The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045762	Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 chromosome, complete genome	4794364	209503	304025	4794364	lysis,terminase,tail,portal,protease,capsid,head,holin,tRNA,plate,integrase	Escherichia_phage(44.44%)	108	242722:242768	274121:274167
WP_000560969.1|209503_209941_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001518251.1|209985_210927_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001259012.1|210941_211388_-	type II toxin-antitoxin system HigA family antitoxin	NA	NA	NA	NA	NA
WP_000558163.1|211384_211696_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_001127705.1|211781_212711_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001159635.1|212928_213240_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	NA	NA	NA	NA
WP_000362050.1|213240_213531_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000027730.1|213577_214507_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829025.1|214503_215139_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331361.1|215135_216038_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_077248424.1|216050_219101_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	4.6e-06
WP_001059747.1|219295_220132_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000710973.1|220399_221431_-	YiiG family protein	NA	NA	NA	NA	NA
WP_000828043.1|221613_222714_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_000527676.1|223057_223381_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_000683586.1|223380_224040_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010989088.1|224122_224689_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000619477.1|224777_225092_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000009250.1|225088_226237_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_001179685.1|226363_227191_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211472.1|227333_228593_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000143957.1|228589_230059_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217117.1|230346_231183_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000013291.1|231335_232184_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063541.1|232180_233215_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000378721.1|233833_234517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000566800.1|234675_235983_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_001091413.1|235975_236491_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000812816.1|236509_237493_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000122632.1|237821_238442_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
WP_011233226.1|238448_239201_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000133442.1|239212_239608_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000338671.1|239728_239932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580402.1|239979_241353_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_001033731.1|241349_242048_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001233463.1|242198_242699_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
242722:242768	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000985246.1|242884_243865_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|243934_244228_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|244364_244637_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217677.1|244806_245307_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000288879.1|245370_245595_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	2.3e-32
WP_001277964.1|245594_245897_+	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	97.0	2.5e-45
WP_001113272.1|245896_246121_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	97.3	8.5e-35
WP_000027666.1|246117_246393_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	97.8	1.6e-43
WP_000216280.1|246382_248671_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.0	0.0e+00
WP_000423601.1|248901_251109_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000038172.1|251539_252574_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	1.2e-200
WP_000156860.1|252573_254346_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.5	0.0e+00
WP_001085976.1|254519_255374_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	96.5	9.0e-133
WP_001248559.1|255432_256506_+|capsid	phage major capsid protein, P2 family	capsid	Q94MD1	Enterobacteria_phage	100.0	5.1e-202
WP_001682330.1|256509_257253_+|terminase	terminase endonuclease subunit	terminase	U5N091	Enterobacteria_phage	97.2	3.3e-123
WP_000988633.1|257352_257862_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|257861_258065_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123124.1|258068_258350_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144101.1|258349_258847_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736607.1|258861_259287_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.8e-58
WP_000040673.1|259274_259700_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	4.7e-66
WP_000917156.1|259807_260275_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	8.7e-82
WP_001001780.1|260267_260720_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_001093737.1|260786_261422_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	9.0e-114
WP_000127163.1|261418_261766_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121478.1|261770_262679_+|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	100.0	8.8e-163
WP_001285338.1|262671_263283_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	6.4e-117
WP_000216976.1|263279_264257_+|tail	tail protein	tail	A0A0F7LBW5	Escherichia_phage	88.6	1.7e-143
WP_031612487.1|264568_265282_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000006335.1|265478_265886_-|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	1.8e-59
WP_000022046.1|265892_266555_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	73.7	9.3e-37
WP_000905102.1|266753_267347_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	1.3e-103
WP_001286720.1|267406_268597_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	4.8e-225
WP_001251408.1|268609_269128_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031306.1|269184_269460_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|269492_269612_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069914.1|269604_272052_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	97.1	0.0e+00
WP_000978885.1|272066_272546_+|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
WP_000882949.1|272545_273709_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	7.0e-205
WP_000468308.1|273790_274009_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001077320.1|274245_275148_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
274121:274167	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591793.1|275332_276295_+	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758717.1|276498_277488_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000750754.1|277588_278344_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000777317.1|278608_279943_+	MFS transporter	NA	NA	NA	NA	NA
WP_000646499.1|279953_280913_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000557888.1|280922_281963_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_001528882.1|282025_282748_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000060997.1|282845_283010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621104.1|283025_283157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001173080.1|283246_283597_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000113085.1|283610_285203_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001283048.1|285290_286250_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001167250.1|286505_288041_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_000911134.1|288034_289078_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_000981826.1|289074_290076_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000090737.1|290104_291127_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774146.1|291155_292031_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_001543603.1|292113_292404_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001088046.1|292413_293178_+	epimerase	NA	NA	NA	NA	NA
WP_001216339.1|293269_294037_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802242.1|294149_294746_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155237.1|294846_295275_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000796303.1|295380_296127_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250617.1|296223_297234_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136809.1|297345_298854_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084287.1|298874_299720_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.6e-15
WP_000051370.1|300118_300358_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872918.1|300579_301065_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139639.1|301157_302087_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293360.1|302153_303485_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000208240.1|303494_304025_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 2
NZ_CP045762	Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 chromosome, complete genome	4794364	412011	432908	4794364	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587739.1|412011_412653_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.9	4.6e-33
WP_024132246.1|413231_413648_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000084336.1|414028_414484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151758.1|414480_415095_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368193.1|415101_416760_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.8e-52
WP_000359509.1|416762_417395_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
WP_000951734.1|417387_418503_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_001093501.1|418493_418853_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632053.1|419016_420564_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_000703633.1|420563_421493_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000593182.1|421489_421852_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|422179_422902_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|422911_423955_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|423942_424152_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271420.1|424151_425105_-	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|425104_427459_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|427555_427684_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|427643_427961_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907497.1|428012_428537_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	2.3e-67
WP_000729852.1|428536_429964_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|429953_430151_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|430147_430603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|430762_431077_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|431089_431695_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|431697_431985_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|432560_432908_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 3
NZ_CP045762	Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 chromosome, complete genome	4794364	1199408	1243004	4794364	lysis,terminase,portal,protease,coat,integrase	Enterobacteria_phage(44.26%)	62	1203255:1203300	1242520:1242565
WP_001043660.1|1199408_1200461_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	2.2e-112
WP_001285275.1|1200743_1201847_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893221.1|1201858_1203109_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	2.1e-98
1203255:1203300	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
WP_000051900.1|1203314_1204478_-|integrase	site-specific integrase	integrase	A0A075B8E2	Enterobacteria_phage	99.7	2.4e-229
WP_000016640.1|1204707_1205343_-	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	99.5	1.3e-120
WP_001277769.1|1205443_1205623_-	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	98.3	1.6e-28
WP_000208013.1|1205719_1206406_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.2	4.3e-53
WP_000224223.1|1206416_1206680_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	2.0e-30
WP_001289978.1|1206681_1207167_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.3e-43
WP_000812182.1|1207163_1207790_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	71.2	7.1e-71
WP_001682200.1|1207786_1207951_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	1.6e-22
WP_001111313.1|1207961_1208258_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	90.8	3.9e-43
WP_000031375.1|1208588_1209206_-	ERF family protein	NA	A0A0N7CFJ3	Salmonella_phage	100.0	3.3e-105
WP_000158027.1|1209335_1209524_-	hypothetical protein	NA	A0A075B8F9	Enterobacteria_phage	100.0	1.4e-30
WP_000582314.1|1209504_1209663_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A075B8H4	Enterobacteria_phage	100.0	4.0e-23
WP_000776964.1|1209748_1210060_-	superinfection exclusion protein	NA	A0A075B8E5	Enterobacteria_phage	100.0	1.1e-48
WP_001737461.1|1210207_1210411_-	DUF551 domain-containing protein	NA	A0A0N7CAQ5	Salmonella_phage	100.0	1.7e-34
WP_000651935.1|1210410_1210647_-	hypothetical protein	NA	A0A075B8J0	Enterobacteria_phage	100.0	4.3e-37
WP_000213983.1|1210683_1210878_-	hypothetical protein	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
WP_001682202.1|1211092_1211671_+	superinfection exclusion protein B	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_000216175.1|1211691_1211994_-	hypothetical protein	NA	B8K1E6	Salmonella_phage	98.0	1.1e-48
WP_001095984.1|1212347_1212998_-	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_000276884.1|1213078_1213264_+	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_000424167.1|1213370_1213649_+	transcriptional regulator	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_001125981.1|1213683_1213830_+	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000067075.1|1213822_1214638_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001248406.1|1214634_1216011_+	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000736921.1|1216084_1216522_+	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.3e-79
WP_000113772.1|1216658_1216835_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_001531428.1|1216837_1217170_+	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000950959.1|1217162_1217339_+	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001129733.1|1217331_1217943_+	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000036317.1|1217939_1218164_+	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_000149925.1|1218160_1218364_+	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_000219131.1|1218344_1218524_+	hypothetical protein	NA	A0A1U8QR34	Salmonella_phage	100.0	1.4e-24
WP_001235453.1|1218520_1219144_+	antitermination protein	NA	A0A075B8H9	Enterobacteria_phage	100.0	2.3e-114
WP_000286100.1|1219582_1219786_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_000074137.1|1219763_1220261_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	97.0	6.0e-89
WP_001531485.1|1220349_1220787_+|lysis	lysis protein	lysis	O80289	Bacteriophage	99.3	9.1e-73
WP_001177703.1|1220999_1221686_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	99.6	4.7e-124
WP_000807785.1|1221988_1222231_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_001278047.1|1222232_1222412_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	91.5	3.0e-22
WP_000729925.1|1222435_1222924_+	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_000417849.1|1222901_1224401_+|terminase	terminase	terminase	A0A192Y824	Salmonella_phage	99.8	1.4e-306
WP_000774656.1|1224400_1226578_+|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.9	0.0e+00
WP_000433852.1|1226591_1227503_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_001196938.1|1227502_1228795_+|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
WP_000684729.1|1228833_1229043_+	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_001166098.1|1229026_1229527_+	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_001122424.1|1229486_1230905_+	Packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_000774927.1|1230908_1231610_+	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
WP_000627697.1|1231609_1232065_+	DUF2824 family protein	NA	A0A192Y6V9	Salmonella_phage	100.0	5.2e-87
WP_000964902.1|1232067_1232760_+	hypothetical protein	NA	G5DA80	Enterobacteria_phage	98.7	1.2e-108
WP_000246945.1|1232769_1234065_+	DNA injection protein	NA	Q716G3	Shigella_phage	84.5	2.1e-181
WP_001029838.1|1234064_1236062_+	hypothetical protein	NA	Q716G2	Shigella_phage	94.9	0.0e+00
WP_000749288.1|1236152_1236638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000287064.1|1237040_1237295_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	63.3	4.4e-19
WP_000129930.1|1237430_1239434_+	endorhamnosidase	NA	A0A2H4FWI0	Salmonella_phage	99.9	0.0e+00
WP_000671495.1|1239492_1240950_-	hypothetical protein	NA	A0A192Y7W8	Salmonella_phage	100.0	4.5e-241
WP_000703640.1|1240939_1241872_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|1241868_1242231_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_001683918.1|1242728_1243004_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	64.1	1.9e-23
1242520:1242565	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
>prophage 4
NZ_CP045762	Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 chromosome, complete genome	4794364	1847229	1855252	4794364	protease,transposase	Dickeya_phage(14.29%)	8	NA	NA
WP_001201751.1|1847229_1848348_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125890.1|1848344_1850291_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|1850420_1850642_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1850965_1851286_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1851316_1853593_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1853783_1854242_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001117984.1|1854515_1854713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531374.1|1854874_1855252_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
>prophage 5
NZ_CP045762	Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 chromosome, complete genome	4794364	1905860	2003819	4794364	lysis,terminase,tail,portal,protease,tRNA,integrase,transposase	Salmonella_phage(45.61%)	103	1908769:1908788	1979707:1979726
WP_001154025.1|1905860_1906664_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1906656_1907979_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1907959_1908664_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572752.1|1908663_1913130_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1908769:1908788	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925883.1|1913474_1915295_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1915554_1916103_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1916130_1916778_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1916839_1918030_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|1918214_1919306_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1919912_1921313_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1921513_1921975_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1922291_1923506_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893206.1|1923750_1925184_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191413.1|1925264_1926467_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262307.1|1926661_1927954_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000065276.1|1927998_1928247_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001682304.1|1928287_1928527_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	98.7	3.3e-37
WP_000189634.1|1928532_1929402_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	86.3	7.2e-146
WP_000187054.1|1929398_1930079_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	97.8	3.3e-130
WP_000100830.1|1930075_1930861_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	98.8	2.4e-148
WP_000995352.1|1930866_1931163_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	100.0	1.1e-48
WP_000186242.1|1931253_1931454_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_000373338.1|1931741_1931948_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	1.6e-16
WP_000091280.1|1931974_1932409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000439725.1|1932410_1932836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001230956.1|1932878_1933274_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_000992434.1|1933378_1933615_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
WP_015675517.1|1933580_1933955_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	1.9e-63
WP_000024046.1|1934046_1934952_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	99.7	9.1e-176
WP_000788826.1|1934948_1935650_+	hypothetical protein	NA	A0A0M3ULE2	Salmonella_phage	99.1	1.9e-128
WP_023602525.1|1935694_1936096_+	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	98.5	5.4e-72
WP_000215887.1|1936092_1936626_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	89.8	8.1e-92
WP_000224239.1|1936627_1936885_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	4.5e-40
WP_000208143.1|1936895_1937297_+	hypothetical protein	NA	I6R0R2	Salmonella_phage	82.0	1.2e-18
WP_000877758.1|1937404_1938049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1938279_1938513_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1938629_1938878_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929790.1|1938912_1939515_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001096547.1|1939723_1940335_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_001617856.1|1940331_1940478_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1940467_1941265_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_000508329.1|1941431_1941650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000658038.1|1941930_1942119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682303.1|1942321_1942624_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000301013.1|1942601_1943141_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	72.4	2.2e-76
WP_086010216.1|1943457_1943943_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	80.4	1.1e-58
WP_000371784.1|1944153_1944687_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989238.1|1944643_1946782_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	6.9e-291
WP_000196190.1|1946778_1946985_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_077906132.1|1947011_1948529_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.7	7.5e-175
WP_077906133.1|1948452_1950531_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.3	2.4e-264
WP_001107908.1|1950621_1950945_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1950937_1951237_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453192.1|1951217_1951784_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
WP_000196703.1|1951780_1952182_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000132755.1|1952193_1952943_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478858.1|1952988_1953387_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1953383_1953713_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_065305406.1|1953792_1956780_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.0	2.5e-262
WP_000978295.1|1956776_1957109_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_000410972.1|1957207_1957732_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	35.3	1.8e-19
WP_000877926.1|1957821_1958355_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|1958444_1959140_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000606356.1|1959149_1959887_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	5.2e-113
WP_020867839.1|1959784_1960489_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	2.0e-66
WP_000178849.1|1963949_1964192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001532020.1|1964245_1966621_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	64.9	1.9e-87
WP_031618324.1|1967121_1967442_+	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	79.2	4.9e-44
WP_000143158.1|1967431_1968013_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.4	1.8e-92
WP_000161705.1|1968209_1968932_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000388788.1|1969144_1969363_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	89.7	1.7e-24
WP_000343758.1|1969582_1970803_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_071531551.1|1970799_1971297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193784.1|1971731_1974344_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1974551_1975562_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1975727_1976270_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1976266_1977376_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1977474_1979583_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1979595_1981503_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1979707:1979726	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1981517_1982771_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1982775_1984416_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1984412_1984976_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1985231_1985399_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1985498_1986017_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1986085_1987846_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1988031_1988484_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1988555_1989608_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1989964_1990474_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1990690_1991296_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1991282_1993436_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1993454_1993901_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1994024_1996079_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1996114_1996573_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847716.1|1996667_1997330_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|1997500_1997917_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1997961_1998279_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1998336_1999548_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859416.1|1999762_2000311_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|2000336_2001116_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|2001164_2001446_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|2001442_2001772_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|2001858_2002518_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000938191.1|2003138_2003819_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 6
NZ_CP045762	Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 chromosome, complete genome	4794364	2902951	2913552	4794364		Morganella_phage(25.0%)	12	NA	NA
WP_001157304.1|2902951_2904382_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
WP_000377037.1|2904455_2905151_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_000107434.1|2905230_2905542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153676277.1|2906192_2907389_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.3	2.3e-110
WP_024131109.1|2907646_2907835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2907845_2908058_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457664.1|2908512_2909781_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.2e-226
WP_000394197.1|2909783_2910203_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2910329_2910491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598921.1|2910971_2911769_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001683376.1|2912140_2912431_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	52.6	2.1e-09
WP_001219015.1|2913078_2913552_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
>prophage 7
NZ_CP045762	Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 chromosome, complete genome	4794364	2999547	3010053	4794364		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2999547_3000861_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|3000887_3001967_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|3001971_3002745_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|3002741_3003734_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|3003739_3004291_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|3004291_3005170_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|3005217_3006117_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|3006116_3007202_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|3007578_3008472_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111845.1|3008649_3010053_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	6.8e-21
>prophage 8
NZ_CP045762	Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 chromosome, complete genome	4794364	3078329	3087500	4794364	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195330.1|3078329_3080363_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|3080603_3081062_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|3081233_3081764_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|3081820_3082288_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|3082334_3083054_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|3083050_3084736_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240417.1|3084958_3085690_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|3085749_3085857_+	protein YohO	NA	NA	NA	NA	NA
WP_000824857.1|3085837_3086569_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569165.1|3086552_3087500_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 9
NZ_CP045762	Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 chromosome, complete genome	4794364	3106907	3175427	4794364	lysis,tail,holin,transposase	Salmonella_phage(27.27%)	62	NA	NA
WP_000989295.1|3106907_3107603_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|3107756_3108641_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|3108817_3109537_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|3109533_3109779_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136394.1|3109983_3111225_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956097.1|3111218_3112454_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|3112528_3113539_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|3113554_3115075_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|3115208_3116207_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|3116705_3117728_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001520237.1|3117877_3119020_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|3119034_3119703_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|3120032_3120890_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|3120878_3121268_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001531764.1|3121272_3122640_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022912.1|3122856_3123744_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|3123776_3125099_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488244.1|3125142_3127134_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|3127479_3128949_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548316.1|3129138_3130002_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137966.1|3130122_3131172_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873906.1|3131250_3132108_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	1.3e-22
WP_000854395.1|3132172_3133861_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|3133877_3134816_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|3134815_3135946_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|3136313_3137495_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213897.1|3137558_3138224_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|3138225_3138348_-	membrane protein	NA	NA	NA	NA	NA
WP_001523448.1|3138735_3138990_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|3139313_3139886_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169346.1|3140098_3141085_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|3141114_3141834_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|3142247_3142820_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957755.1|3143145_3144702_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561742.1|3144808_3146614_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501626.1|3146623_3147718_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137747.1|3147717_3148743_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000222013.1|3148744_3150334_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	7.2e-19
WP_001094639.1|3150337_3150682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|3151072_3152263_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234834.1|3152290_3152986_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578130.1|3153137_3154898_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	1.4e-100
WP_000494192.1|3155022_3155307_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033443.1|3155415_3156036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|3156063_3157071_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|3157250_3157478_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|3157509_3159270_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|3159550_3160054_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|3160081_3160372_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|3160719_3162549_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|3162602_3163046_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|3163423_3163951_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|3163953_3165195_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|3165787_3166117_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894638.1|3166413_3167745_+	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	4.6e-19
WP_010989045.1|3167773_3168142_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|3168156_3169146_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|3169474_3171841_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|3172009_3172213_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|3172509_3173301_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001653202.1|3173603_3173807_+	virulence protein MsgA	NA	NA	NA	NA	NA
WP_001682306.1|3174503_3175427_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	94.5	5.4e-168
>prophage 10
NZ_CP045762	Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 chromosome, complete genome	4794364	4713336	4726975	4794364	integrase	Enterobacteria_phage(80.0%)	14	4713154:4713175	4724426:4724447
4713154:4713175	attL	GACTCCTGTGATCTTCCGCCAA	NA	NA	NA	NA
WP_001218979.1|4713336_4714506_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.1	1.7e-198
WP_000119815.1|4714525_4716385_+	hypothetical protein	NA	A0A097BY72	Enterococcus_phage	22.4	1.8e-13
WP_000186475.1|4716381_4716807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446136.1|4717134_4717707_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.9e-94
WP_021038238.1|4717780_4718281_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001283037.1|4718277_4719012_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	99.2	2.7e-130
WP_001149160.1|4719563_4719830_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980222.1|4719826_4720417_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	4.1e-60
WP_001244665.1|4720409_4720697_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459302.1|4720689_4721145_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|4721280_4721601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783667.1|4721615_4723949_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_000120776.1|4724762_4725107_-	hypothetical protein	NA	NA	NA	NA	NA
4724426:4724447	attR	GACTCCTGTGATCTTCCGCCAA	NA	NA	NA	NA
WP_001541628.1|4725784_4726975_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	34.3	1.2e-10
>prophage 1
NZ_CP045763	Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 plasmid p1CFSAN000318, complete sequence	117406	5159	43838	117406	transposase,integrase	Salmonella_phage(18.18%)	35	10588:10603	47545:47560
WP_000487119.1|5159_6170_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	4.9e-21
WP_000113740.1|6390_6966_+	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	40.1	2.4e-28
WP_000896474.1|7283_7961_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000493383.1|7945_8806_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|8837_10037_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000470730.1|10115_10793_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
10588:10603	attL	AGGCCGGCGACAGCGA	NA	NA	NA	NA
WP_000844627.1|10824_11067_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001138014.1|11124_14091_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|14094_14655_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_000845048.1|14879_15893_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001682441.1|16038_16830_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_001288435.1|18317_19751_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	1.4e-106
WP_001532073.1|19784_20999_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	2.1e-34
WP_001067855.1|21320_22025_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|22516_23377_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000971921.1|24197_25568_-|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_000080861.1|25682_26819_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001330846.1|26869_27115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|27120_27312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|27793_28336_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|28348_29209_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067855.1|29441_30146_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427623.1|32945_33950_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_044568872.1|34214_34619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000627831.1|35095_35362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442119.1|35361_35856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517689.1|35911_36514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132019.1|36867_38214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001283356.1|38492_40373_+	colicin	NA	NA	NA	NA	NA
WP_000762580.1|40390_40738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000142424.1|40856_41204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194555.1|41221_41812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343102.1|41808_42069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465034.1|42637_43051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001164192.1|43052_43838_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	96.5	4.0e-55
47545:47560	attR	TCGCTGTCGCCGGCCT	NA	NA	NA	NA
>prophage 2
NZ_CP045763	Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 plasmid p1CFSAN000318, complete sequence	117406	57485	64320	117406	transposase	Stx2-converting_phage(50.0%)	8	NA	NA
WP_000977997.1|57485_58082_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.3	3.4e-14
WP_000117611.1|58543_59044_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.3	2.4e-05
WP_000218863.1|59772_60207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247862.1|60300_60567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078704.1|60631_61570_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	3.6e-66
WP_001682408.1|61704_62382_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|62381_62729_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|62748_64320_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
