The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045875	Heliorestis convoluta strain HH chromosome, complete genome	3218981	110260	121129	3218981		Prochlorococcus_phage(25.0%)	10	NA	NA
WP_153723886.1|110260_111628_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.9	2.2e-48
WP_153723887.1|111737_112220_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	39.7	9.8e-20
WP_153723888.1|112237_113374_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_153723889.1|113881_115177_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.2	3.3e-22
WP_153726441.1|115221_115938_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SCX8	Cyanophage	43.3	1.1e-43
WP_153723890.1|115954_116206_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_153723891.1|116232_117672_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.6	5.1e-64
WP_153723892.1|117708_118806_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	48.7	7.3e-71
WP_153723893.1|118845_119469_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.7	1.7e-27
WP_153723894.1|119518_121129_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.4	2.5e-83
>prophage 2
NZ_CP045875	Heliorestis convoluta strain HH chromosome, complete genome	3218981	152742	209644	3218981	coat,transposase,integrase	Brevibacillus_phage(16.67%)	52	203502:203561	210044:210214
WP_153723916.1|152742_153606_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	33.9	1.4e-32
WP_153723917.1|153938_155465_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_153723918.1|155461_156238_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	35.9	9.9e-38
WP_153723919.1|156457_158380_+	ATP-binding protein	NA	A0A2H4J2R8	uncultured_Caudovirales_phage	41.6	1.1e-143
WP_153723920.1|159215_160709_+	hypothetical protein	NA	Q332L3	Clostridium_botulinum_C_phage	30.2	2.8e-33
WP_153723921.1|160846_161038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153723922.1|161058_161457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162007828.1|161666_162761_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_153723924.1|162909_163134_+	DUF3006 family protein	NA	NA	NA	NA	NA
WP_153723925.1|163868_164060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153723926.1|164330_165839_+	helix-hairpin-helix domain-containing protein	NA	Q0H255	Geobacillus_phage	46.9	1.5e-58
WP_162007829.1|165873_166692_-	helix-turn-helix domain-containing protein	NA	A0A139ZPI6	Marinitoga_camini_virus	25.5	1.7e-11
WP_153723928.1|166836_167067_+	helix-turn-helix domain-containing protein	NA	B5LPU7	Bacillus_virus	48.6	5.9e-07
WP_153723929.1|167232_167823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162007830.1|167836_168397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153723931.1|168440_169103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162007831.1|169379_169946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162007832.1|170064_172275_+	ATP-dependent RecD-like DNA helicase	NA	A0A218KCE8	Bacillus_phage	31.0	6.0e-64
WP_151620732.1|172484_172814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153723934.1|172825_173170_+	PrgI family protein	NA	NA	NA	NA	NA
WP_162007833.1|173206_173878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153723936.1|173886_175812_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_153723937.1|175912_177847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153723938.1|177858_179625_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A222YU16	Streptomyces_phage	31.2	6.6e-13
WP_162007834.1|179745_180069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151620719.1|180096_180297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162007835.1|180420_181122_+	flagella basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_153723941.1|181133_182225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153723942.1|182160_183474_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_153723943.1|183470_184364_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_153723944.1|184363_185155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153723945.1|185151_185610_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_153723946.1|185657_186539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153723947.1|186684_192927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162007836.1|193010_194360_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_153723949.1|194369_194831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153723950.1|194853_195399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162007837.1|195407_196025_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_153723952.1|196110_196266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162007838.1|196509_198153_+	recombinase family protein	NA	A0A2P1JU08	Anoxybacillus_phage	26.7	8.2e-34
WP_153723954.1|198303_198585_-|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_153723955.1|198603_198834_-|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_153723956.1|198994_199210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153723957.1|199263_200442_-	MFS transporter	NA	NA	NA	NA	NA
WP_153723958.1|200642_202079_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_153723959.1|202165_203032_-	universal stress protein	NA	NA	NA	NA	NA
203502:203561	attL	TAGCTTCTCACCAATTCTCGGAGGTCTGAAGCGAACTTTATCGAGATAGCCTGACCAACG	NA	NA	NA	NA
WP_153723960.1|203941_204895_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	27.1	7.6e-24
WP_153723961.1|205481_206024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153723962.1|206370_207318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153723963.1|207451_208024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153723964.1|208047_208545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153723965.1|208744_209644_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	35.2	1.4e-43
210044:210214	attR	TAGCTTCTCACCAATTCTCGGAGGTCTGAAGCGAACTTTATCGAGATAGCCTGACCAACGCTTTGTCTGTCGTGCGGAAGGAAGGCGAAATCTAAAACGAGAGACTACGCTCGTAGATGCCTATGTGGGTATTTCTTCGGACGCTGGGTTCGACTCCCGCCGCCTCCACCA	NA	NA	NA	NA
>prophage 3
NZ_CP045875	Heliorestis convoluta strain HH chromosome, complete genome	3218981	1135078	1238927	3218981	integrase,portal,transposase,head,protease,tRNA,terminase,holin,tail,capsid	Erysipelothrix_phage(27.08%)	96	1195626:1195643	1239209:1239226
WP_153724707.1|1135078_1135903_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_153724708.1|1135902_1136562_+	sugar transferase	NA	NA	NA	NA	NA
WP_153724709.1|1136558_1137437_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_153726522.1|1137441_1138719_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_153724710.1|1138715_1140569_+	heparinase II/III family protein	NA	NA	NA	NA	NA
WP_153724711.1|1140612_1141833_+	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	28.2	1.1e-27
WP_153724712.1|1141912_1143169_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_162007907.1|1143411_1144473_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_153726523.1|1144765_1144894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153724714.1|1145767_1146337_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_153724715.1|1146282_1146525_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_153724716.1|1146509_1146875_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_153724717.1|1147421_1148657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162007908.1|1148653_1149688_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_153724719.1|1150325_1151435_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_153724720.1|1151796_1153167_+	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	40.1	7.7e-86
WP_153724721.1|1153147_1154173_+	SDR family NAD(P)-dependent oxidoreductase	NA	K7QJG5	Escherichia_phage	25.0	2.6e-22
WP_153724722.1|1154273_1154723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153724723.1|1155044_1156616_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	36.4	1.3e-23
WP_153724724.1|1156679_1157036_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	51.1	2.1e-19
WP_153724725.1|1157817_1158210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153724726.1|1158283_1159366_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_153724727.1|1159362_1159728_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153724728.1|1159882_1160128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153724729.1|1160541_1161696_+	DUF2800 domain-containing protein	NA	A0A0A7S066	Clostridium_phage	51.3	2.5e-106
WP_153724730.1|1161707_1162247_+	DUF2815 family protein	NA	A0A0A7RVM4	Clostridium_phage	54.2	1.9e-48
WP_153726524.1|1162252_1164202_+	hypothetical protein	NA	S5M5X4	Brevibacillus_phage	62.0	7.1e-234
WP_153726525.1|1164272_1166651_+	hypothetical protein	NA	A0A0A7RTG3	Clostridium_phage	50.9	6.2e-240
WP_153724731.1|1166905_1167184_+	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	56.7	1.3e-19
WP_153724732.1|1167180_1168578_+	DEAD/DEAH box helicase	NA	A0A1S7FYY5	Listeria_phage	59.6	5.3e-159
WP_153724733.1|1168552_1168969_+	DUF4406 domain-containing protein	NA	A0A2K5B270	Erysipelothrix_phage	50.0	6.0e-34
WP_153724734.1|1168970_1169201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153724735.1|1169201_1169624_+	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_153724736.1|1169829_1170219_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.3	2.5e-29
WP_153726526.1|1170811_1172071_+	ParB N-terminal domain-containing protein	NA	A0A2I4R670	Erysipelothrix_phage	59.0	3.7e-143
WP_153726527.1|1172211_1172526_+	hypothetical protein	NA	A0A2K5B282	Erysipelothrix_phage	57.8	4.1e-27
WP_153724737.1|1172613_1173486_+	virulence-related protein	NA	NA	NA	NA	NA
WP_153724738.1|1173607_1174114_+|terminase	phage terminase small subunit P27 family	terminase	Q6DMU4	Streptococcus_phage	65.6	9.2e-53
WP_153724739.1|1174139_1175696_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	57.2	3.7e-177
WP_153724740.1|1175706_1176951_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	61.5	2.8e-143
WP_153724741.1|1177052_1177313_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_153724742.1|1177408_1178257_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	Q6DMU1	Streptococcus_phage	54.0	8.8e-56
WP_153724743.1|1178261_1179458_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	64.9	9.9e-146
WP_153724744.1|1179483_1180047_+|head,tail	phage head-tail connector protein	head,tail	A0A0R6PKP1	Moraxella_phage	48.9	4.7e-05
WP_153724745.1|1180040_1180385_+|head	phage head closure protein	head	A6M954	Geobacillus_virus	39.0	6.8e-15
WP_153724746.1|1180365_1180737_+	HK97 gp10 family phage protein	NA	A0A288WGM7	Bacillus_phage	32.4	4.2e-10
WP_153724747.1|1180753_1181077_+	hypothetical protein	NA	A0A2I7SC10	Paenibacillus_phage	42.6	1.1e-14
WP_153724748.1|1181064_1181637_+|tail	phage tail protein	tail	E2ELJ1	Clostridium_phage	42.9	4.6e-32
WP_153724749.1|1181789_1182089_+	hypothetical protein	NA	H0USX2	Bacillus_phage	30.9	2.4e-08
WP_170285770.1|1182100_1182256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153724750.1|1182301_1184824_+|tail	phage tail tape measure protein	tail	R9QSQ8	Staphylococcus_phage	46.5	2.8e-97
WP_153724751.1|1184823_1185531_+|tail	phage tail family protein	tail	A0A0A7RWN1	Clostridium_phage	33.6	3.8e-36
WP_153724752.1|1185530_1187153_+|tail	phage tail protein	tail	A0A0A7RUI9	Clostridium_phage	34.7	2.8e-50
WP_153724753.1|1187149_1188217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153726528.1|1188529_1188943_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	56.7	9.3e-35
WP_153724754.1|1188908_1189934_+	N-acetylmuramoyl-L-alanine amidase	NA	R4JGH8	Bacillus_phage	35.1	1.2e-11
WP_153724755.1|1190144_1191803_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	35.6	3.7e-66
WP_153724756.1|1191799_1193440_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	43.8	3.0e-92
WP_162007909.1|1193549_1197185_+	recombinase family protein	NA	E4ZFN9	Streptococcus_phage	39.8	1.2e-69
1195626:1195643	attL	TTTGAAAAAGAGAACATC	NA	NA	NA	NA
WP_153724758.1|1197408_1197690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153724760.1|1197875_1198328_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_153724761.1|1198331_1198529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153724762.1|1199389_1200694_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	40.6	6.7e-55
WP_162007910.1|1200809_1201622_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	36.1	2.8e-35
WP_153724764.1|1201587_1204476_+	recombinase family protein	NA	D0R0F3	Streptococcus_phage	39.5	6.0e-64
WP_153724765.1|1204732_1205278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162007911.1|1205413_1205641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153724767.1|1205963_1206257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153724768.1|1206315_1207641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153724769.1|1208206_1209166_+	recombinase family protein	NA	A0A1B0RXE6	Streptococcus_phage	36.5	1.0e-39
WP_162007912.1|1209458_1209941_+	recombinase family protein	NA	M1PSD6	Streptococcus_phage	50.6	8.3e-35
WP_153724772.1|1210118_1210469_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153724773.1|1210461_1211265_+	ImmA/IrrE family metallo-endopeptidase	NA	I3VYZ2	Thermoanaerobacterium_phage	34.0	8.7e-05
WP_153724774.1|1211638_1212421_+	recombinase zinc beta ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_162007913.1|1212531_1216167_+	recombinase family protein	NA	E4ZFN9	Streptococcus_phage	36.7	3.6e-66
WP_153724776.1|1216391_1216667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153726529.1|1217244_1218192_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	64.7	2.5e-112
WP_162007914.1|1218706_1219969_+	recombinase family protein	NA	Q6DMS5	Streptococcus_phage	31.5	7.0e-49
WP_151618596.1|1220270_1220525_+	hypothetical protein	NA	A0A0A8WF72	Clostridium_phage	39.7	9.7e-11
WP_153726530.1|1220801_1221605_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_153724778.1|1223149_1223620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153724779.1|1223933_1224224_+|protease	aspartyl protease family protein	protease	NA	NA	NA	NA
WP_153724780.1|1224259_1224517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153724781.1|1224695_1224857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153724782.1|1226100_1227066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153724783.1|1227698_1228268_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_162007916.1|1229269_1229746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153724785.1|1229897_1230137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153724786.1|1230152_1230872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162007917.1|1231629_1232298_+	virulence protein	NA	A0A2K5B280	Erysipelothrix_phage	39.3	5.7e-42
WP_153724788.1|1232432_1233341_-|capsid	phage major capsid protein	capsid	Q6DMU0	Streptococcus_phage	41.9	1.5e-61
WP_153724789.1|1233360_1233597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153724790.1|1233912_1236165_-	DNA primase	NA	A0A2H4J4H0	uncultured_Caudovirales_phage	25.3	9.5e-49
WP_162007918.1|1236318_1236549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153724792.1|1236866_1237445_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153724793.1|1237559_1238927_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2R2ZGM9	Clostridioides_phage	32.8	2.4e-26
1239209:1239226	attR	TTTGAAAAAGAGAACATC	NA	NA	NA	NA
>prophage 4
NZ_CP045875	Heliorestis convoluta strain HH chromosome, complete genome	3218981	1414016	1529789	3218981	portal,protease,terminase,integrase,tail,capsid	Paenibacillus_phage(31.25%)	108	1460965:1461024	1535082:1535158
WP_162007930.1|1414016_1414580_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_162007931.1|1414693_1415428_+	DUF4912 domain-containing protein	NA	NA	NA	NA	NA
WP_153726543.1|1415420_1417019_+	DUF1957 domain-containing protein	NA	NA	NA	NA	NA
WP_153724936.1|1417684_1418932_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_153726544.1|1418993_1419308_-	carbohydrate-binding protein	NA	NA	NA	NA	NA
WP_153724937.1|1419611_1420748_-	homocitrate synthase	NA	NA	NA	NA	NA
WP_153724938.1|1420893_1421109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153724939.1|1421150_1421624_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_162007932.1|1421738_1422545_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_153724941.1|1422666_1426644_-	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	24.2	1.6e-06
WP_153724942.1|1426643_1430240_-	helicase-exonuclease AddAB subunit AddB	NA	NA	NA	NA	NA
WP_153724943.1|1430419_1431142_+	UDP-galactose-lipid carrier transferase	NA	NA	NA	NA	NA
WP_153724944.1|1431264_1432293_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_153724945.1|1432340_1432706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153724946.1|1433167_1434658_-	nitrite/sulfite reductase	NA	NA	NA	NA	NA
WP_153724947.1|1434718_1435309_-	adenylyl-sulfate kinase	NA	A0A2P1ELS9	Moumouvirus	39.3	1.5e-22
WP_153724948.1|1435814_1436888_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_153726545.1|1436964_1438092_-	sulfate adenylyltransferase	NA	A0A2K9L0F0	Tupanvirus	32.8	2.8e-41
WP_153724949.1|1438186_1438900_-	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_153724950.1|1439018_1439198_-	DUF2292 domain-containing protein	NA	NA	NA	NA	NA
WP_153724951.1|1439484_1439919_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	43.4	7.5e-19
WP_153724952.1|1440078_1440837_-	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_153724953.1|1440890_1442627_-	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	29.2	3.9e-26
WP_153724954.1|1442891_1443542_+	cobalamin B12-binding domain-containing protein	NA	NA	NA	NA	NA
WP_153724955.1|1443534_1444593_+	methylcobamide--CoM methyltransferase MtbA	NA	NA	NA	NA	NA
WP_162007933.1|1444582_1446862_+	response regulator	NA	A0A1V0SGX0	Hokovirus	35.0	1.1e-47
WP_153724957.1|1446994_1448044_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_153724958.1|1451470_1454107_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_153724959.1|1454343_1454907_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_153724960.1|1454918_1456448_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	30.9	3.6e-39
WP_153724961.1|1456938_1457208_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_153724962.1|1457236_1457965_-	CoA-transferase	NA	NA	NA	NA	NA
WP_153724963.1|1457964_1458759_-	CoA transferase subunit A	NA	NA	NA	NA	NA
1460965:1461024	attL	GGGCCCGTTGGTCAAGTGGTCTAAGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAA	NA	NA	NA	NA
WP_153724964.1|1462012_1462969_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4IBS1	Pseudomonas_phage	34.1	4.2e-06
WP_153724965.1|1463263_1464001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153724966.1|1464217_1465405_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	27.0	1.1e-24
WP_153724967.1|1465759_1467616_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_153724968.1|1468037_1468460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153724969.1|1468462_1469173_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_153724970.1|1469323_1470778_-	DNA (cytosine-5-)-methyltransferase	NA	K4HZD0	Acidithiobacillus_phage	28.6	3.9e-35
WP_153724971.1|1470964_1471906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162007934.1|1472138_1472810_+	site-specific DNA-methyltransferase	NA	A0A2K9VH43	Faecalibacterium_phage	41.2	2.8e-41
WP_153726546.1|1473505_1473862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153724973.1|1474026_1474920_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	34.8	2.4e-48
WP_162007935.1|1475889_1476069_+	Spo0E family sporulation regulatory protein-aspartic acid phosphatase	NA	NA	NA	NA	NA
WP_170285783.1|1476195_1477557_+	ABC transporter ATP-binding protein	NA	J9Q807	Salmonella_phage	49.0	4.3e-44
WP_153724976.1|1477689_1478532_+	amidoligase family protein	NA	A0A218KCI6	Bacillus_phage	41.6	5.3e-45
WP_153724977.1|1478576_1478855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162007936.1|1478996_1479494_+	gamma-glutamylcyclotransferase	NA	G3MAQ5	Bacillus_virus	46.9	2.5e-26
WP_153726547.1|1479778_1481383_+|terminase	phage terminase large subunit	terminase	A0A0N9RZA7	Paenibacillus_phage	49.2	4.4e-141
WP_153724979.1|1481443_1482901_+|portal	phage portal protein	portal	A0A0N7GFE4	Paenibacillus_phage	60.5	2.9e-155
WP_153724980.1|1482900_1483806_+|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	36.6	1.1e-40
WP_153724981.1|1483808_1484345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153724982.1|1484414_1485329_+|capsid	phage major capsid protein	capsid	A0A0N9S7T7	Paenibacillus_phage	67.2	3.9e-110
WP_153724983.1|1485595_1485943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153724984.1|1485942_1486254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153724985.1|1486253_1486697_+	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	40.0	4.2e-17
WP_153724986.1|1486711_1487077_+	hypothetical protein	NA	A0A0N7GFE5	Paenibacillus_phage	28.1	6.5e-08
WP_153724987.1|1487076_1487484_+|tail	phage major tail protein, TP901-1 family	tail	A0A0C5AMZ4	Paenibacillus_phage	40.3	4.9e-20
WP_153724988.1|1487485_1487782_+	hypothetical protein	NA	A0A2I7SBZ1	Paenibacillus_phage	34.1	1.5e-07
WP_153724989.1|1487811_1488111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153724990.1|1488156_1490214_+|tail	phage tail tape measure protein	tail	A0A0C5AJ16	Paenibacillus_phage	36.8	4.4e-69
WP_153724991.1|1490216_1490930_+|tail	phage tail family protein	tail	A0A0N9RRA9	Paenibacillus_phage	44.5	5.9e-37
WP_153724992.1|1490941_1494091_+|tail	phage tail protein	tail	A0A0N9SIL8	Paenibacillus_phage	25.5	2.0e-65
WP_153724993.1|1494103_1494454_+	hypothetical protein	NA	A0A2H4JCI0	uncultured_Caudovirales_phage	45.3	6.5e-05
WP_153724994.1|1494504_1494750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153724995.1|1494753_1495386_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	54.5	1.3e-43
WP_153724996.1|1495415_1495640_+	hypothetical protein	NA	A0A290GJS2	Caldibacillus_phage	36.8	8.9e-08
WP_153724997.1|1495754_1496777_+	helix-turn-helix domain-containing protein	NA	A0A0N7GFE9	Paenibacillus_phage	48.6	8.5e-21
WP_153724998.1|1496773_1497550_+	ATP-binding protein	NA	A0A142F1P9	Bacillus_phage	30.6	2.1e-27
WP_153724999.1|1497543_1498803_+	AAA family ATPase	NA	G9BWB0	Planktothrix_phage	21.8	5.6e-06
WP_153725000.1|1498943_1499906_+	toprim domain-containing protein	NA	A0A0N9S7Y2	Paenibacillus_phage	43.0	1.2e-61
WP_153725001.1|1499886_1500315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153725002.1|1500350_1500755_-	helix-turn-helix domain-containing protein	NA	A0A0K2FLG2	Brevibacillus_phage	27.2	6.8e-06
WP_153725003.1|1500993_1501587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153725004.1|1501629_1502313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153726548.1|1502406_1504653_+	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	41.0	2.7e-144
WP_153726549.1|1504640_1505564_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_153725005.1|1505564_1505897_+	Holliday junction resolvase	NA	NA	NA	NA	NA
WP_153725006.1|1505897_1506362_+	4Fe-4S cluster-binding domain-containing protein	NA	NA	NA	NA	NA
WP_153725007.1|1506358_1508281_+	anaerobic ribonucleoside-triphosphate reductase	NA	D9ZNH0	Clostridium_phage	25.8	9.0e-24
WP_153725008.1|1508281_1509529_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8DJM9	Virus_Rctr41k	34.4	5.1e-52
WP_153725009.1|1509559_1510060_+	dUTP diphosphatase	NA	V9SFR6	Tunisvirus	49.3	1.5e-26
WP_153725010.1|1510056_1510986_+	hypothetical protein	NA	A7KUZ3	Bacillus_phage	49.4	5.1e-81
WP_153726550.1|1511405_1511966_+	site-specific DNA-methyltransferase	NA	A0A1U9ZA49	Proteus_phage	56.7	8.1e-58
WP_153725011.1|1511899_1512592_+	hypothetical protein	NA	A0A1U9ZA49	Proteus_phage	34.1	6.1e-23
WP_153725012.1|1512693_1513218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153725013.1|1513198_1513429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153726551.1|1513462_1513960_+	hypothetical protein	NA	A0A0N9SJZ0	Paenibacillus_phage	41.2	1.2e-23
WP_153725014.1|1513984_1514341_+	RNA polymerase subunit sigma-28	NA	NA	NA	NA	NA
WP_153725015.1|1514342_1514732_+	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	42.0	1.2e-12
WP_162007937.1|1514756_1515566_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3JT82	Bacillus_phage	50.3	3.3e-36
WP_153725017.1|1515529_1515775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153725018.1|1515930_1516599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153726552.1|1517187_1517631_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4IBS1	Pseudomonas_phage	35.4	5.1e-07
WP_153725019.1|1517791_1518301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162007938.1|1518753_1519515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153725022.1|1519599_1520826_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	27.2	8.9e-25
WP_162007939.1|1521209_1521443_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_162007940.1|1521488_1521995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162007941.1|1522120_1522420_+	amidoligase family protein	NA	A0A1B1IN52	uncultured_Mediterranean_phage	47.4	1.0e-06
WP_153725026.1|1522463_1522742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153725027.1|1523837_1524455_+	DUF4351 domain-containing protein	NA	NA	NA	NA	NA
WP_153725028.1|1525916_1526402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153725029.1|1526612_1526777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153726553.1|1526940_1527492_-	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_153725030.1|1527620_1527869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153725031.1|1528853_1529789_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIE1	Clostridium_phage	29.6	6.1e-18
1535082:1535158	attR	GGGCCCGTTGGTCAAGTGGTCTAAGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAATCCCCTACGGGTCACCA	NA	NA	NA	NA
>prophage 5
NZ_CP045875	Heliorestis convoluta strain HH chromosome, complete genome	3218981	2098944	2136895	3218981	transposase,integrase	Bacillus_phage(16.67%)	44	2119077:2119096	2120460:2120479
WP_153726613.1|2098944_2099787_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	46.6	2.6e-60
WP_162007992.1|2100798_2101698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153725512.1|2101708_2102896_-	response regulator	NA	NA	NA	NA	NA
WP_153725513.1|2102892_2103315_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_153725514.1|2103308_2104100_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_153725515.1|2104105_2106007_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_153725516.1|2106269_2106632_-	DUF2512 family protein	NA	NA	NA	NA	NA
WP_153725517.1|2106742_2107342_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	C7F482	Cyanophage	29.5	5.9e-06
WP_153725518.1|2107495_2108665_+	TraB family protein	NA	NA	NA	NA	NA
WP_153725519.1|2108712_2109177_-	chemotaxis protein CheX	NA	NA	NA	NA	NA
WP_170285785.1|2109173_2109593_-	hemerythrin family protein	NA	NA	NA	NA	NA
WP_153725521.1|2110007_2112116_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_162007993.1|2112291_2113278_+	MBL fold metallo-hydrolase	NA	Q332B9	Clostridium_botulinum_C_phage	33.8	7.6e-43
WP_153725523.1|2113290_2113515_+	DUF3006 family protein	NA	Q0H256	Geobacillus_phage	43.5	1.2e-07
WP_153725524.1|2113646_2114738_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_153726614.1|2114869_2115601_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_153725525.1|2115854_2116388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153725526.1|2116643_2116841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162007994.1|2117180_2117360_+	Spo0E family sporulation regulatory protein-aspartic acid phosphatase	NA	NA	NA	NA	NA
WP_153725528.1|2117448_2117841_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	45.0	7.0e-24
WP_153725529.1|2117837_2118596_+	DUF4351 domain-containing protein	NA	NA	NA	NA	NA
2119077:2119096	attL	TCGTTTGAGTTAAGGCTGTA	NA	NA	NA	NA
WP_153726615.1|2119191_2119527_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_151621232.1|2119519_2119717_-	DUF2281 domain-containing protein	NA	NA	NA	NA	NA
WP_153725530.1|2119993_2120278_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U3U8Y8	Bacillus_phage	36.6	1.4e-05
WP_151621236.1|2120606_2121179_-	hypothetical protein	NA	NA	NA	NA	NA
2120460:2120479	attR	TCGTTTGAGTTAAGGCTGTA	NA	NA	NA	NA
WP_153725531.1|2121732_2122002_+	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_153725532.1|2122165_2122312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151621240.1|2122434_2123166_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_151621242.1|2123493_2123703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162007995.1|2124010_2124475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153725534.1|2124688_2124916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153725535.1|2125276_2126872_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	35.0	4.2e-75
WP_153725536.1|2126943_2127300_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	50.5	2.1e-19
WP_153725537.1|2127296_2127860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153725538.1|2128024_2129710_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_153725539.1|2130079_2130466_-	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_153725540.1|2130677_2131688_+	arsenic resistance protein	NA	NA	NA	NA	NA
WP_153725541.1|2132012_2132210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153726616.1|2132531_2133764_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_153725542.1|2133937_2134099_-	hypothetical protein	NA	A0A0N9SKD8	Staphylococcus_phage	58.1	3.5e-06
WP_153725543.1|2134098_2134341_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_153725544.1|2134649_2135249_+	helix-turn-helix domain-containing protein	NA	A0A0A8WE28	Clostridium_phage	50.0	5.7e-09
WP_153725545.1|2135393_2135792_+|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	56.1	1.7e-41
WP_153725546.1|2135791_2136895_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0A8WI33	Clostridium_phage	27.0	3.4e-15
>prophage 6
NZ_CP045875	Heliorestis convoluta strain HH chromosome, complete genome	3218981	2638420	2663997	3218981	transposase,integrase	Brevibacillus_phage(66.67%)	23	2643547:2643566	2664560:2664579
WP_153725943.1|2638420_2638648_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_162008043.1|2639072_2639834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153725945.1|2639842_2640718_-	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_153725946.1|2640813_2641134_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_153725947.1|2641589_2641817_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_153725948.1|2641796_2642690_-|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	33.9	1.3e-41
2643547:2643566	attL	CTTGTCGACTTGTCGATTTG	NA	NA	NA	NA
WP_153725949.1|2643932_2645012_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_153725950.1|2645411_2645672_-	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_153725951.1|2645859_2646792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153725952.1|2647098_2648139_-	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	26.1	8.6e-29
WP_153726657.1|2648135_2649341_-	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_153725953.1|2649759_2650014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153725954.1|2650247_2651105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153725955.1|2651326_2652316_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_153725956.1|2653585_2654290_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_162008044.1|2654692_2654857_-	flagellar protein FliS	NA	NA	NA	NA	NA
WP_153725957.1|2655050_2656283_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_153725958.1|2657298_2657667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153725959.1|2657725_2658049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153726659.1|2658055_2659741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162008045.1|2660324_2661548_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_153725961.1|2662077_2663022_+	DUF4351 domain-containing protein	NA	NA	NA	NA	NA
WP_153725962.1|2663103_2663997_-|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	34.3	3.8e-41
2664560:2664579	attR	CAAATCGACAAGTCGACAAG	NA	NA	NA	NA
>prophage 8
NZ_CP045875	Heliorestis convoluta strain HH chromosome, complete genome	3218981	3124271	3170392	3218981	transposase,protease,holin,integrase	Bacillus_virus(20.0%)	40	3122862:3122883	3135215:3135236
3122862:3122883	attL	GGGTCAGGCGTTATGAATTCCT	NA	NA	NA	NA
WP_153726360.1|3124271_3125594_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	37.4	9.0e-31
WP_153726361.1|3125596_3126427_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_153726685.1|3126478_3127351_+	glycine/betaine ABC transporter	NA	NA	NA	NA	NA
WP_153726362.1|3127497_3128661_+	excisionase	NA	NA	NA	NA	NA
WP_153726363.1|3128705_3129059_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_153726364.1|3129100_3129241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153726365.1|3129333_3129891_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	28.5	7.6e-08
WP_153726366.1|3130282_3131449_-	hypothetical protein	NA	A0A2R2ZGJ6	Clostridioides_phage	39.6	5.8e-74
WP_153726367.1|3131713_3132799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153726368.1|3133062_3134346_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_153726369.1|3134786_3135068_+	2-hydroxyacyl-CoA dehydratase	NA	NA	NA	NA	NA
WP_153726370.1|3135549_3135837_+	2-hydroxyacyl-CoA dehydratase	NA	NA	NA	NA	NA
3135215:3135236	attR	AGGAATTCATAACGCCTGACCC	NA	NA	NA	NA
WP_153726371.1|3136369_3137122_+	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_153726372.1|3137140_3137983_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_153726373.1|3137986_3138559_+	Fe-S-containing hydro-lyase	NA	NA	NA	NA	NA
WP_153726374.1|3138608_3139328_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_153726375.1|3139371_3140010_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_153726376.1|3140522_3141821_+	trigger factor	NA	NA	NA	NA	NA
WP_153726377.1|3141892_3142489_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	53.2	1.2e-51
WP_153726378.1|3142508_3143771_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.7	1.8e-145
WP_153726379.1|3143887_3145621_+|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	31.8	5.7e-17
WP_153726380.1|3145702_3148138_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	41.8	3.1e-170
WP_153726381.1|3148227_3148863_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_153726382.1|3148984_3150841_+	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	28.3	5.6e-31
WP_153726383.1|3150903_3152034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153726384.1|3152193_3152904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153726385.1|3153105_3153540_+	rod-binding protein	NA	NA	NA	NA	NA
WP_162008088.1|3153740_3156239_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_153726387.1|3156300_3156480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153726388.1|3156792_3156990_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_153726686.1|3157302_3159474_-	anaerobic carbon-monoxide dehydrogenase catalytic subunit	NA	NA	NA	NA	NA
WP_153726389.1|3159600_3160365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153726390.1|3161061_3161754_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A1U9WRB5	Streptococcus_virus	35.9	8.5e-33
WP_153726391.1|3161755_3162490_+	TIGR03915 family putative DNA repair protein	NA	NA	NA	NA	NA
WP_153726392.1|3162966_3164280_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_153726393.1|3164666_3165836_+	permease	NA	NA	NA	NA	NA
WP_153726394.1|3165872_3166103_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_153726395.1|3166667_3167012_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_153726396.1|3167095_3169750_+	CBS domain-containing protein	NA	E1A2I5	Aeromonas_phage	34.0	8.1e-15
WP_153726397.1|3169759_3170392_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
