The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045863	Escherichia coli O157:H7 strain ATCC 43890 chromosome, complete genome	5338790	27663	49353	5338790	transposase,plate	uncultured_Caudovirales_phage(66.67%)	18	NA	NA
WP_000246434.1|27663_28995_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|28997_29522_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|29518_30799_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|30823_31906_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|31869_33720_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|33723_34137_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|34227_35619_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|35669_35894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|35928_36429_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|37125_37644_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103125.1|37853_39995_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_000059353.1|42139_43276_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	5.3e-24
WP_001356493.1|43344_43890_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000420837.1|44635_45772_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001145876.1|45774_47535_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000247943.1|47736_48000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|47914_48100_-	protein YncO	NA	NA	NA	NA	NA
WP_000027427.1|48180_49353_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP045863	Escherichia coli O157:H7 strain ATCC 43890 chromosome, complete genome	5338790	68139	83412	5338790	transposase,tail	Escherichia_phage(37.5%)	17	NA	NA
WP_000749881.1|68139_69195_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|69482_70586_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|70597_71851_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001303805.1|72920_73166_-	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000708838.1|73405_73795_-	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.3	1.7e-06
WP_001274756.1|73922_74636_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000437875.1|74736_74937_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|75055_75349_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000788819.1|76300_76612_+	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_001096948.1|76611_77322_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	86.6	1.3e-65
WP_000344820.1|77342_77786_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000805544.1|77757_78351_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_001115574.1|78350_78845_-	hypothetical protein	NA	K7PH60	Enterobacterial_phage	93.5	3.9e-80
WP_000904979.1|78874_79429_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_000355475.1|79486_80260_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000246059.1|81083_81827_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168200277.1|82198_83412_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.3	7.1e-168
>prophage 3
NZ_CP045863	Escherichia coli O157:H7 strain ATCC 43890 chromosome, complete genome	5338790	664267	702364	5338790	portal,terminase,lysis,holin,integrase,tail,protease	Enterobacteria_phage(51.16%)	50	653709:653723	685999:686013
653709:653723	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_024219169.1|664267_665149_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
WP_001303849.1|665311_665530_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|665569_665737_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|665979_666582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|666792_667014_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_023436627.1|667112_667394_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000548536.1|667404_667596_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|667568_667751_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|667747_668428_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|669125_669308_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|669304_669475_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|669467_670088_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028854.1|670084_670750_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750155.1|670961_671921_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|672258_672381_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|672395_673085_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|673268_674012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|674097_674256_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|674336_674735_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|674877_675093_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|675092_675590_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|675586_676054_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|676041_676194_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000349509.1|676868_677360_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934137.1|677359_679462_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|679458_679671_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|679598_680723_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|680844_681180_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136597.1|681124_683152_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_001097050.1|683238_683562_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|683554_683830_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|683841_684420_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|684416_684818_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|684828_685572_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|685632_686019_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
685999:686013	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|686027_686357_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|686328_689394_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|689393_689723_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|689732_690431_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|690436_691180_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|691116_691725_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000515426.1|691785_695199_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_001233141.1|695269_695869_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741879.1|695928_697245_+|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001024022.1|697246_697516_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|697692_698673_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|698706_699726_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|700222_700384_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|700553_701435_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_001247925.1|701665_702364_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 4
NZ_CP045863	Escherichia coli O157:H7 strain ATCC 43890 chromosome, complete genome	5338790	919088	988684	5338790	portal,head,terminase,transposase,holin,integrase,tail,protease	Escherichia_phage(26.19%)	75	927576:927591	948937:948952
WP_000156526.1|919088_920849_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|921034_921487_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|921562_922603_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|922959_923469_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|923687_924317_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|924279_926442_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|926451_926898_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|927020_929075_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
927576:927591	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_000424181.1|929106_929565_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|929660_930323_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|930495_930909_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|930953_931271_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|931328_932519_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|932613_932892_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|932888_933218_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|933308_933968_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_001299351.1|934375_935395_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|935372_935615_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001098307.1|938242_938434_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|938430_938619_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|939192_939378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|939564_939954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|940095_940251_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|940528_940816_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|940815_941007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|941034_941436_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|941544_941817_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|941800_942226_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|942432_942888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|942966_944058_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788751.1|944064_944811_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_000450992.1|944832_945603_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|945618_946032_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|946383_947157_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|947522_947660_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000813263.1|947761_947917_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_001341388.1|948084_948363_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|948364_949414_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
948937:948952	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|949426_949798_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|949787_950159_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|950310_951129_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001303877.1|951415_951655_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000261909.1|951749_952463_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303878.1|956429_956744_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|957271_957457_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|957678_957792_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|958012_958546_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|958705_958978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|959233_959440_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|960190_960466_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|960541_960922_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|960918_961266_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|961315_962854_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001302857.1|963117_965046_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|965029_965236_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|965232_966825_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|966814_968320_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|968356_968704_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|968761_969028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|969009_969750_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|969763_970195_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|970221_970635_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082450.1|970615_973195_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.7	0.0e+00
WP_000847304.1|973191_973521_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001151078.1|973520_974219_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000194760.1|974229_974973_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_050546863.1|974918_975551_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649830.1|975741_976269_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
WP_153782193.1|976402_979876_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	96.5	0.0e+00
WP_001230444.1|979943_980543_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_001023352.1|981922_982192_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001301613.1|984465_985584_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|985580_987374_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|987392_988100_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|988096_988684_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP045863	Escherichia coli O157:H7 strain ATCC 43890 chromosome, complete genome	5338790	1256831	1318894	5338790	portal,head,terminase,tRNA,lysis,capsid,holin,integrase,tail,protease	Enterobacteria_phage(44.44%)	79	1255191:1255205	1285698:1285712
1255191:1255205	attL	CGCCCAGCAGGCGAT	NA	NA	NA	NA
WP_000085257.1|1256831_1258061_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
WP_000953272.1|1258425_1258614_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_001304194.1|1258671_1259415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|1259440_1259638_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920682.1|1259630_1259816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|1259815_1260007_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000794515.1|1259996_1260239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770148.1|1260244_1260544_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761781.1|1260540_1262673_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	5.8e-173
WP_000198852.1|1263043_1263295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126692.1|1263291_1263702_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233299.1|1263712_1263985_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132080.1|1264109_1264334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137345.1|1264626_1265784_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_000504050.1|1265823_1266396_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
WP_000267612.1|1266397_1267609_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	1.2e-188
WP_001020660.1|1267605_1267944_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000134113.1|1267940_1268237_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145903.1|1268236_1268677_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
WP_000174068.1|1268660_1268843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|1268966_1269323_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000127893.1|1269306_1270968_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	1.5e-277
WP_000133425.1|1270981_1271263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|1272119_1273580_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|1273579_1274251_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1274419_1275790_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|1275793_1276435_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|1276470_1277577_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1277630_1278092_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|1278101_1278755_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|1278926_1280177_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|1280290_1281433_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|1281422_1281659_-	excisionase	NA	NA	NA	NA	NA
WP_000788869.1|1282583_1283285_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|1283281_1283584_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|1283651_1283984_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|1284048_1284171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|1284228_1285755_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
1285698:1285712	attR	CGCCCAGCAGGCGAT	NA	NA	NA	NA
WP_001053040.1|1286256_1286712_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|1286711_1286882_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1286874_1287165_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|1287161_1287524_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|1287520_1287661_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|1287657_1288347_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|1288668_1288974_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|1288960_1289437_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|1289653_1289836_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|1289926_1290220_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|1290511_1290922_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|1291207_1291414_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|1291578_1291773_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|1292161_1292707_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|1292681_1294607_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|1294603_1294810_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1294806_1296408_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|1296388_1297708_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1297717_1298050_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_052930406.1|1298105_1299131_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	2.5e-190
WP_000158906.1|1299172_1299571_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|1299582_1299936_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|1299947_1300526_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|1300522_1300918_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|1300925_1301666_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|1301681_1302104_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|1302085_1302520_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|1302512_1305062_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|1305058_1305388_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|1305387_1306086_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_153782196.1|1306091_1306835_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	91.5	3.7e-135
WP_000090920.1|1306771_1307404_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|1307464_1310863_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000268883.1|1311593_1314509_+	membrane protein	NA	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_000885629.1|1314508_1315090_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	2.3e-100
WP_000488340.1|1315209_1316100_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|1316118_1316625_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|1316661_1317162_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|1317240_1317423_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|1317920_1318589_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|1318645_1318894_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
>prophage 6
NZ_CP045863	Escherichia coli O157:H7 strain ATCC 43890 chromosome, complete genome	5338790	1419332	1496105	5338790	portal,head,terminase,capsid,transposase,holin,integrase,tail,protease	Stx2-converting_phage(36.36%)	84	1419169:1419196	1480577:1480604
1419169:1419196	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|1419332_1420463_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1420440_1420689_-	excisionase	NA	NA	NA	NA	NA
WP_000048551.1|1420753_1423225_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090200.1|1423317_1423509_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1423505_1423694_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_122994727.1|1424030_1424174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|1424167_1424401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1424378_1424786_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|1424808_1425027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1425099_1425399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1425662_1426070_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|1426146_1426374_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|1426357_1426909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|1426880_1427921_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|1427832_1428375_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000774808.1|1428561_1429143_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|1429139_1429304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1430002_1430761_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|1431039_1431252_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|1431472_1431730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1431799_1432078_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|1432079_1433126_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|1433138_1433498_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|1433506_1434037_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|1434278_1434476_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|1434626_1435685_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_072617007.1|1436481_1438335_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_000284517.1|1438484_1438700_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|1438704_1439049_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|1439099_1439633_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|1439903_1440473_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1440472_1440619_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1440846_1441032_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1441456_1441684_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|1441725_1442091_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|1442380_1442944_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001507810.1|1442940_1444602_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.5	0.0e+00
WP_000173030.1|1444665_1446603_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063094.1|1446647_1446869_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_001304108.1|1446814_1449394_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
WP_000125988.1|1449396_1449723_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_000573391.1|1450083_1450530_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1450526_1450871_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|1450936_1451653_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|1451667_1452042_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|1452137_1452347_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212822.1|1452394_1455637_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.4	0.0e+00
WP_000807954.1|1455629_1455971_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179481.1|1455970_1456669_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000194720.1|1456679_1457423_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|1457368_1458001_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_153782197.1|1458342_1459518_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.7	5.9e-228
WP_162829202.1|1461375_1462589_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001228304.1|1463195_1463795_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000216532.1|1463946_1465260_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001023474.1|1465261_1465531_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|1466557_1467883_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_106409364.1|1469480_1469603_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|1469709_1470621_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|1470686_1471256_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_153782198.1|1472221_1473760_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.2	2.5e-295
WP_000612591.1|1473809_1474157_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1474153_1474534_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|1474873_1475152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1475579_1475726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|1475862_1476510_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|1476693_1477284_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_000147167.1|1480034_1480253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079499.1|1480754_1481261_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1480577:1480604	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|1481306_1481807_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1481892_1482072_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|1482452_1483259_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|1483258_1484452_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001302292.1|1484463_1485822_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
WP_000763520.1|1485825_1487421_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|1487420_1488983_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1489074_1489119_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|1489256_1490138_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1490134_1490755_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|1490782_1492366_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|1492578_1493451_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|1493490_1494081_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|1494077_1494836_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|1495055_1496105_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
NZ_CP045863	Escherichia coli O157:H7 strain ATCC 43890 chromosome, complete genome	5338790	1574226	1638684	5338790	head,terminase,capsid,transposase,holin,integrase,tail,tRNA	Escherichia_phage(41.54%)	75	1572256:1572271	1624651:1624666
1572256:1572271	attL	CACCGCTCATCAGACG	NA	NA	NA	NA
WP_162829202.1|1574226_1575440_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001156434.1|1576299_1577745_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444937.1|1577744_1579055_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885454.1|1579230_1580139_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046821.1|1580468_1581032_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628061.1|1581052_1582285_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1582539_1583523_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001625136.1|1583797_1583968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123746.1|1584000_1585374_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|1585502_1586438_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040839.1|1586489_1587725_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|1587726_1587942_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|1588041_1588230_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|1588267_1588417_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|1588472_1589282_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105140.1|1589274_1591875_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_001344816.1|1591976_1592252_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|1592326_1592497_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|1592496_1592718_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|1593159_1593648_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1593644_1593800_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|1593810_1593990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|1594232_1594652_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|1594731_1594986_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|1594982_1595405_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001304174.1|1595482_1596271_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000788980.1|1596277_1597024_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_000450712.1|1597046_1597808_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_001141110.1|1597823_1598246_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000935420.1|1598351_1598564_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000224233.1|1598815_1599079_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000208018.1|1599089_1599251_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000365100.1|1599329_1599575_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_001100703.1|1600006_1601158_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000016656.1|1601125_1602115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138556.1|1602114_1603506_-	ATPase	NA	NA	NA	NA	NA
WP_000940319.1|1604005_1604605_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247761.1|1604604_1604895_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000640158.1|1604891_1605446_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000466957.1|1606007_1606439_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_021497776.1|1606916_1608770_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000284522.1|1608919_1609135_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|1609139_1609484_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992086.1|1609534_1610068_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_000661712.1|1610341_1611037_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_001280923.1|1611131_1611263_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_012817877.1|1611485_1611671_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_000828070.1|1612071_1612398_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|1612529_1612730_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829192.1|1612771_1613137_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958380.1|1613425_1613989_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001411753.1|1613985_1615647_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000173030.1|1615710_1617648_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063094.1|1617692_1617914_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000125988.1|1620440_1620767_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007911.1|1620776_1621127_+|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000573391.1|1621123_1621570_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|1621566_1621911_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275479.1|1621979_1622696_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_001030060.1|1622701_1623076_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001453698.1|1623171_1623381_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212768.1|1623432_1626513_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	0.0e+00
1624651:1624666	attR	CGTCTGATGAGCGGTG	NA	NA	NA	NA
WP_000807964.1|1626505_1626847_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152159.1|1626846_1627545_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000194763.1|1627555_1628299_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_064732755.1|1628244_1628877_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000649829.1|1629067_1629595_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515042.1|1629728_1633226_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_001230550.1|1633296_1633896_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000268955.1|1633960_1635274_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001023992.1|1635275_1635545_+|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_001131659.1|1635657_1636233_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001443810.1|1636305_1636935_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|1637016_1637658_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|1638249_1638684_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
>prophage 8
NZ_CP045863	Escherichia coli O157:H7 strain ATCC 43890 chromosome, complete genome	5338790	1813189	1903279	5338790	portal,head,terminase,capsid,transposase,holin,tail	Enterobacteria_phage(30.77%)	113	NA	NA
WP_000214712.1|1813189_1813393_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|1813428_1814889_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|1814977_1816261_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_016241229.1|1816320_1816635_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143808.1|1816796_1817438_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.2	8.6e-104
WP_001356599.1|1817519_1818149_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|1818221_1818797_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023362.1|1818910_1819180_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268860.1|1819181_1820405_-|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_153782199.1|1820469_1821069_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	96.5	2.7e-104
WP_115801853.1|1821136_1823488_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_001413764.1|1823439_1824615_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	98.2	1.5e-231
WP_072147834.1|1824855_1825485_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000194798.1|1825430_1826174_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001151105.1|1826184_1826883_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|1826882_1827212_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081803.1|1827208_1829821_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.7	0.0e+00
WP_000533440.1|1829801_1830215_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|1830241_1830664_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|1830677_1831430_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|1831437_1831833_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|1831829_1832363_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|1832377_1832731_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|1832742_1833141_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|1833182_1834208_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|1834263_1834596_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|1834605_1835925_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|1835905_1837507_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|1837503_1837710_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027223.1|1837706_1839632_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867493.1|1839606_1840152_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	4.7e-79
WP_001303940.1|1840538_1840763_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|1840844_1841159_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|1841684_1841870_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|1842092_1842239_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|1842238_1842808_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|1843079_1843613_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_153782213.1|1843663_1844008_-	DUF1327 domain-containing protein	NA	B6DZ91	Enterobacteria_phage	99.1	7.6e-59
WP_024180155.1|1844012_1844228_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_153782200.1|1844666_1846517_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_001302123.1|1846994_1847426_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|1847876_1848590_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|1848725_1848923_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|1849147_1849702_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|1849764_1850070_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|1850082_1851132_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|1851133_1851406_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|1851527_1851872_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|1851991_1852204_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|1852437_1852995_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|1852996_1853215_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|1853342_1853654_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|1853646_1853874_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|1853870_1854152_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|1854184_1854901_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|1854934_1855396_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|1855388_1856432_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|1856500_1856926_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|1856909_1857152_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|1857543_1857882_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|1858174_1858327_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|1858338_1858977_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|1858977_1859187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|1859751_1859940_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|1859936_1860125_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|1860217_1861462_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_016241229.1|1862100_1862415_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|1863377_1863758_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1863754_1864102_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1864151_1865690_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|1866272_1866923_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001023362.1|1868322_1868592_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268860.1|1868593_1869817_-|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_153782201.1|1869881_1870481_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_001304111.1|1870548_1870764_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_038425866.1|1870766_1874027_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.1	0.0e+00
WP_001152128.1|1874214_1874652_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_000807954.1|1874651_1874993_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_153782202.1|1874985_1878066_-|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	94.2	0.0e+00
WP_001453698.1|1878118_1878328_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|1878423_1878798_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_153782203.1|1878803_1879520_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	94.5	1.9e-123
WP_000573391.1|1879926_1880373_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|1880369_1880720_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|1880729_1881056_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001304108.1|1881058_1883638_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
WP_001063094.1|1883583_1883805_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000173030.1|1883849_1885787_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001507810.1|1885850_1887512_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.5	0.0e+00
WP_000958416.1|1887508_1888072_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|1888361_1888727_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|1888768_1888996_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_071998602.1|1889420_1889606_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	83.6	1.5e-21
WP_000539795.1|1889828_1889975_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|1889974_1890544_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|1890814_1891348_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|1891398_1891743_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_024180155.1|1891747_1891963_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_153782204.1|1892402_1894253_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000216649.1|1894566_1894734_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	70.6	5.4e-10
WP_001303509.1|1894730_1895159_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|1895799_1896489_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|1896485_1896845_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|1896857_1897907_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|1897908_1898187_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|1898354_1898567_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|1898755_1898860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|1898975_1899560_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|1899616_1900012_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788938.1|1900822_1901563_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095669.1|1901569_1902532_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000693943.1|1902554_1902980_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|1902976_1903279_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 9
NZ_CP045863	Escherichia coli O157:H7 strain ATCC 43890 chromosome, complete genome	5338790	2304425	2351323	5338790	portal,head,terminase,transposase,holin,integrase,tail	Escherichia_phage(39.13%)	58	2339148:2339162	2352731:2352745
WP_001023407.1|2304425_2304695_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268861.1|2304696_2306010_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	4.8e-77
WP_001230508.1|2306074_2306674_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_115801853.1|2306741_2309093_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_001413764.1|2309044_2310220_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	98.2	1.5e-231
WP_127446151.1|2310460_2311090_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	1.3e-101
WP_000194798.1|2311035_2311779_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001151105.1|2311789_2312488_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|2312487_2312817_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082450.1|2312813_2315393_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.7	0.0e+00
WP_000533402.1|2315373_2315787_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|2315813_2316245_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|2316258_2316999_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|2316980_2317247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|2317304_2317652_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|2317688_2319194_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|2319183_2320776_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|2320772_2320979_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|2320962_2322891_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000235436.1|2322862_2323372_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|2323766_2323991_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|2324072_2324387_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2324913_2325099_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|2325326_2325458_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|2325470_2325653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|2325808_2326342_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|2326392_2326737_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_024165672.1|2326741_2326957_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_168200278.1|2327267_2328480_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.0	1.1e-168
WP_153782206.1|2328562_2330413_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000216649.1|2330726_2330894_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	70.6	5.4e-10
WP_001303558.1|2330890_2331319_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_001059369.1|2331952_2332642_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|2332638_2332998_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|2333010_2334060_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|2334061_2334340_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001302544.1|2334280_2334466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2334507_2334720_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|2334906_2335011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|2335120_2335684_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|2335810_2336122_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|2336118_2336271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|2336303_2336660_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|2336656_2336881_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|2336902_2337601_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_072143023.1|2337635_2338178_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_001262409.1|2338089_2339127_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
2339148:2339162	attL	AACTTTACCCTCGAA	NA	NA	NA	NA
WP_000693816.1|2339195_2339621_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|2339617_2339845_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|2339942_2340587_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|2340861_2341014_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|2341494_2341683_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|2341679_2341868_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|2341963_2344435_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|2344493_2344697_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533600.1|2344696_2345719_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_001302302.1|2345954_2346752_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_168200279.1|2350109_2351323_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	7.1e-168
2352731:2352745	attR	AACTTTACCCTCGAA	NA	NA	NA	NA
>prophage 10
NZ_CP045863	Escherichia coli O157:H7 strain ATCC 43890 chromosome, complete genome	5338790	2472039	2509290	5338790	portal,head,terminase,lysis,tail,capsid,holin,integrase,plate,tRNA	Escherichia_phage(40.82%)	52	2476339:2476366	2507483:2507510
WP_000675144.1|2472039_2473443_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137884.1|2473439_2474162_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_001301848.1|2474352_2474685_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|2474832_2476194_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
2476339:2476366	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2476468_2476687_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882987.1|2476768_2477932_-	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	98.7	3.5e-204
WP_000978915.1|2477931_2478411_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	1.5e-84
WP_000069920.1|2478425_2480873_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	95.7	0.0e+00
WP_000785970.1|2480865_2480985_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|2481017_2481293_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|2481349_2481868_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286714.1|2481880_2483071_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	1.5e-223
WP_000905091.1|2483130_2483724_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	1.3e-103
WP_001145597.1|2483754_2484165_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	87.1	4.5e-58
WP_001008242.1|2484185_2484629_+|tail	tail fiber assembly protein	tail	M1SNQ2	Escherichia_phage	97.3	1.6e-80
WP_000368070.1|2484600_2485203_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	98.5	5.9e-107
WP_000216998.1|2485202_2486702_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	98.2	2.3e-272
WP_001285344.1|2486698_2487310_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	4.9e-117
WP_001121492.1|2487302_2488211_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.0	8.3e-161
WP_000127172.1|2488215_2488563_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_001093756.1|2488559_2489195_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	4.5e-113
WP_001001774.1|2489261_2489714_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	1.4e-76
WP_000917172.1|2489706_2490174_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	7.4e-81
WP_001300730.1|2490136_2490310_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000040660.1|2490281_2490707_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	1.8e-65
WP_000736588.1|2490694_2491120_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	94.3	2.1e-58
WP_001144113.1|2491134_2491632_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	2.6e-92
WP_000123125.1|2491631_2491913_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	98.9	6.3e-43
WP_000846399.1|2491916_2492120_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|2492119_2492629_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203439.1|2492728_2493472_-|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	98.4	8.6e-124
WP_001248573.1|2493475_2494549_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.7	6.7e-202
WP_001085969.1|2494603_2495458_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	95.8	5.8e-132
WP_000156861.1|2495631_2497404_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_000038195.1|2497403_2498438_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	96.2	4.5e-195
WP_001177885.1|2498650_2498920_+	hypothetical protein	NA	Q2P9X2	Enterobacteria_phage	89.9	3.8e-29
WP_000042038.1|2499143_2499581_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	92.3	1.6e-69
WP_000746343.1|2499705_2500656_-	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	40.0	3.8e-39
WP_001310277.1|2500633_2500942_-	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	40.2	1.7e-12
WP_001302990.1|2500978_2501134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268557.1|2501542_2503831_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.6	0.0e+00
WP_000027665.1|2503820_2504096_-	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	98.9	6.6e-45
WP_001113260.1|2504092_2504317_-	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	5.5e-34
WP_001277943.1|2504316_2504619_-	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	95.0	1.9e-45
WP_000557701.1|2504618_2504843_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_000217679.1|2504906_2505407_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_001005166.1|2505403_2505574_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.2	6.7e-24
WP_000043869.1|2505584_2505860_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001306384.1|2505974_2506274_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000985261.1|2506389_2507403_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_001303579.1|2507667_2507985_-	hypothetical protein	NA	NA	NA	NA	NA
2507483:2507510	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2508390_2509290_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 11
NZ_CP045863	Escherichia coli O157:H7 strain ATCC 43890 chromosome, complete genome	5338790	2534921	2608546	5338790	portal,terminase,tRNA,holin,integrase,tail,protease	Enterobacteria_phage(67.5%)	89	2559485:2559505	2606052:2606072
WP_001301615.1|2534921_2536955_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_000356841.1|2543912_2547542_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|2547603_2547921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|2549161_2550250_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|2550260_2551790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|2551808_2552540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|2552532_2553669_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|2553665_2555669_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|2555794_2556256_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2556297_2556768_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2556814_2557534_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|2557530_2559216_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
2559485:2559505	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001261937.1|2559730_2559979_+	DinI family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001023431.1|2560346_2560616_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	100.0	2.9e-45
WP_000268835.1|2560617_2561931_-|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
WP_001228289.1|2561995_2562595_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_153782214.1|2562662_2565008_-	DUF1983 domain-containing protein	NA	Q9EYE7	Enterobacteria_phage	99.5	0.0e+00
WP_001356361.1|2564959_2566135_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	100.0	3.8e-235
WP_072147834.1|2566375_2567005_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000194798.1|2566950_2567694_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001301816.1|2567704_2568403_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000847298.1|2568402_2568732_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_153782209.1|2568728_2571374_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.7	0.0e+00
WP_000532073.1|2571417_2571726_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|2571752_2572175_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|2572188_2572941_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2572948_2573347_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|2573359_2573983_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2573985_2574267_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2574259_2574586_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|2574673_2576698_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|2576642_2578145_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102414.1|2578144_2578357_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_001077625.1|2578353_2580477_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|2580473_2580950_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001302882.1|2580982_2581255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|2581466_2581652_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_153782210.1|2581879_2582026_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	97.9	9.8e-16
WP_001056806.1|2582025_2582595_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|2582865_2583399_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|2583403_2583619_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|2583696_2583942_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2583982_2584162_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874257.1|2584299_2586246_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	100.0	0.0e+00
WP_000752026.1|2586756_2587026_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|2587035_2587983_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204849.1|2588489_2588924_-	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000144764.1|2588916_2589111_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107983.1|2589107_2589713_-	recombination protein NinG	NA	Q9EYC6	Enterobacteria_phage	100.0	2.3e-98
WP_001543885.1|2589705_2589915_-	protein ninF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
WP_000924601.1|2589874_2590276_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001254255.1|2590278_2590455_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000153268.1|2590451_2590979_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001304104.1|2590975_2591422_-	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	100.0	2.4e-81
WP_001281772.1|2591378_2591615_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103678.1|2591625_2591841_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|2591973_2592252_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000145935.1|2592322_2592613_-	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_000788906.1|2592609_2593311_-	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000185456.1|2593307_2594246_-	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000035953.1|2594278_2594575_-	hypothetical protein	NA	Q9EYB4	Enterobacteria_phage	100.0	1.8e-48
WP_001033078.1|2594689_2594908_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	100.0	1.1e-34
WP_001299796.1|2595016_2595664_+	LexA family transcriptional regulator	NA	K7PH19	Enterobacteria_phage	100.0	1.2e-121
WP_001280993.1|2595786_2596068_+	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	100.0	1.1e-44
WP_000990548.1|2596074_2596626_+	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	100.0	4.1e-70
WP_000256574.1|2597138_2597411_+	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	100.0	2.0e-41
WP_001066169.1|2597427_2598009_-	superinfection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000065377.1|2598269_2598638_+	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001198861.1|2598710_2598875_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372942.1|2598843_2598987_+	host cell division inhibitory peptide Kil	NA	Q9EYA7	Enterobacteria_phage	100.0	1.2e-18
WP_000995395.1|2599062_2599359_+	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000100847.1|2599364_2600150_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|2600146_2600824_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|2600823_2601006_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|2600978_2601170_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|2601180_2601462_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|2601560_2601782_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|2601778_2602726_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001356547.1|2602727_2602904_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|2603237_2603594_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|2603590_2603953_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|2604040_2604283_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556583.1|2604286_2604421_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001193437.1|2604439_2604694_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|2604727_2606014_+|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|2606034_2606736_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
2606052:2606072	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|2606795_2606903_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2606883_2607615_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|2607619_2608546_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 12
NZ_CP045863	Escherichia coli O157:H7 strain ATCC 43890 chromosome, complete genome	5338790	2854166	2859592	5338790	integrase	Enterobacteria_phage(50.0%)	6	2844617:2844633	2856581:2856597
2844617:2844633	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000368131.1|2854166_2855099_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958700.1|2855410_2856568_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|2856742_2857879_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
2856581:2856597	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|2857888_2858569_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|2858555_2859023_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000950857.1|2859022_2859592_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
>prophage 13
NZ_CP045863	Escherichia coli O157:H7 strain ATCC 43890 chromosome, complete genome	5338790	3126957	3160641	5338790	transposase,holin,integrase,tail,tRNA	Enterobacteria_phage(37.5%)	40	3136286:3136300	3168982:3168996
WP_000264777.1|3126957_3127725_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3127755_3128304_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3128322_3128571_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3128707_3130069_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3130235_3131027_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077626964.1|3131048_3132335_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3132389_3132983_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059175.1|3133105_3133984_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880923.1|3134069_3135731_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3135879_3136221_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117844.1|3136282_3136573_-	RnfH family protein	NA	NA	NA	NA	NA
3136286:3136300	attL	TTTATTCGCTGATTT	NA	NA	NA	NA
WP_000600190.1|3136562_3137039_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3137170_3137653_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|3138498_3138747_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|3139248_3139839_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|3140021_3140672_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|3140750_3141809_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|3141938_3142361_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|3142521_3142791_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000165061.1|3143008_3143335_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
WP_153782211.1|3144028_3144673_-	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	99.3	5.3e-69
WP_000612591.1|3144722_3145070_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3145066_3145447_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731259.1|3145803_3146148_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|3146152_3146368_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_072617007.1|3146517_3148371_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_000499458.1|3148778_3148946_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3149031_3149775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3150027_3150651_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|3150647_3151313_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|3151309_3151921_-	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001108081.1|3151895_3152462_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001254939.1|3152797_3153553_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001417601.1|3153588_3153891_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000150580.1|3153966_3155187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|3155582_3155996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001052051.1|3156093_3156492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059531.1|3156492_3158124_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000428092.1|3158120_3159434_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000540864.1|3159435_3160641_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3168982:3168996	attR	TTTATTCGCTGATTT	NA	NA	NA	NA
>prophage 1
NZ_CP045864	Escherichia coli O157:H7 strain ATCC 43890 plasmid p1CFSAN076619, complete sequence	95989	34254	81447	95989	protease,integrase,transposase	Stx2-converting_phage(30.0%)	40	26433:26447	50502:50516
26433:26447	attL	ATTGCCTGAATATTT	NA	NA	NA	NA
WP_162829202.1|34254_35468_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_072142587.1|35493_35907_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001159868.1|35907_36213_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|36214_36433_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_010891291.1|36891_37575_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001248529.1|37571_38192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708307.1|38188_38389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361615.1|38796_39774_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_046835546.1|40152_40869_+	hypothetical protein	NA	A0A1I9LJQ6	Stx_converting_phage	100.0	5.4e-139
WP_001096887.1|40926_41721_+	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_001066920.1|41984_42725_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_010891288.1|42845_43076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001358890.1|43244_43529_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303402.1|43558_43753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001213545.1|43819_45259_-	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_000987091.1|45262_47383_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_000217739.1|47432_50429_-	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000839950.1|50430_50946_-	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
50502:50516	attR	ATTGCCTGAATATTT	NA	NA	NA	NA
WP_000971918.1|52836_53238_-	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000096786.1|53329_54163_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_001004187.1|54220_54733_-	type II secretion system protein M	NA	NA	NA	NA	NA
WP_071525076.1|54719_55892_-	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000776550.1|55930_56908_-	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_000082782.1|56904_57504_-	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000173396.1|57500_57848_-	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082929.1|57862_58417_-	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_001231211.1|58413_58848_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001173152.1|58878_60102_-	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_000092338.1|60103_61609_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001302177.1|61608_63576_-	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_001302175.1|63576_64452_-	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001358886.1|64538_67235_-|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001171554.1|67723_68104_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|68100_68448_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|68497_70036_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001302181.1|70555_71554_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000550559.1|71627_73349_-	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000975743.1|73438_74545_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001302199.1|74544_75366_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001034100.1|77544_81447_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
