The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045771	Citrobacter braakii strain MiY-A chromosome, complete genome	4917491	1500787	1508438	4917491		Thermobifida_phage(16.67%)	10	NA	NA
WP_003025085.1|1500787_1501642_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_016154690.1|1501687_1502179_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_003025078.1|1502262_1502550_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	4.2e-10
WP_153689977.1|1502572_1504006_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003025073.1|1504052_1504778_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_047358523.1|1504784_1505333_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_047358522.1|1505301_1505877_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_046276014.1|1505873_1506440_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.3	2.5e-54
WP_016154685.1|1506460_1507447_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	6.7e-39
WP_016154684.1|1507460_1508438_-	calcium/sodium antiporter	NA	A0A2D1GNI8	Pseudoalteromonas_phage	23.0	8.1e-05
>prophage 2
NZ_CP045771	Citrobacter braakii strain MiY-A chromosome, complete genome	4917491	2014153	2026182	4917491	integrase	uncultured_Mediterranean_phage(28.57%)	8	2012893:2012906	2037775:2037788
2012893:2012906	attL	GCGTATTCAGGCCA	NA	NA	NA	NA
WP_016157332.1|2014153_2014915_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.6	3.8e-58
WP_003034172.1|2014908_2015535_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.6	4.4e-36
WP_016154206.1|2015652_2016780_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.6	5.0e-06
WP_000081498.1|2016842_2017835_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_047414286.1|2017914_2020476_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	21.0	3.2e-32
WP_153690077.1|2020693_2021977_+|integrase	tyrosine-type recombinase/integrase	integrase	I6R9B6	Salmonella_phage	26.8	2.6e-19
WP_153690078.1|2022001_2022547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153690079.1|2023167_2026182_-	DEAD/DEAH box helicase	NA	A0A1D8BJ75	Sulfolobus_islandicus_filamentous_virus	23.6	2.9e-08
2037775:2037788	attR	GCGTATTCAGGCCA	NA	NA	NA	NA
>prophage 3
NZ_CP045771	Citrobacter braakii strain MiY-A chromosome, complete genome	4917491	2718660	2727107	4917491	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_016153694.1|2718660_2719608_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	25.1	2.9e-07
WP_049281973.1|2719591_2720323_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003027354.1|2720303_2720411_-	protein YohO	NA	NA	NA	NA	NA
WP_016153692.1|2720485_2721217_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.0	1.0e-105
WP_016153691.1|2721442_2723128_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.4	5.6e-280
WP_016153690.1|2723124_2723844_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_016156965.1|2723890_2724361_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	77.6	8.3e-64
WP_141875420.1|2724403_2724862_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	71.2	1.0e-50
WP_047501004.1|2725073_2727107_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	1.2e-53
>prophage 4
NZ_CP045771	Citrobacter braakii strain MiY-A chromosome, complete genome	4917491	2763099	2772667	4917491	protease,tRNA	Bacillus_phage(28.57%)	8	NA	NA
WP_153690214.1|2763099_2765046_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.2	4.8e-41
WP_003036813.1|2765120_2765345_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_003036810.1|2765668_2765989_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_016153651.1|2766019_2768296_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
WP_006683890.1|2768555_2769917_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	93.4	2.8e-205
WP_047501032.1|2770076_2770409_-	YegP family protein	NA	NA	NA	NA	NA
WP_019077149.1|2770544_2771267_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
WP_016153606.1|2771263_2772667_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.9	5.0e-32
>prophage 5
NZ_CP045771	Citrobacter braakii strain MiY-A chromosome, complete genome	4917491	3785763	3846774	4917491	tail,protease,lysis,terminase,coat	Enterobacteria_phage(25.71%)	68	NA	NA
WP_003034964.1|3785763_3786645_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_029139508.1|3786837_3788886_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.6	1.0e-86
WP_003833781.1|3788905_3789592_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_016152783.1|3789688_3790186_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_016152782.1|3790314_3791598_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_019076590.1|3791566_3794200_+	PqiB family protein	NA	NA	NA	NA	NA
WP_153690749.1|3794223_3795705_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_003034943.1|3795802_3796042_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_016152779.1|3796144_3796336_+	YebW family protein	NA	NA	NA	NA	NA
WP_103766188.1|3796336_3796978_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	48.1	9.6e-55
WP_153690452.1|3797068_3797815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101699978.1|3798581_3799250_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.7	5.3e-80
WP_101699977.1|3799565_3800525_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_101699976.1|3800538_3801069_-	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
WP_101699975.1|3801065_3801593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101699974.1|3801589_3802075_-	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
WP_101699973.1|3802071_3803292_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_049281531.1|3803288_3804011_-	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_101699972.1|3804012_3805269_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_047417980.1|3805265_3805985_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_101699971.1|3805981_3806416_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_047417986.1|3806621_3807350_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	44.8	6.0e-45
WP_047417989.1|3807581_3808043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047418452.1|3808308_3809778_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_047417991.1|3809859_3810126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047418455.1|3810431_3812429_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.5	9.7e-21
WP_047417995.1|3813145_3813535_-	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.1	2.5e-50
WP_003840850.1|3813854_3814097_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
WP_101699969.1|3814380_3815031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052134161.1|3815227_3815737_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_052134162.1|3815925_3816228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101699966.1|3816517_3816610_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	73.3	1.3e-05
WP_101699965.1|3816625_3816781_-	hypothetical protein	NA	A0A1S6L009	Salmonella_phage	74.5	1.7e-10
WP_047418003.1|3816874_3817198_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_153690453.1|3817468_3819874_-	hypothetical protein	NA	B1GS50	Salmonella_phage	62.5	4.7e-272
WP_153690454.1|3819930_3822654_-	kinase	NA	A0A286S259	Klebsiella_phage	58.6	0.0e+00
WP_047418006.1|3822650_3823031_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	78.6	4.3e-55
WP_019076987.1|3823040_3823529_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	68.2	6.0e-57
WP_153690455.1|3823525_3823990_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	56.4	9.7e-49
WP_047500758.1|3824420_3824798_-	hypothetical protein	NA	A0A2H4J9F9	uncultured_Caudovirales_phage	43.1	2.5e-18
WP_131345987.1|3824822_3825779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153690456.1|3825861_3829134_-|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	35.7	1.2e-100
WP_047418022.1|3829188_3829440_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	65.1	4.9e-23
WP_047418025.1|3829634_3829832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047418027.1|3829951_3830419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047418030.1|3830481_3831654_-	Ig domain-containing protein	NA	A0A059VG08	Pseudomonas_phage	42.2	5.1e-62
WP_047418033.1|3831680_3832073_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_047418035.1|3832069_3832621_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	40.4	2.3e-28
WP_047418037.1|3832622_3833006_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	44.4	5.4e-21
WP_047418040.1|3833011_3833422_-	hypothetical protein	NA	A0A0H5AUF0	Pseudomonas_phage	40.4	3.9e-09
WP_153690457.1|3833425_3833734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047418045.1|3833772_3834909_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	75.1	1.5e-156
WP_047418049.1|3834996_3835761_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	59.8	9.0e-76
WP_047418052.1|3835867_3836056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047418054.1|3837772_3839197_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	70.4	7.0e-191
WP_047418058.1|3839201_3840506_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	3.4e-147
WP_153690458.1|3840483_3841476_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	37.8	7.7e-35
WP_153690459.1|3841599_3842028_+	VOC family protein	NA	NA	NA	NA	NA
WP_047418063.1|3842068_3842530_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	64.1	2.0e-46
WP_047418066.1|3842526_3843075_-	lysozyme	NA	K7PM52	Enterobacteria_phage	97.3	1.2e-101
WP_016150496.1|3843046_3843325_-	hypothetical protein	NA	K7P6H9	Enterobacteria_phage	98.9	1.1e-44
WP_047418069.1|3843667_3844102_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	50.7	1.2e-27
WP_047418072.1|3844335_3845025_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.6	6.2e-60
WP_103766167.1|3845021_3845153_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	90.9	1.5e-10
WP_153690460.1|3845318_3845525_-	hypothetical protein	NA	K7PJT9	Enterobacteria_phage	77.3	1.9e-25
WP_153690461.1|3845524_3846127_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	89.5	7.5e-102
WP_153690462.1|3846209_3846431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016236996.1|3846540_3846774_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	98.7	6.6e-38
>prophage 6
NZ_CP045771	Citrobacter braakii strain MiY-A chromosome, complete genome	4917491	3850800	3932114	4917491	holin,integrase,head,terminase,capsid,tail,portal	Klebsiella_phage(23.73%)	92	3853286:3853312	3926911:3926937
WP_153690467.1|3850800_3851673_-	DNA-binding protein	NA	V5URT9	Shigella_phage	51.4	1.6e-84
WP_153690468.1|3851822_3852362_-	regulator	NA	K7PJT7	Enterobacteria_phage	86.6	5.5e-80
WP_097727139.1|3852373_3852595_-	hypothetical protein	NA	H6WRX5	Salmonella_phage	44.6	9.4e-10
WP_153690469.1|3852714_3853128_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	37.7	1.8e-06
3853286:3853312	attL	GTTCCGCCAGCCTGGCGACAAGGGCAA	NA	NA	NA	NA
WP_153690470.1|3853364_3853523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153690471.1|3853519_3853720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153690472.1|3853719_3853917_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_153690473.1|3853921_3854086_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	86.8	3.9e-21
WP_153690474.1|3854171_3854459_+	DNA breaking-rejoining protein	NA	H6WRX2	Salmonella_phage	77.9	4.3e-39
WP_153690475.1|3854584_3857524_+	exodeoxyribonuclease VIII	NA	K7P6V4	Enterobacteria_phage	87.9	0.0e+00
WP_047418276.1|3857535_3858582_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	63.6	9.9e-134
WP_047415379.1|3858621_3858864_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	88.6	1.1e-32
WP_072034353.1|3858928_3859201_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	62.2	3.2e-28
WP_047415377.1|3859169_3860255_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	69.0	1.6e-147
WP_075847181.1|3860591_3860930_-	YebY family protein	NA	NA	NA	NA	NA
WP_153690476.1|3860950_3861823_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_047415373.1|3861826_3862201_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_003034925.1|3862344_3862575_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
WP_016156222.1|3862681_3863338_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_016152773.1|3863361_3864024_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	31.1	9.1e-08
WP_053090135.1|3864005_3866105_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_016156220.1|3866167_3866827_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_103766151.1|3866928_3867282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003833810.1|3867403_3867694_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_153690477.1|3867826_3869005_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016152768.1|3869071_3869713_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_153690478.1|3869747_3871559_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_003034896.1|3871791_3873267_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.1	8.3e-78
WP_153690750.1|3873635_3874505_+	transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_016152765.1|3874623_3876066_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_047501988.1|3876110_3877082_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_016152763.1|3877201_3878521_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.5e-14
WP_019076521.1|3878536_3879481_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_153690479.1|3879559_3880315_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.8	1.7e-18
WP_103766149.1|3880311_3881097_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_135953055.1|3882102_3883305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153690480.1|3883486_3884755_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	78.7	2.5e-195
WP_153690751.1|3884754_3885174_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.6	4.7e-34
WP_153690481.1|3885251_3885494_+	DinI-like family protein	NA	Q6UAW0	Klebsiella_phage	77.9	2.6e-29
WP_109149526.1|3885818_3887150_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.4	1.8e-42
WP_153690482.1|3887146_3887515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153690483.1|3887882_3888467_-	DUF4376 domain-containing protein	NA	Q7BQC6	Enterobacteria_phage	47.7	2.3e-47
WP_153690752.1|3888478_3889225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153690484.1|3890463_3893844_-	DUF1983 domain-containing protein	NA	A0A0K2FI38	Escherichia_phage	70.8	0.0e+00
WP_049268765.1|3893915_3894593_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	68.9	8.0e-68
WP_153690485.1|3894490_3895225_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	75.7	1.2e-114
WP_153690486.1|3895236_3895932_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	71.9	7.1e-96
WP_153690487.1|3895940_3896273_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.1	2.2e-39
WP_153690488.1|3896273_3899576_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	65.4	0.0e+00
WP_153690489.1|3899826_3900189_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	56.8	6.2e-27
WP_003832379.1|3900251_3900734_-	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	80.6	6.1e-62
WP_101699948.1|3900767_3901169_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	85.7	2.2e-57
WP_016152738.1|3901165_3901555_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	65.3	6.7e-43
WP_016152737.1|3901523_3901874_-|head	phage head closure protein	head	Q6UAX3	Klebsiella_phage	74.8	2.4e-44
WP_032950890.1|3901870_3902188_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	79.6	2.1e-39
WP_101699945.1|3902168_3902555_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	59.0	9.6e-18
WP_153690490.1|3902652_3903939_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	88.8	7.7e-213
WP_153690491.1|3904011_3904932_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	79.7	3.0e-134
WP_153690492.1|3904968_3906228_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	88.1	1.7e-217
WP_153690493.1|3906400_3908122_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	58.6	1.6e-192
WP_153690494.1|3908121_3908556_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.1	2.7e-29
WP_042309020.1|3908891_3909254_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	89.2	1.2e-57
WP_153690495.1|3909964_3910873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153690753.1|3911112_3911646_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	72.5	3.2e-56
WP_153690496.1|3911636_3912185_-	glycoside hydrolase family protein	NA	K7PM52	Enterobacteria_phage	93.4	3.5e-98
WP_003832349.1|3912156_3912435_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	100.0	3.9e-45
WP_044711866.1|3912779_3913214_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	49.0	1.3e-26
WP_153690497.1|3913625_3913814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137366891.1|3913916_3914333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137366892.1|3914650_3915250_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	74.9	9.8e-86
WP_153690498.1|3915263_3916304_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	50.3	1.3e-96
WP_153690499.1|3916300_3916660_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	63.6	6.4e-40
WP_153690500.1|3916662_3916863_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	61.5	2.1e-16
WP_065554934.1|3917282_3917516_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	83.1	2.7e-31
WP_153690501.1|3917797_3918889_-	permease	NA	NA	NA	NA	NA
WP_065554936.1|3918990_3919287_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088583139.1|3919353_3919779_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	1.9e-51
WP_153690502.1|3919791_3921081_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.2	6.0e-173
WP_153690503.1|3921127_3922879_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_038641374.1|3922896_3923259_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_044700602.1|3923306_3923660_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	4.8e-24
WP_153690754.1|3923783_3924329_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	76.8	7.1e-67
WP_153690504.1|3924240_3925356_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	55.1	1.4e-48
WP_153690505.1|3925404_3925959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115602206.1|3925962_3926175_-	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	59.7	4.9e-16
WP_153690506.1|3926280_3926661_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	65.3	1.9e-18
WP_032943037.1|3926879_3927095_+	hypothetical protein	NA	NA	NA	NA	NA
3926911:3926937	attR	GTTCCGCCAGCCTGGCGACAAGGGCAA	NA	NA	NA	NA
WP_135912188.1|3927256_3927595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032944383.1|3927606_3927933_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_153690755.1|3928074_3930546_+	exonuclease	NA	K7P6V4	Enterobacteria_phage	38.3	4.8e-110
WP_153690507.1|3930612_3930828_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	54.9	2.8e-19
WP_153690756.1|3930827_3932114_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	50.6	2.7e-109
