The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045837	Citrobacter sp. H12-3-2 chromosome, complete genome	4948530	866737	906412	4948530	tRNA,capsid,integrase	Bacillus_phage(16.67%)	45	860646:860661	909043:909058
860646:860661	attL	TGCAGTTGTTCAATGT	NA	NA	NA	NA
WP_153752296.1|866737_867721_-|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_003825514.1|867978_868245_+	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_003825515.1|868225_868633_+	membrane protein	NA	NA	NA	NA	NA
WP_003026933.1|868734_869256_-	flavodoxin FldB	NA	NA	NA	NA	NA
WP_003825519.1|869369_870266_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	27.9	2.5e-29
WP_003825520.1|870289_871003_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_153752298.1|871008_872742_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.3	1.4e-60
WP_100194817.1|872833_873931_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_003026911.1|873941_875459_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	1.3e-86
WP_048215592.1|875536_876091_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_020996306.1|876257_877016_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	37.3	3.2e-09
WP_151451381.1|877656_878259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076730442.1|878741_878951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153752300.1|878961_879522_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SCL7	Streptococcus_phage	34.1	1.0e-15
WP_151451380.1|881258_881687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076730439.1|881970_882954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151451379.1|882968_883442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153752302.1|883555_883891_+	hypothetical protein	NA	A0A2H4YGU9	Raoultella_phage	69.2	2.3e-07
WP_076730707.1|883890_886047_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_076730706.1|886658_886994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153752304.1|887018_888077_+|capsid	major capsid protein E	capsid	NA	NA	NA	NA
WP_076730445.1|888192_888408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000002667.1|888432_888681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032968401.1|888915_889095_+	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_076730446.1|889150_889429_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	38.1	6.5e-08
WP_076730447.1|889456_890644_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_080528468.1|891302_891869_+	hypothetical protein	NA	A0A1L5C2A2	Pseudoalteromonas_phage	69.4	8.0e-05
WP_044700793.1|891892_892390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044700792.1|892452_892722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003838329.1|892797_893091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044700790.1|893087_893285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044700788.1|893378_893957_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6D2	Bacillus_phage	26.3	5.0e-10
WP_044700786.1|896245_897007_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044700784.1|897018_897300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003846410.1|897311_897710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044700783.1|897706_897913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044700780.1|897905_898208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003846417.1|898925_899141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003846419.1|899137_899506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003846421.1|899527_900559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003846423.1|900697_900898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044699790.1|900890_902762_+	hypothetical protein	NA	A0A1Q1N989	Escherichia_phage	29.5	1.1e-53
WP_003033848.1|902789_903461_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003033850.1|903711_904947_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_048215593.1|905227_906412_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	60.4	2.0e-138
909043:909058	attR	TGCAGTTGTTCAATGT	NA	NA	NA	NA
>prophage 2
NZ_CP045837	Citrobacter sp. H12-3-2 chromosome, complete genome	4948530	1243839	1252936	4948530	integrase	Enterobacteria_phage(83.33%)	9	1243597:1243610	1252956:1252969
1243597:1243610	attL	AAGCGTATACCAAT	NA	NA	NA	NA
WP_153752440.1|1243839_1246173_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.5	0.0e+00
WP_000743149.1|1246187_1246508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001216597.1|1246504_1246732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153752442.1|1246728_1247286_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	66.7	1.2e-29
WP_119917220.1|1248089_1248827_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	62.3	6.0e-77
WP_000984211.1|1248823_1249069_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_153752444.1|1249085_1249652_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.4	5.7e-59
WP_153752446.1|1250054_1251740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153752448.1|1251736_1252936_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	51.0	5.1e-110
1252956:1252969	attR	ATTGGTATACGCTT	NA	NA	NA	NA
>prophage 3
NZ_CP045837	Citrobacter sp. H12-3-2 chromosome, complete genome	4948530	1506872	1515500	4948530	transposase,integrase	Escherichia_phage(33.33%)	7	1502873:1502886	1518568:1518581
1502873:1502886	attL	ATTCTGGTGAGATG	NA	NA	NA	NA
WP_153752552.1|1506872_1507655_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.1	1.8e-135
WP_153752554.1|1507651_1508674_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.3	5.3e-172
WP_153752556.1|1510645_1511641_+	hypothetical protein	NA	V5UPJ4	Shigella_phage	69.9	3.3e-54
WP_153752557.1|1511645_1512920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153752559.1|1512916_1513834_-	glycosyltransferase	NA	B9UDL7	Salmonella_phage	86.5	1.0e-150
WP_153752561.1|1513830_1514193_-	GtrA family protein	NA	U5P0S6	Shigella_phage	84.2	6.8e-50
WP_153752564.1|1514330_1515500_-|integrase	tyrosine-type recombinase/integrase	integrase	C6ZR22	Salmonella_phage	90.5	3.9e-211
1518568:1518581	attR	CATCTCACCAGAAT	NA	NA	NA	NA
>prophage 4
NZ_CP045837	Citrobacter sp. H12-3-2 chromosome, complete genome	4948530	1732894	1741461	4948530	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_153752638.1|1732894_1733842_+	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	25.6	2.2e-07
WP_048234924.1|1733825_1734557_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003027354.1|1734537_1734645_-	protein YohO	NA	NA	NA	NA	NA
WP_153752640.1|1734844_1735576_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	92.5	2.0e-104
WP_020996665.1|1735801_1737487_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.4	3.3e-280
WP_003840155.1|1737483_1738203_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_003834454.1|1738249_1738720_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	77.4	1.8e-63
WP_057066540.1|1738763_1739222_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	69.9	3.2e-52
WP_032943974.1|1739427_1741461_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	8.9e-54
>prophage 5
NZ_CP045837	Citrobacter sp. H12-3-2 chromosome, complete genome	4948530	1791904	1801482	4948530	tRNA,protease	Bacillus_phage(28.57%)	8	NA	NA
WP_153752668.1|1791904_1793851_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.8	1.8e-40
WP_003036813.1|1793925_1794150_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_003036810.1|1794473_1794794_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036804.1|1794824_1797101_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
WP_043016896.1|1797370_1798732_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	93.2	4.8e-205
WP_048224506.1|1798891_1799224_-	YegP family protein	NA	NA	NA	NA	NA
WP_032943946.1|1799359_1800082_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
WP_153752669.1|1800078_1801482_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.2	2.3e-32
>prophage 6
NZ_CP045837	Citrobacter sp. H12-3-2 chromosome, complete genome	4948530	1843332	1850837	4948530		Enterobacteria_phage(42.86%)	7	NA	NA
WP_153752694.1|1843332_1844727_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	34.0	6.1e-22
WP_153752696.1|1844875_1845871_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0K1L6Z1	Scale_drop_disease_virus	28.5	1.5e-09
WP_153752698.1|1846108_1847002_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	39.7	2.8e-44
WP_153752700.1|1847369_1848455_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	9.7e-100
WP_153752702.1|1848454_1849354_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	36.0	4.2e-32
WP_153752704.1|1849404_1850283_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.4	5.6e-106
WP_153752706.1|1850285_1850837_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	59.6	3.3e-56
>prophage 7
NZ_CP045837	Citrobacter sp. H12-3-2 chromosome, complete genome	4948530	2033462	2042395	4948530		Organic_Lake_phycodnavirus(16.67%)	8	NA	NA
WP_153752801.1|2033462_2035541_+	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	36.3	6.3e-31
WP_003833802.1|2035531_2036194_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	31.1	9.1e-08
WP_008785043.1|2036217_2036874_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_003034925.1|2036980_2037211_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
WP_003844143.1|2037359_2039111_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	33.3	7.2e-44
WP_153752803.1|2039528_2040254_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_153752162.1|2040560_2041139_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	37.7	6.5e-18
WP_003844140.1|2041492_2042395_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.0	5.5e-16
>prophage 8
NZ_CP045837	Citrobacter sp. H12-3-2 chromosome, complete genome	4948530	2046555	2122837	4948530	tRNA,head,terminase,holin,capsid,portal,protease,integrase,tail	Enterobacteria_phage(50.91%)	89	2046453:2046483	2089330:2089360
2046453:2046483	attL	ACAGGAATCGTATTCGGTCTCTTTTTATGTG	NA	NA	NA	NA
WP_153752806.1|2046555_2047641_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	68.7	2.8e-147
WP_016156226.1|2047609_2047882_-	hypothetical protein	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	63.3	2.5e-28
WP_003841647.1|2047946_2048189_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	89.9	1.3e-33
WP_153752808.1|2048175_2048379_-	hypothetical protein	NA	A0A1B0VN94	Pseudomonas_phage	66.7	1.3e-10
WP_153752810.1|2048371_2048716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153752812.1|2048750_2049791_-	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	75.1	2.3e-154
WP_153752813.1|2049804_2052360_-	exodeoxyribonuclease VIII	NA	K7P6V4	Enterobacteria_phage	45.9	4.0e-229
WP_001568763.1|2052672_2052879_-	hypothetical protein	NA	K7PM31	Enterobacteria_phage	100.0	1.5e-33
WP_086523735.1|2053230_2054382_-	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	27.8	3.7e-33
WP_086523851.1|2054403_2055072_-	helix-turn-helix transcriptional regulator	NA	A0A2D1GM27	Escherichia_phage	68.3	1.0e-91
WP_086523734.1|2055214_2055433_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	78.3	1.9e-23
WP_153752815.1|2055462_2056002_+	regulator	NA	K7PJT7	Enterobacteria_phage	80.4	3.1e-75
WP_153753970.1|2056085_2056277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153753971.1|2056341_2057184_+	hypothetical protein	NA	V5URT9	Shigella_phage	28.9	1.1e-26
WP_153752817.1|2057186_2057936_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	88.8	2.5e-123
WP_153752819.1|2057954_2058266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153753972.1|2058671_2059184_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	74.9	2.4e-72
WP_153752820.1|2060077_2060335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153752821.1|2060755_2060956_+	hypothetical protein	NA	U5P0J0	Shigella_phage	41.2	4.3e-06
WP_153752822.1|2061054_2061657_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	90.5	6.4e-101
WP_153752823.1|2061656_2061863_+	hypothetical protein	NA	K7PJT9	Enterobacteria_phage	75.8	1.6e-24
WP_103848778.1|2061865_2062474_+	protein NinG	NA	A0A0M4RU10	Salmonella_phage	63.7	2.4e-47
WP_001568781.1|2062470_2062611_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	95.7	1.2e-18
WP_057064561.1|2062607_2063438_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	98.9	1.6e-155
WP_001568784.1|2063940_2064219_+|holin	holin	holin	K7PGZ9	Enterobacteria_phage	97.8	5.1e-45
WP_153752824.1|2064190_2064694_+	glycoside hydrolase family protein	NA	K7P7Q3	Enterobacteria_phage	90.2	5.0e-83
WP_153752825.1|2064782_2065325_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	81.9	1.3e-60
WP_153752826.1|2065449_2065623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103284338.1|2065637_2066366_+	Fur-regulated protein	NA	M9NZE9	Enterobacteria_phage	84.7	3.7e-103
WP_127791704.1|2066616_2067162_+|terminase	terminase small subunit	terminase	E4WL18	Enterobacteria_phage	99.4	2.8e-95
WP_153752828.1|2067136_2069059_+|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	96.9	0.0e+00
WP_153752830.1|2069058_2069265_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	94.0	9.3e-28
WP_003826190.1|2069261_2070854_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	92.1	9.7e-290
WP_048231659.1|2070834_2072172_+	S49 family peptidase	NA	O64320	Escherichia_phage	83.9	1.2e-189
WP_003826193.1|2072181_2072514_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	82.7	5.0e-47
WP_103284335.1|2072581_2073607_+|capsid	major capsid protein	capsid	K7P6G7	Enterobacteria_phage	92.7	8.7e-183
WP_153752831.1|2073652_2074057_+	DNA-packaging protein	NA	K7PM13	Enterobacteria_phage	53.0	6.1e-23
WP_153752832.1|2074068_2074422_+|tail	phage tail protein	tail	K7P6U9	Enterobacteria_phage	76.1	6.9e-47
WP_048231665.1|2074431_2074986_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	91.4	2.1e-74
WP_003826202.1|2074982_2075381_+|tail	tail protein	tail	K7P7G5	Enterobacteria_phage	82.6	1.2e-60
WP_048231668.1|2075388_2076126_+|tail	tail fiber protein	tail	O64327	Escherichia_phage	67.3	8.1e-90
WP_008784480.1|2076162_2076570_+|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	58.6	1.7e-25
WP_071524448.1|2076578_2076899_+|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	69.8	2.7e-34
WP_048231671.1|2076876_2079393_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	70.3	0.0e+00
WP_008322439.1|2079396_2079744_+	hypothetical protein	NA	K7PJT2	Enterobacteria_phage	69.6	2.3e-39
WP_153752833.1|2079740_2080499_+|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	96.0	1.4e-142
WP_088902111.1|2080500_2081211_+	peptidase P60	NA	K7PGR2	Enterobacteria_phage	91.9	2.2e-137
WP_008784485.1|2081241_2081577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032941793.1|2081628_2082231_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	72.8	6.0e-75
WP_008323352.1|2082268_2082586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008323354.1|2082554_2082815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153752834.1|2082981_2086167_+	DUF1983 domain-containing protein	NA	O64335	Escherichia_phage	86.5	0.0e+00
WP_044700331.1|2086166_2086481_+	hypothetical protein	NA	O64336	Escherichia_phage	59.6	7.0e-27
WP_153752835.1|2086481_2087156_+	hypothetical protein	NA	O64337	Escherichia_phage	51.5	1.2e-52
WP_153752836.1|2087264_2087504_+	cor protein	NA	K7PLZ0	Enterobacterial_phage	58.4	7.0e-19
WP_153753973.1|2088186_2088873_+	hypothetical protein	NA	A0A220NRP2	Escherichia_phage	66.2	1.3e-70
WP_048235214.1|2089508_2090150_+	protein-serine/threonine phosphatase	NA	Q71TJ1	Escherichia_phage	50.2	1.3e-56
2089330:2089360	attR	ACAGGAATCGTATTCGGTCTCTTTTTATGTG	NA	NA	NA	NA
WP_003034941.1|2090150_2090342_-	YebW family protein	NA	NA	NA	NA	NA
WP_003034943.1|2090444_2090684_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_153752838.1|2090781_2092203_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_063940870.1|2092282_2094916_-	PqiB family protein	NA	NA	NA	NA	NA
WP_048216185.1|2094884_2096168_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_003833782.1|2096296_2096794_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_003833781.1|2096890_2097577_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_048235216.1|2097596_2099645_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	6.1e-87
WP_003034964.1|2099837_2100719_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_048216186.1|2100766_2102140_-	MFS transporter	NA	NA	NA	NA	NA
WP_153752840.1|2102314_2103106_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_003034975.1|2103220_2103460_-	membrane protein	NA	NA	NA	NA	NA
WP_003034977.1|2103624_2103768_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_003833774.1|2103842_2104127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003034983.1|2104763_2104907_+	YobF family protein	NA	NA	NA	NA	NA
WP_001062678.1|2104919_2105129_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_003833773.1|2105348_2107094_+	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_153752842.1|2107157_2107967_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_020996621.1|2107963_2108530_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_048216190.1|2108963_2109422_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_003833769.1|2109482_2110334_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_003021004.1|2110346_2111147_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_003833768.1|2111205_2112168_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_008785026.1|2112627_2114187_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	5.1e-41
WP_008785025.1|2114193_2115795_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_100272287.1|2115925_2117290_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_153752844.1|2117473_2118052_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_153752846.1|2118055_2119417_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	32.1	2.3e-42
WP_003020986.1|2119500_2119680_+	YoaH family protein	NA	NA	NA	NA	NA
WP_003020984.1|2119686_2120031_-	RidA family protein	NA	NA	NA	NA	NA
WP_003020980.1|2120172_2122083_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.1	9.1e-93
WP_032943756.1|2122141_2122837_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	A0A0R6PI74	Moraxella_phage	35.4	5.8e-05
>prophage 9
NZ_CP045837	Citrobacter sp. H12-3-2 chromosome, complete genome	4948530	2348186	2357047	4948530	tRNA,terminase,holin	Escherichia_phage(83.33%)	12	NA	NA
WP_032943567.1|2348186_2349122_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.5	9.8e-141
WP_153752937.1|2350020_2350290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153752938.1|2350500_2351070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047416721.1|2351403_2351802_+	membrane protein	NA	NA	NA	NA	NA
WP_153752939.1|2351798_2352020_+|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	1.8e-08
WP_153753980.1|2352073_2352616_+	hypothetical protein	NA	A0A0U2I1S0	Escherichia_phage	72.3	6.4e-76
WP_153752941.1|2352612_2352885_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	62.8	1.6e-19
WP_153752943.1|2353317_2353809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153752945.1|2353959_2354574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153752947.1|2354655_2354883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153752949.1|2354906_2355479_+|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	82.6	9.7e-67
WP_153752951.1|2355475_2357047_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	92.0	2.6e-303
>prophage 10
NZ_CP045837	Citrobacter sp. H12-3-2 chromosome, complete genome	4948530	2806152	2816160	4948530	tRNA	Brazilian_cedratvirus(28.57%)	10	NA	NA
WP_153753236.1|2806152_2806932_+	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	4.6e-11
WP_103285103.1|2806928_2808371_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	2.9e-51
WP_048235505.1|2808432_2809146_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003832591.1|2809464_2809929_-	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
WP_008784579.1|2810006_2810756_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
WP_153753237.1|2810755_2811307_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003832584.1|2811367_2812348_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.7e-15
WP_003030571.1|2812469_2812769_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_032943162.1|2812773_2815161_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_153753238.1|2815176_2816160_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
>prophage 11
NZ_CP045837	Citrobacter sp. H12-3-2 chromosome, complete genome	4948530	3084298	3171950	4948530	tRNA,head,terminase,holin,capsid,portal,protease,integrase,tail	Salmonella_phage(25.53%)	95	3115331:3115347	3172915:3172931
WP_008784297.1|3084298_3084958_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	2.6e-47
WP_008784296.1|3085046_3085376_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_020996508.1|3085372_3085654_-	acylphosphatase	NA	NA	NA	NA	NA
WP_008784294.1|3085748_3086939_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_003035905.1|3086996_3087314_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_153753380.1|3087381_3087795_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_016149882.1|3087967_3088630_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_003035897.1|3088723_3089182_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_153753382.1|3089214_3091269_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
WP_003831998.1|3091394_3091841_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_048236463.1|3091859_3094013_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_079934916.1|3093990_3094605_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_008784287.1|3094822_3095332_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_153753383.1|3095689_3096748_+	porin OmpA	NA	NA	NA	NA	NA
WP_032942905.1|3096836_3097289_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_153753385.1|3097474_3099235_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003035875.1|3099303_3099822_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_003035871.1|3099929_3100097_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_048214507.1|3100353_3100917_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_048235695.1|3100913_3102554_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_032942902.1|3102558_3103812_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_008784281.1|3103827_3105735_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	6.0e-52
WP_153753387.1|3105747_3107856_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_153753389.1|3107954_3109061_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_003035852.1|3109057_3109600_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_003831973.1|3109765_3110776_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_153753391.1|3111019_3111595_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_048235698.1|3111587_3112562_+	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_153753393.1|3112558_3113704_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_048235702.1|3113714_3114506_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_008784274.1|3114502_3115270_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	2.0e-30
3115331:3115347	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_153753395.1|3115366_3117979_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.9	3.1e-19
WP_153753397.1|3118405_3118648_+	DinI-like family protein	NA	Q6UAW0	Klebsiella_phage	76.6	2.9e-28
WP_153753973.1|3118776_3119463_-	hypothetical protein	NA	A0A220NRP2	Escherichia_phage	66.2	1.3e-70
WP_153753399.1|3120097_3121060_-	hypothetical protein	NA	F8UBU3	Escherichia_phage	49.2	1.6e-85
WP_153753400.1|3121059_3123780_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	92.5	0.0e+00
WP_121581689.1|3123779_3124178_-	hypothetical protein	NA	S4TR39	Salmonella_phage	93.9	1.5e-69
WP_121581691.1|3124184_3124769_-	hypothetical protein	NA	S4TND4	Salmonella_phage	96.4	7.8e-104
WP_121581693.1|3124768_3125362_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	95.9	1.2e-107
WP_003841703.1|3125527_3125752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016150474.1|3125740_3126100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048997959.1|3126142_3129478_-|tail	phage tail tape measure protein	tail	S4TTF9	Salmonella_phage	67.8	0.0e+00
WP_048997960.1|3129526_3129904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048997961.1|3129965_3130244_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	86.7	1.1e-36
WP_023993431.1|3130252_3130642_-|tail	phage tail assembly protein	tail	K7PKV6	Enterobacterial_phage	85.3	7.3e-58
WP_038642094.1|3130669_3131374_-|tail	tail protein	tail	K7PHL2	Enterobacterial_phage	74.4	5.7e-93
WP_127785621.1|3131431_3131779_-	DUF3168 domain-containing protein	NA	A0A220NRP0	Escherichia_phage	75.7	1.8e-44
WP_086539186.1|3131775_3132225_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	85.9	5.0e-66
WP_057107378.1|3132221_3132560_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	2.3e-39
WP_048221283.1|3132569_3132893_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.0	8.6e-20
WP_153753402.1|3132889_3133096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016150485.1|3133134_3134343_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	82.9	6.2e-188
WP_153753404.1|3134356_3135010_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	85.5	3.0e-104
WP_153753406.1|3134996_3136226_-|portal	phage portal protein	portal	U5P411	Shigella_phage	82.9	1.9e-205
WP_088731911.1|3136225_3136411_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	57.6	4.9e-12
WP_153753408.1|3136421_3138179_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	89.6	0.0e+00
WP_003841734.1|3138178_3138676_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	73.9	9.7e-63
WP_153753410.1|3138822_3139173_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.0	6.0e-51
WP_108961644.1|3139160_3139451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086539076.1|3139904_3140444_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	73.8	7.3e-56
WP_048240885.1|3140464_3140953_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	71.3	1.4e-66
WP_094542926.1|3140936_3141269_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	95.4	4.2e-54
WP_001446083.1|3141717_3142251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003839229.1|3142366_3143053_-	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	78.5	2.8e-100
WP_153753412.1|3143343_3144126_-	antitermination protein	NA	F1C595	Cronobacter_phage	75.2	2.4e-108
WP_153753413.1|3144122_3144446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080100503.1|3144448_3146320_-	AAA family ATPase	NA	C6ZR53	Salmonella_phage	58.9	5.4e-223
WP_080100504.1|3146426_3147350_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	60.8	1.0e-33
WP_075206730.1|3147346_3147544_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_075206729.1|3147545_3147764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048998241.1|3147877_3148585_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	74.2	2.8e-95
WP_048998235.1|3148920_3149124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048218896.1|3149120_3149312_+	hypothetical protein	NA	A0A1B5FPB5	Escherichia_phage	63.0	3.3e-11
WP_048998227.1|3149308_3149734_+	hypothetical protein	NA	A0A1B5FPB2	Escherichia_phage	48.3	2.4e-06
WP_048998225.1|3149795_3150065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048998253.1|3150183_3150540_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	49.6	3.1e-23
WP_048998222.1|3150539_3150770_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	69.9	1.5e-21
WP_048998220.1|3150762_3151176_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	67.9	1.5e-48
WP_048998217.1|3151175_3151457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048998216.1|3151453_3152305_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	78.1	6.2e-126
WP_048998215.1|3152297_3152720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153753415.1|3152716_3152893_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	77.1	8.2e-17
WP_048998214.1|3152900_3153149_+	excisionase family protein	NA	S4TND0	Salmonella_phage	83.8	3.2e-35
WP_048998213.1|3153193_3154486_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	95.1	6.1e-242
WP_153753416.1|3154680_3155883_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_020996514.1|3156049_3157450_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.9	5.0e-80
WP_048235705.1|3158050_3159127_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	53.9	1.5e-100
WP_048235707.1|3159310_3160501_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_153753417.1|3160553_3161201_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003831948.1|3161229_3161778_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	32.6	3.5e-05
WP_153753418.1|3161955_3163707_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_153753419.1|3164686_3169147_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_003035809.1|3169146_3169851_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_003831939.1|3169831_3171154_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_153753420.1|3171146_3171950_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
3172915:3172931	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 12
NZ_CP045837	Citrobacter sp. H12-3-2 chromosome, complete genome	4948530	3467526	3475656	4948530		Escherichia_phage(50.0%)	8	NA	NA
WP_153753567.1|3467526_3468357_-	alpha/beta fold hydrolase	NA	W8EHU1	Mycobacterium_phage	31.2	6.0e-17
WP_003831264.1|3468632_3469043_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_003022101.1|3469226_3469655_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	1.1e-17
WP_153753569.1|3469724_3470492_-	hydrogenase	NA	NA	NA	NA	NA
WP_008784074.1|3470491_3471049_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.7	6.2e-26
WP_048235898.1|3471045_3473316_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	25.0	2.6e-46
WP_153753570.1|3473312_3473867_-	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	29.0	4.5e-08
WP_020996553.1|3474090_3475656_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	1.1e-43
>prophage 1
NZ_CP045839	Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence	84545	0	60024	84545	transposase,integrase	Escherichia_phage(41.67%)	59	22908:22967	33711:34368
WP_001493762.1|1169_1742_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|1878_2469_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_000776034.1|4183_4615_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_000457559.1|4614_5886_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	4.9e-151
WP_006797589.1|5967_6945_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	5.0e-87
WP_000368714.1|6941_8147_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|8561_8831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|9007_9874_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000764642.1|10636_10894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|10951_11728_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000129823.1|11724_12468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493378.1|12518_12869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000648897.1|13658_13949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000386705.1|13948_15073_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_001350003.1|15107_16700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000494510.1|16921_17680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000528930.1|17691_18183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371884.1|18456_18696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001084041.1|18885_20958_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000085084.1|20954_22346_-	hypothetical protein	NA	NA	NA	NA	NA
22908:22967	attL	CGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067858.1|22971_23676_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_065799591.1|23566_24331_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	36.9	1.3e-26
WP_063844315.1|24475_24973_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_153754056.1|25084_25375_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|25380_26172_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|26335_26683_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|26676_27516_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|27920_29462_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_114213596.1|29679_30096_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_012372818.1|30176_30932_-	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_000027057.1|31101_31962_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|32144_32702_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001067858.1|33001_33706_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000743213.1|33778_34003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|34213_35707_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
33711:34368	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGGAAAGGGCATGAAGAAGCCGAACCAAGACGACGAGCCGTTTTTCATCACCGAGGAGATTGCGGCCGAAATGATCGCCGGCGGCTATGAGTTCGAGCTGCCGCCCATTCCTTGCACCATCCGCCTACGCGACGTGCTGGAGCGCATGACCGATGCTGAGCTAGCATTGCAGCCGGGCGAGATCGCCGACCAGGAGCGTGAACGCTGCCGGCGCAAGCCGTGTTCAACCTCATGATCTGGTCATGGTATTTTTCATGGCACTGAGCCTGATAGTTCTTGCAAATTGTTGTCACTAAAGGGTTTTGTGTGCTTGTTTACAATCGAGTGGGAGTGACGGGCACTGGCTGGCAATGTCTAGCAACGGCAGGCATTTCGGCTGAGGGTAAAAGAACTTTCCGCTAAGCGATAGACTGTATGTAAACACAGTATTGCAAGGACGCGGAACATGCCTCATGTGGCGGCCAGGACGGCCAGCCGGGATCGGGATACTGGTCGTTACCAGAGCCACCGACCCGAGCAAACCCTTCTCTATCAGATCGTTGACGAGTATTACCCGGCATTCGCTGCGCTTATGGCAGAGCAGGGAAAGGAATTGCCGGG	NA	NA	NA	NA
WP_001447541.1|35737_36622_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_058100717.1|36838_38053_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001255015.1|38080_38386_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021545039.1|38747_39773_+|transposase	IS21-like element ISEc57 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	44.1	6.6e-74
WP_001053381.1|39772_40546_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	55.4	5.5e-73
WP_075322286.1|40620_41895_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000602738.1|43476_44229_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_000957857.1|44961_45150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112901278.1|45159_46359_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000220561.1|46855_47137_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	2.9e-24
WP_000121743.1|47126_47378_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_024129959.1|48612_49452_+	replication initiation protein	NA	NA	NA	NA	NA
WP_000435064.1|49472_50315_+	replication initiation protein	NA	NA	NA	NA	NA
WP_001074384.1|50318_50765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024129958.1|50901_51255_+	DNA distortion protein 3	NA	NA	NA	NA	NA
WP_012291478.1|51792_52857_-	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	30.4	6.3e-27
WP_000051066.1|53280_53511_-	partitioning protein	NA	NA	NA	NA	NA
WP_000864788.1|53562_54183_-	ParA family protein	NA	A2I303	Vibrio_virus	33.8	6.3e-19
WP_000203199.1|54477_55122_+	resolvase	NA	A0A1V0E035	Clostridioides_phage	28.3	9.8e-07
WP_000347021.1|55237_55417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|56988_57693_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000084745.1|58027_58420_+	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_063102497.1|58739_59126_-	bleomycin binding protein	NA	NA	NA	NA	NA
WP_001067858.1|59319_60024_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
