
WP_000113933.1|4551134_4551824_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221319.1|4552013_4553216_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000698951.1|4553212_4556359_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001326926.1|4556484_4557669_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219309.1|4557913_4558822_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|4558946_4559858_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 340
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4564147	4565263	4581492		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|4564147_4565263_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 341
NZ_CP045741	Escherichia coli strain DH5alpha chromosome, complete genome	4581492	4571955	4576504	4581492	transposase	uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000830741.1|4571955_4573113_+	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
WP_001295335.1|4573113_4573737_-	hydrogen peroxide resistance inhibitor IprA	NA	NA	NA	NA	NA
WP_000169527.1|4575341_4575641_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|4575637_4576504_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
>prophage 1
NZ_CP045742	Escherichia coli strain DH5alpha plasmid pTHNK130-1, complete sequence	180783	14581	54265	180783	transposase	Escherichia_phage(30.77%)	53	NA	NA
WP_000948429.1|14581_15781_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957857.1|15790_15979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210560.1|16828_16957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000849071.1|16953_17562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000393785.1|17566_18088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000805800.1|18090_18612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000057877.1|18708_19182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001370730.1|19192_19486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061602450.1|19490_20345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000829616.1|20344_21304_+	S49 family peptidase	NA	Q9JMP1	Wolbachia_phage	31.5	7.0e-17
WP_000139698.1|21319_22180_+	DsbA family protein	NA	NA	NA	NA	NA
WP_000591074.1|22213_22642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422768.1|22698_23058_+	hypothetical protein	NA	A0A076G835	Escherichia_phage	49.4	5.6e-20
WP_000919345.1|23057_23504_+	Fe3+-siderophore ABC transporter permease	NA	NA	NA	NA	NA
WP_000210756.1|23500_24019_+	nitrite reductase	NA	NA	NA	NA	NA
WP_000972663.1|24018_24249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001167032.1|24235_25093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342196.1|25160_25307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236377.1|25323_25851_+	thermonuclease family protein	NA	O64020	Bacillus_phage	37.0	1.3e-09
WP_001043047.1|25908_26181_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	59.6	4.2e-20
WP_001239997.1|26268_26562_+	chromosome segregation protein ParM	NA	NA	NA	NA	NA
WP_000124640.1|26588_26891_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270043.1|26895_27246_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_001061574.1|27408_27957_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_014342197.1|28078_28270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343597.1|28297_28492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000516916.1|28502_28874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001281821.1|28866_29337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000683476.1|29351_29687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001273096.1|29783_30272_+	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	61.7	1.7e-51
WP_000062185.1|30274_30772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|30986_31691_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014342101.1|31843_31966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001617865.1|31945_32821_+	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_013362812.1|32855_33824_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_153676270.1|35879_36464_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	96.0	6.9e-84
WP_153676271.1|36683_37394_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	95.7	4.1e-131
WP_000811656.1|37488_39000_-	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
WP_000101568.1|39286_40327_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_001097010.1|40479_41355_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_162007592.1|41503_41626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000139717.1|41671_42163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997323.1|42159_43029_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
WP_000949433.1|43979_44516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000575657.1|44814_45096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|45365_45968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326394.1|46606_47047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257735.1|47018_51272_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
WP_032410269.1|51226_51430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988731.1|51404_52130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868820.1|52243_52618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338626.1|52738_52855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|53260_54265_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP045742	Escherichia coli strain DH5alpha plasmid pTHNK130-1, complete sequence	180783	102168	134656	180783	integrase,transposase	Escherichia_phage(30.0%)	28	102106:102165	139762:140581
102106:102165	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067858.1|102168_102873_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001426317.1|103367_103748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000090707.1|104500_105343_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000351437.1|105329_107453_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001049180.1|107452_108901_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000909810.1|111122_111431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097216.1|111783_112083_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001239419.1|112646_114473_+	AAA family ATPase	NA	E5E3R2	Burkholderia_phage	22.8	4.7e-14
WP_000647571.1|114641_114992_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	50.5	1.8e-18
WP_000790485.1|115139_115571_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000555736.1|115815_117297_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
WP_001067858.1|117922_118627_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000572405.1|118933_119728_-	aminoglycoside O-phosphotransferase APH(3')-IIa	NA	Q75ZG1	Hepacivirus	100.0	9.5e-153
WP_000957857.1|121306_121495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000883925.1|123420_123855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342194.1|123941_124106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000350011.1|124891_125992_-	plasmid replication protein	NA	NA	NA	NA	NA
WP_000127321.1|125976_126264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001447712.1|126268_126808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000077458.1|127306_128290_+	ParM/StbA family protein	NA	A7KUY1	Bacillus_phage	24.4	2.1e-08
WP_000919078.1|128306_128600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000651490.1|128601_129021_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001020646.1|129080_129632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000454193.1|130633_130984_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|131186_132200_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|132357_132831_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|132961_133750_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001067855.1|133951_134656_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
139762:140581	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCACGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCAACGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 3
NZ_CP045742	Escherichia coli strain DH5alpha plasmid pTHNK130-1, complete sequence	180783	160264	168038	180783	integrase	Escherichia_phage(28.57%)	10	158056:158070	169301:169315
158056:158070	attL	CAGGATGGCATCGAG	NA	NA	NA	NA
WP_001302707.1|160264_161044_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	96.4	2.6e-54
WP_000239529.1|161181_161457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633913.1|161450_162095_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_001103690.1|162323_163295_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
WP_000340829.1|163299_163692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457496.1|163696_164968_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	1.4e-142
WP_000109071.1|164967_165405_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|165401_165650_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_072108049.1|165998_166970_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_021511694.1|167354_168038_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	3.0e-30
169301:169315	attR	CTCGATGCCATCCTG	NA	NA	NA	NA
