The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045797	Mycoplasma bovis strain XBY01 chromosome, complete genome	986067	75170	86531	986067	tRNA	Bodo_saltans_virus(28.57%)	8	NA	NA
WP_013954527.1|75170_76151_+	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	27.1	3.9e-15
WP_013954528.1|76154_76976_+	alpha/beta hydrolase	NA	G9E3U1	Emiliania_huxleyi_virus	32.5	2.3e-08
WP_013954529.1|77059_77824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954530.1|77816_78797_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	40.6	8.1e-53
WP_013954531.1|78921_83298_+	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	31.8	6.2e-12
WP_013954532.1|83703_84927_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	35.1	1.5e-61
WP_013456569.1|84916_85882_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	40.9	3.6e-29
WP_013954533.1|85871_86531_+	uracil-DNA glycosylase	NA	A0A068EP41	Falconid_herpesvirus	36.4	1.6e-28
>prophage 2
NZ_CP045797	Mycoplasma bovis strain XBY01 chromosome, complete genome	986067	145383	154990	986067	transposase	Mycoplasma_phage(57.14%)	7	NA	NA
WP_013455927.1|145383_146400_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.6	8.4e-37
WP_014829869.1|146727_148569_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	19.1	2.7e-17
WP_013954581.1|148830_150243_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	68.7	1.6e-81
WP_013954582.1|150226_151063_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	62.0	1.5e-87
WP_013954583.1|151055_151949_+	spermidine/putrescine ABC transporter permease	NA	Q6GZ01	Mycoplasma_phage	62.1	2.1e-92
WP_013954584.1|151935_153837_+	membrane protein	NA	Q6GZ00	Mycoplasma_phage	34.7	1.8e-80
WP_013455927.1|153973_154990_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.6	8.4e-37
>prophage 3
NZ_CP045797	Mycoplasma bovis strain XBY01 chromosome, complete genome	986067	220323	296833	986067	integrase,tRNA,transposase	Bacillus_virus(12.5%)	60	273648:273696	282479:282527
WP_013954625.1|220323_222165_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_141774561.1|222151_222604_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_049773792.1|222714_224430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954628.1|224573_225593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954629.1|225593_226142_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_013455969.1|226209_226770_+	peptide deformylase	NA	NA	NA	NA	NA
WP_013954630.1|226782_228180_+	CvpA family protein	NA	NA	NA	NA	NA
WP_013954631.1|228293_230210_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.9	5.7e-119
WP_013954632.1|230223_232809_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	29.6	9.8e-90
WP_013954633.1|232950_233880_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_013954634.1|233881_234598_+	ribonuclease HIII	NA	NA	NA	NA	NA
WP_013954635.1|234785_235760_+	DNA cytosine methyltransferase	NA	R4TMW4	Halovirus	38.4	1.6e-48
WP_013954636.1|235752_236460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456076.1|236929_237259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954638.1|237501_238197_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_014829885.1|238180_239167_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	35.7	2.2e-42
WP_013954642.1|239384_240107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038582854.1|240710_241478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954646.1|242162_243107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954647.1|243205_245152_+	transketolase	NA	NA	NA	NA	NA
WP_013954648.1|245214_245769_-	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	2.1e-21
WP_013456603.1|245847_246117_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_013954649.1|246230_246818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954650.1|246911_249080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954651.1|249091_250474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954652.1|250473_250809_+	HIT family protein	NA	B5LJ12	Mycobacterium_phage	33.8	3.6e-05
WP_013954653.1|250927_251626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004024364.1|251679_251832_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_013456491.1|252297_252783_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_013456378.1|252820_253057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954655.1|253046_254111_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_013954656.1|254179_254464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014829889.1|254485_256036_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	35.7	1.9e-80
WP_013954658.1|256038_256845_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_013456627.1|256844_259034_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	1.0e-71
WP_013456572.1|259036_259279_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_013456283.1|259621_260209_+	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	38.6	1.2e-08
WP_153700562.1|260214_260967_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_013456514.1|260984_261983_+	serine/threonine protein kinase	NA	Q85453	Moloney_murine_sarcoma_virus	32.2	4.3e-17
WP_013456585.1|261994_262840_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_013455939.1|262826_263489_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_013954660.1|264423_265812_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954661.1|265980_268206_-	AAA family ATPase	NA	A0A218KCE8	Bacillus_phage	27.7	3.4e-30
WP_013456112.1|268351_269785_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954662.1|270257_271301_+	AAA family ATPase	NA	A0A2H4UTU5	Bodo_saltans_virus	29.0	9.9e-09
WP_013954663.1|271302_273573_+	S8 family peptidase	NA	NA	NA	NA	NA
273648:273696	attL	ATAATTATGTTTTCTTGTTTTATGCTTAAACTGGGAAACGTAGGAAAAT	NA	NA	NA	NA
WP_013954664.1|273802_276943_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	24.8	2.3e-24
WP_013954665.1|276944_278585_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_013954666.1|278571_279123_+	C-terminal truncated type I restriction modification DNA specificity domain-containing protein	NA	NA	NA	NA	NA
WP_013954667.1|279119_279812_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013954668.1|279990_281166_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013954669.1|281239_282208_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	29.2	3.8e-31
WP_013456559.1|282572_284246_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
282479:282527	attR	ATTTTCCTACGTTTCCCAGTTTAAGCATAAAACAAGAAAACATAATTAT	NA	NA	NA	NA
WP_013954670.1|284695_285157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954672.1|285471_286629_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_013954673.1|287574_289194_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	39.8	5.9e-109
WP_013954674.1|289433_292100_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	27.3	4.2e-80
WP_013954675.1|292112_292823_+	signal peptidase II	NA	NA	NA	NA	NA
WP_153700563.1|293083_294757_-|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_013954660.1|295444_296833_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP045797	Mycoplasma bovis strain XBY01 chromosome, complete genome	986067	324612	414495	986067	tRNA,transposase	Tupanvirus(15.79%)	58	NA	NA
WP_013954691.1|324612_325857_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	5.3e-09
WP_013456216.1|326298_327648_+	SidA/IucD/PvdA family monooxygenase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.0	1.0e-13
WP_013954692.1|327640_329251_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_013954693.1|329316_330756_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_013954694.1|330867_332955_-	peptidase S41	NA	NA	NA	NA	NA
WP_013954695.1|332918_334310_-	leucine-rich repeat protein	NA	NA	NA	NA	NA
WP_013954696.1|334312_336622_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_013954697.1|336940_338302_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013954698.1|338821_339655_+	DNA adenine methylase	NA	A0A1S5PRR3	Streptococcus_phage	45.7	3.6e-54
WP_013954699.1|339961_340915_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_013954700.1|340964_341861_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_038582690.1|341894_343769_-	peptidase S41	NA	NA	NA	NA	NA
WP_013954702.1|343792_344296_-	hypothetical protein	NA	S6AVW3	Thermus_phage	32.8	5.6e-10
WP_013954703.1|344598_346272_-|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_013954704.1|346585_347950_-	NADH oxidase	NA	NA	NA	NA	NA
WP_014829907.1|348332_350006_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_013954705.1|350135_350921_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_013954706.1|350925_352455_-	RNA polymerase sigma factor	NA	G8CLC7	Synechococcus_phage	33.7	2.0e-29
WP_013954707.1|352447_354388_-	DNA primase	NA	A0A1S5RFD7	Helicobacter_phage	35.3	5.7e-42
WP_013954708.1|354429_355806_-|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	32.0	3.9e-53
WP_013954709.1|355917_357705_-	membrane protein	NA	NA	NA	NA	NA
WP_013954710.1|358155_359511_+	alkylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013456298.1|359513_360446_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.0	1.3e-07
WP_013456124.1|360409_362161_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013456114.1|362267_362513_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_013954711.1|362593_365113_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_038582866.1|365349_366396_+	zinc-dependent alcohol dehydrogenase family protein	NA	A0A0K0KVL7	Prochlorococcus_phage	26.9	1.0e-13
WP_013954712.1|366544_368383_-	type I DNA topoisomerase	NA	A0A2P1ELA0	Moumouvirus	32.1	4.8e-75
WP_013456432.1|368762_369200_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_013456362.1|369241_369640_+	single-stranded DNA-binding protein	NA	A0A0H3U4B5	Staphylococcus_phage	30.3	9.3e-08
WP_013456088.1|369659_369986_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_013954713.1|370120_371449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078086163.1|371687_372716_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013456295.1|373059_373515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954715.1|373565_375236_-	APC family permease	NA	NA	NA	NA	NA
WP_013954716.1|375474_376791_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	25.1	2.7e-11
WP_013456122.1|376859_378563_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	23.1	2.0e-14
WP_013954717.1|378646_379891_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_013456084.1|379989_380781_-	aquaporin family protein	NA	M1HQW3	Paramecium_bursaria_Chlorella_virus	27.5	7.3e-12
WP_013954718.1|380789_382298_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_013456345.1|382587_383979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954719.1|384111_385113_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_013456401.1|385114_386083_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_013456470.1|386196_386940_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_013456409.1|387123_387408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456558.1|387400_389047_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_013456463.1|389053_390058_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_013456004.1|390050_390725_+	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	31.9	1.2e-18
WP_013954720.1|390798_393777_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_013954721.1|393829_395182_-	YitT family protein	NA	NA	NA	NA	NA
WP_013954722.1|395276_396113_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_013954723.1|396099_396831_-	DNA processing protein DprA	NA	NA	NA	NA	NA
WP_038582875.1|397057_398098_+	zinc-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	29.7	5.2e-34
WP_038582700.1|398425_399454_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013954726.1|399718_402520_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_013954727.1|402748_409780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954734.1|412345_413128_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_078086171.1|413466_414495_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.0	5.0e-21
>prophage 5
NZ_CP045797	Mycoplasma bovis strain XBY01 chromosome, complete genome	986067	923415	967744	986067	integrase,tRNA,transposase	Staphylococcus_phage(25.0%)	41	955025:955042	965060:965077
WP_078086180.1|923415_924444_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013955061.1|924654_925662_+	membrane protein	NA	NA	NA	NA	NA
WP_014829994.1|926207_927041_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_153700573.1|927083_927881_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013456123.1|928166_928916_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_013955063.1|929314_931159_+	ribonuclease J	NA	NA	NA	NA	NA
WP_013955064.1|931293_932445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014829996.1|932634_935052_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_013955066.1|935069_935378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013955067.1|935675_937097_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_013955068.1|937089_938403_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_013955069.1|938402_938708_-|tRNA	glutamyl-tRNA(Gln) amidotransferase	tRNA	NA	NA	NA	NA
WP_013955070.1|938713_939568_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_013456616.1|939579_940158_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	29.7	1.2e-11
WP_013955071.1|940147_940909_-	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_013456430.1|940901_941642_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_013456524.1|941651_941966_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_013456382.1|942139_943450_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_013456261.1|943452_944118_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_014829997.1|944188_944650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013955073.1|944937_946071_-	DnaJ domain-containing protein	NA	A0A1V0SBY2	Catovirus	32.2	3.0e-27
WP_013955074.1|946308_946650_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_013955075.1|946823_948059_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	33.2	3.3e-59
WP_013955076.1|948069_948672_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_013456246.1|948733_949636_+	DegV family protein	NA	NA	NA	NA	NA
WP_014829999.1|949796_950030_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_013955078.1|950069_950792_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_013456073.1|950791_951868_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_013955080.1|951993_952566_-	cell division protein Fic	NA	NA	NA	NA	NA
WP_013955081.1|952587_954009_-	YitT family protein	NA	NA	NA	NA	NA
955025:955042	attL	TGATAATAGAAGTGAAAA	NA	NA	NA	NA
WP_013954660.1|955463_956852_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013955084.1|957167_959135_+	type IIA DNA topoisomerase subunit B	NA	G3M9Z3	Bacillus_virus	41.5	8.7e-131
WP_013955085.1|959257_959572_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	39.0	1.7e-12
WP_013955086.1|959624_960071_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	37.4	1.8e-12
WP_013955087.1|960191_961259_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_153700563.1|961341_963015_+|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_013955090.1|963319_964309_-	DUF285 domain-containing protein	NA	NA	NA	NA	NA
WP_038582834.1|964424_964634_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013456532.1|964770_965730_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
965060:965077	attR	TTTTCACTTCTATTATCA	NA	NA	NA	NA
WP_013955092.1|965925_966321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013955093.1|966499_967744_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.3	1.1e-09
