The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045056	Salmonella enterica subsp. enterica serovar Muenchen strain LG24 chromosome, complete genome	4930424	968135	975448	4930424	protease	Dickeya_phage(16.67%)	7	NA	NA
WP_001201759.1|968135_969254_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
WP_001748306.1|969250_971197_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|971326_971548_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520787.1|971871_972192_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_000934064.1|972222_974499_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|974711_974909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531374.1|975070_975448_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
>prophage 2
NZ_CP045056	Salmonella enterica subsp. enterica serovar Muenchen strain LG24 chromosome, complete genome	4930424	1076856	1123328	4930424	head,lysis,tail,protease,integrase	Salmonella_phage(25.0%)	65	1071977:1071992	1103725:1103740
1071977:1071992	attL	GCGCCAGACGCGGCGC	NA	NA	NA	NA
WP_000374046.1|1076856_1077516_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_097361317.1|1078103_1079126_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	51.9	3.5e-91
WP_024134793.1|1079109_1079346_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_097361318.1|1079425_1079842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058645056.1|1079935_1080199_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_097361319.1|1080201_1080594_-	hypothetical protein	NA	A0A0M4RTV1	Salmonella_phage	42.4	6.6e-06
WP_057395058.1|1080590_1080860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153789541.1|1080856_1081048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361321.1|1081044_1081260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361322.1|1081259_1081547_-	hypothetical protein	NA	I6RSM9	Salmonella_phage	94.7	5.1e-24
WP_097361323.1|1081543_1081858_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	57.3	2.0e-34
WP_097361324.1|1081893_1082709_-	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	64.7	1.9e-87
WP_097361325.1|1082714_1085309_-	exonuclease VIII	NA	V5UQJ3	Shigella_phage	56.3	9.6e-162
WP_097361326.1|1085449_1085782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024153606.1|1085857_1086064_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_097361327.1|1086067_1086343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361328.1|1086368_1087220_-	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	57.4	5.5e-58
WP_058679873.1|1087528_1087771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079816621.1|1087831_1088101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361329.1|1088472_1088967_-	helix-turn-helix domain-containing protein	NA	A0A0R6PH50	Moraxella_phage	58.8	7.5e-15
WP_024153610.1|1089038_1089314_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	39.2	1.3e-08
WP_097361330.1|1089310_1089805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361331.1|1089852_1090860_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	69.6	1.0e-127
WP_097361332.1|1090852_1091314_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	76.2	3.2e-68
WP_097361333.1|1091329_1091725_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	37.4	1.5e-18
WP_097361334.1|1091721_1091994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023220363.1|1092118_1092331_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	77.1	1.8e-18
WP_097361335.1|1092797_1093397_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	1.5e-97
WP_097361336.1|1093393_1093588_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	7.9e-13
WP_097361337.1|1093584_1093866_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	1.7e-35
WP_097361338.1|1093862_1094399_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	66.3	1.1e-64
WP_097361339.1|1094929_1096360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001525456.1|1096544_1096847_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_097361340.1|1096824_1097364_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	69.5	2.4e-75
WP_097361563.1|1097681_1098137_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	81.9	1.9e-57
WP_070799731.1|1098362_1098551_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_079828278.1|1098614_1099244_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	3.3e-108
WP_079953322.1|1099246_1100866_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	80.1	1.7e-262
WP_097361341.1|1100865_1102374_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	42.7	1.4e-104
WP_097361342.1|1102414_1103104_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	50.9	1.8e-59
WP_097361343.1|1103100_1104456_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.8	9.4e-68
1103725:1103740	attR	GCGCCGCGTCTGGCGC	NA	NA	NA	NA
WP_097361344.1|1104457_1104940_+	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	49.4	1.4e-26
WP_079953317.1|1104939_1105968_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	49.1	1.7e-82
WP_097361345.1|1105971_1106319_+	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	33.3	3.1e-07
WP_079953315.1|1106324_1106771_+	DUF4054 domain-containing protein	NA	H9C0W0	Aeromonas_phage	43.8	1.4e-15
WP_097361346.1|1106764_1107349_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	27.9	1.7e-13
WP_097361347.1|1107345_1107711_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	5.1e-21
WP_097361348.1|1107695_1108241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361349.1|1108221_1109706_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	40.2	3.4e-95
WP_000016414.1|1109706_1110153_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_000101348.1|1110152_1110557_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000228831.1|1110598_1110781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000741779.1|1110764_1112936_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_097361350.1|1112932_1113643_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	2.5e-27
WP_000890115.1|1113642_1113945_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_000122818.1|1113941_1114811_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_000068499.1|1114791_1115469_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.4	5.4e-32
WP_001191865.1|1115481_1115838_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_001293657.1|1115834_1117076_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.9	1.2e-101
WP_097361351.1|1117077_1117680_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	4.3e-33
WP_097361352.1|1117669_1119121_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	72.8	1.7e-46
WP_097361353.1|1119621_1119927_+	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	60.0	1.9e-29
WP_097361354.1|1119916_1120651_+	DUF4376 domain-containing protein	NA	A0A0M4RTP2	Salmonella_phage	76.1	1.7e-47
WP_097361355.1|1120705_1122823_+	sialate O-acetylesterase	NA	H6WZJ9	Escherichia_phage	53.7	2.4e-163
WP_057395107.1|1122953_1123328_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	41.3	1.5e-15
>prophage 3
NZ_CP045056	Salmonella enterica subsp. enterica serovar Muenchen strain LG24 chromosome, complete genome	4930424	1817236	1911628	4930424	tRNA,head,capsid,portal,lysis,tail,protease,terminase,integrase,transposase	Enterobacteria_phage(44.74%)	103	1809326:1809341	1907620:1907635
1809326:1809341	attL	CGCGTGAGCGCGATAT	NA	NA	NA	NA
WP_000173208.1|1817236_1818493_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000174484.1|1818806_1819430_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_000988258.1|1819426_1820278_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001518537.1|1820543_1821491_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
WP_001037188.1|1821615_1823301_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	2.3e-23
WP_000823878.1|1823345_1823624_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000365078.1|1823874_1824483_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001748456.1|1824599_1825691_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001748457.1|1825849_1827115_-	DUF4427 domain-containing protein	NA	NA	NA	NA	NA
WP_001058311.1|1827614_1828733_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000070986.1|1828729_1830523_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_020438146.1|1830541_1831273_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000993801.1|1831269_1831866_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001615886.1|1831855_1832260_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000063377.1|1832256_1833105_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263613.1|1833179_1834724_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000888110.1|1834735_1835872_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270306.1|1835884_1835974_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001526439.1|1836368_1837643_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_020438149.1|1837856_1839569_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_000511323.1|1839631_1839886_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_020438150.1|1840054_1840789_+	flagellar brake protein YcgR	NA	NA	NA	NA	NA
WP_000776974.1|1840802_1841414_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_020438151.1|1841583_1842498_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000338376.1|1842594_1844328_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_023197862.1|1844389_1845460_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266937.1|1845473_1846772_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190831.1|1847094_1848627_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234826.1|1848673_1849393_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406446.1|1849612_1851157_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943475.1|1851298_1851829_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_079952872.1|1852064_1852202_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_079952870.1|1852761_1853142_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	41.6	5.2e-16
WP_153789548.1|1853272_1854559_-	hypothetical protein	NA	S5MDQ7	Escherichia_phage	38.3	2.1e-56
WP_097361386.1|1855638_1856262_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	37.8	2.2e-32
WP_097361387.1|1856273_1857470_-	hypothetical protein	NA	H6WZM9	Escherichia_phage	50.5	8.4e-20
WP_057393620.1|1857611_1857764_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_097361388.1|1861584_1862289_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	61.2	2.0e-66
WP_097361389.1|1862186_1862924_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.2	1.4e-113
WP_097361390.1|1862933_1863629_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	69.3	1.1e-91
WP_097361391.1|1863783_1864947_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	55.6	5.3e-112
WP_079953114.1|1865084_1865417_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	61.1	7.0e-33
WP_097361392.1|1865413_1868509_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	51.8	1.9e-241
WP_079953116.1|1868492_1868795_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	59.4	7.5e-26
WP_057395189.1|1868815_1869205_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	57.0	6.5e-30
WP_057395195.1|1869261_1870014_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	70.4	1.0e-95
WP_001643846.1|1870026_1870428_-|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	60.6	9.6e-45
WP_057395188.1|1870427_1871027_-|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	69.7	9.9e-70
WP_097361393.1|1871043_1871400_-|tail	phage tail protein	tail	K7P6U9	Enterobacteria_phage	58.5	1.7e-32
WP_057395186.1|1871410_1871785_-	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_057395185.1|1871849_1872878_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	58.1	1.9e-108
WP_057395184.1|1872971_1873319_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	53.8	2.1e-19
WP_057395183.1|1873315_1874839_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.7	4.5e-103
WP_097361394.1|1874828_1876424_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.4	2.6e-186
WP_057395181.1|1876420_1876624_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	80.0	1.3e-18
WP_079953120.1|1876607_1878542_-|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	65.8	2.9e-256
WP_057395179.1|1878513_1879059_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	7.6e-53
WP_097361395.1|1879519_1880716_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_070809067.1|1880896_1881187_+	lipoprotein bor	NA	C6ZCX3	Enterobacteria_phage	62.9	8.2e-30
WP_097361565.1|1881218_1881653_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	73.9	4.1e-49
WP_153789549.1|1881805_1881973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079953123.1|1882290_1882776_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	69.4	1.1e-58
WP_097361566.1|1882756_1883044_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_079953022.1|1883220_1883448_+	hypothetical protein	NA	Q38575	Escherichia_phage	42.5	2.4e-08
WP_097361396.1|1883437_1883818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079953024.1|1884493_1884976_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_079953025.1|1885195_1885450_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	42.9	5.0e-15
WP_079953026.1|1885446_1885788_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_079953027.1|1885930_1886680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361397.1|1886580_1887717_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	33.9	4.6e-52
WP_097361398.1|1887738_1888107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361399.1|1888178_1890131_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	33.4	7.6e-95
WP_097361400.1|1890209_1890437_-	derepression protein	NA	NA	NA	NA	NA
WP_057394489.1|1890930_1891194_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_097361402.1|1891196_1891619_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	56.6	3.8e-28
WP_097361403.1|1891622_1892096_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	77.5	5.2e-66
WP_058645051.1|1893156_1893405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079953034.1|1893401_1893797_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	36.9	2.7e-15
WP_097361404.1|1893793_1896112_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	27.1	1.6e-38
WP_153789550.1|1896069_1896312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361405.1|1896601_1896859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057395050.1|1897245_1897437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057395049.1|1897433_1897628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361406.1|1897781_1898360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153789848.1|1898895_1899345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125468762.1|1899429_1899708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361407.1|1899664_1900087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079953039.1|1900114_1900615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361408.1|1900727_1901069_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058645046.1|1901139_1902129_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	54.0	1.7e-98
WP_000018967.1|1902320_1902662_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_001083582.1|1902733_1902907_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001519337.1|1903098_1903236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785716.1|1903587_1904049_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001519895.1|1904126_1904786_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001525604.1|1904835_1905129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072527.1|1905254_1905962_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101047.1|1905985_1906798_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185666.1|1906801_1907068_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_097361409.1|1907189_1908317_-	ribonuclease D	NA	NA	NA	NA	NA
1907620:1907635	attR	ATATCGCGCTCACGCG	NA	NA	NA	NA
WP_000758418.1|1908389_1910075_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.8e-34
WP_021294445.1|1910279_1910861_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_001221014.1|1910932_1911628_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP045056	Salmonella enterica subsp. enterica serovar Muenchen strain LG24 chromosome, complete genome	4930424	1965730	1971120	4930424	integrase	uncultured_Caudovirales_phage(33.33%)	9	1965777:1965791	1976665:1976679
WP_097361410.1|1965730_1966264_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	50.0	2.4e-11
1965777:1965791	attL	CGTTCACACGTCATT	NA	NA	NA	NA
WP_001013467.1|1966317_1966548_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_020438171.1|1966578_1967685_+	hypothetical protein	NA	Q9QF34	Lambdoid_phage	65.0	1.1e-53
WP_071602162.1|1967681_1967876_+	hypothetical protein	NA	A0A2H4IYC8	uncultured_Caudovirales_phage	59.5	5.9e-08
WP_072205508.1|1967904_1968759_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.0	1.2e-71
WP_000722368.1|1969131_1969485_-	YebY family protein	NA	NA	NA	NA	NA
WP_000979705.1|1969501_1970377_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1970377_1970752_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1970889_1971120_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
1976665:1976679	attR	CGTTCACACGTCATT	NA	NA	NA	NA
>prophage 5
NZ_CP045056	Salmonella enterica subsp. enterica serovar Muenchen strain LG24 chromosome, complete genome	4930424	2073793	2085204	4930424		Morganella_phage(25.0%)	12	NA	NA
WP_001157315.1|2073793_2075224_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_001748531.1|2075297_2075993_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107434.1|2076072_2076384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017465542.1|2077035_2078247_+	porin	NA	Q1MVN1	Enterobacteria_phage	56.2	4.4e-109
WP_024131109.1|2078506_2078695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2078705_2078918_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457663.1|2079372_2080641_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000394197.1|2080643_2081063_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_001537372.1|2081189_2081351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598921.1|2081831_2082629_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001683376.1|2083000_2083291_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	52.6	2.1e-09
WP_153789552.1|2083935_2085204_+	DUF4102 domain-containing protein	NA	A0A0U1UNT3	Pseudomonas_phage	36.5	4.2e-62
>prophage 6
NZ_CP045056	Salmonella enterica subsp. enterica serovar Muenchen strain LG24 chromosome, complete genome	4930424	2209145	2219652	4930424		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126351.1|2209145_2210459_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
WP_000565902.1|2210485_2211565_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000648783.1|2211569_2212343_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_020437413.1|2212358_2213333_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973714.1|2213338_2213890_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
WP_000857530.1|2213890_2214769_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
WP_001023659.1|2214816_2215716_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697840.1|2215715_2216801_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981471.1|2217177_2218071_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111837.1|2218248_2219652_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
>prophage 7
NZ_CP045056	Salmonella enterica subsp. enterica serovar Muenchen strain LG24 chromosome, complete genome	4930424	2298107	2307278	4930424	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_021294257.1|2298107_2300141_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2300381_2300840_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|2301011_2301542_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2301598_2302066_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2302112_2302832_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2302828_2304514_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240418.1|2304736_2305468_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2305527_2305635_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2305615_2306347_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2306330_2307278_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 8
NZ_CP045056	Salmonella enterica subsp. enterica serovar Muenchen strain LG24 chromosome, complete genome	4930424	3441671	3481276	4930424	head,tail,terminase,integrase,plate,transposase	Pseudomonas_phage(24.24%)	55	3441418:3441433	3481385:3481400
3441418:3441433	attL	CAATCAATTCTGGACA	NA	NA	NA	NA
WP_153789573.1|3441671_3442253_-	helix-turn-helix domain-containing protein	NA	A0A1C6ZDG7	Pseudomonas_phage	34.0	2.0e-06
WP_153789574.1|3442419_3442686_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_153789575.1|3442695_3444759_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	42.1	1.4e-144
WP_153789576.1|3444776_3445670_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	54.9	5.6e-85
WP_153789577.1|3445683_3445956_+	hypothetical protein	NA	A0A0F6WDF2	Pseudomonas_phage	39.0	3.5e-06
WP_153789578.1|3445968_3446250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789579.1|3446264_3446486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789580.1|3446497_3446713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789581.1|3446727_3446934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789582.1|3446923_3447616_+	DUF3164 family protein	NA	Q6QIE4	Burkholderia_phage	55.3	3.0e-62
WP_153789583.1|3447542_3447845_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153789584.1|3448099_3448366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789585.1|3448366_3448585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789586.1|3448566_3449268_+	DUF4406 domain-containing protein	NA	A0A0K1LK36	Vibrio_phage	53.7	1.7e-17
WP_153789587.1|3449458_3449794_+	hypothetical protein	NA	A0A219YC07	Aeromonas_phage	37.7	4.7e-05
WP_153789588.1|3449898_3450447_+	AsnC family protein	NA	NA	NA	NA	NA
WP_153789589.1|3450472_3450850_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	45.4	2.4e-13
WP_153789590.1|3450846_3451260_+	DUF1018 domain-containing protein	NA	A0A2D1GNN4	Pseudomonas_phage	53.6	5.1e-33
WP_153789591.1|3451381_3451849_+	mor transcription activator family protein	NA	A0A2D1GNW5	Pseudomonas_phage	45.0	5.0e-21
WP_153789592.1|3451887_3452196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789593.1|3452301_3452514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789594.1|3452516_3453044_+	glycoside hydrolase family protein	NA	A0A0M3LPQ1	Mannheimia_phage	46.8	1.8e-38
WP_153789595.1|3453028_3453607_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	31.3	1.1e-09
WP_153789596.1|3453584_3453830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789597.1|3453829_3454330_+	DUF1804 family protein	NA	I6PBD1	Pseudomonas_phage	50.0	1.8e-37
WP_153789598.1|3454316_3454532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789599.1|3455049_3455517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153789600.1|3455531_3455705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153789601.1|3455823_3457467_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	61.7	4.2e-187
WP_153789602.1|3457476_3459066_+	DUF935 family protein	NA	H1ZZE2	Pseudomonas_virus	42.9	6.2e-111
WP_153789603.1|3459055_3460216_+|head	phage head morphogenesis protein	head	Q6QIB9	Burkholderia_phage	41.5	8.1e-52
WP_153789604.1|3460196_3460748_+	phage virion morphogenesis protein	NA	A0A2K9VH22	Faecalibacterium_phage	32.2	1.3e-12
WP_153789605.1|3460965_3462129_+	hypothetical protein	NA	A0A2D1GNS3	Pseudomonas_phage	40.0	6.2e-60
WP_153789606.1|3462128_3462527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789607.1|3462536_3463448_+|head	head protein	head	A0A2H4J778	uncultured_Caudovirales_phage	57.6	2.0e-98
WP_153789608.1|3463444_3463894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789609.1|3463903_3464329_+	DUF1320 domain-containing protein	NA	A0A1X9SGZ3	Bradyrhizobium_phage	36.1	2.8e-10
WP_153789610.1|3464325_3465018_+	DUF1834 family protein	NA	NA	NA	NA	NA
WP_153789611.1|3464977_3465154_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_153789612.1|3465146_3466556_+|tail	phage tail protein	tail	A0A0M3LQC3	Mannheimia_phage	43.8	1.6e-94
WP_153789613.1|3466564_3466939_+|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	51.7	7.9e-25
WP_153789614.1|3466935_3467322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789615.1|3467476_3469783_+|tail	tail length tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	34.0	7.2e-68
WP_153789616.1|3469779_3471180_+	multidrug DMT transporter permease	NA	A0A0M3LQ21	Mannheimia_phage	26.3	1.4e-29
WP_153789641.1|3471169_3472357_+|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	37.1	9.4e-72
WP_153789617.1|3472353_3473052_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	44.2	5.7e-45
WP_153789618.1|3473124_3473475_+	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	55.7	1.8e-26
WP_153789619.1|3473474_3474533_+|tail	phage tail protein	tail	A0A0M3LQN4	Mannheimia_phage	45.6	1.8e-74
WP_153789620.1|3474532_3475105_+	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	39.2	1.2e-29
WP_153789621.1|3476296_3476986_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	53.1	7.1e-64
WP_153789622.1|3477084_3477594_-	hypothetical protein	NA	Q37842	Escherichia_phage	40.2	1.2e-28
WP_153789623.1|3477727_3478288_+	helix-turn-helix domain-containing protein	NA	A0A0A7NPV4	Enterobacteria_phage	77.0	5.8e-72
WP_153789624.1|3478361_3478538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789625.1|3478582_3478846_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_153789642.1|3479230_3481276_+	sialate O-acetylesterase	NA	G9L6J1	Escherichia_phage	51.7	4.0e-163
3481385:3481400	attR	TGTCCAGAATTGATTG	NA	NA	NA	NA
>prophage 9
NZ_CP045056	Salmonella enterica subsp. enterica serovar Muenchen strain LG24 chromosome, complete genome	4930424	4292882	4388360	4930424	tRNA,holin,portal,capsid,head,tail,protease,terminase,integrase,plate	Salmonella_phage(77.78%)	110	4325781:4325825	4358452:4358496
WP_001621365.1|4292882_4293320_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001518251.1|4293364_4294306_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001259012.1|4294320_4294767_-	type II toxin-antitoxin system HigA family antitoxin	NA	NA	NA	NA	NA
WP_000558166.1|4294763_4295075_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_021294279.1|4295160_4296090_-	alpha/beta hydrolase	NA	A0A2K9L5W3	Tupanvirus	44.4	1.3e-07
WP_001159630.1|4296307_4296619_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	NA	NA	NA	NA
WP_000362050.1|4296619_4296910_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000027730.1|4296956_4297886_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829025.1|4297882_4298518_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331361.1|4298514_4299417_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_077248424.1|4299429_4302480_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	4.6e-06
WP_001059740.1|4302674_4303511_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000710966.1|4303778_4304810_-	YiiG family protein	NA	NA	NA	NA	NA
WP_000828039.1|4304992_4306093_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_000527677.1|4306436_4306760_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_000683586.1|4306759_4307419_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010989088.1|4307501_4308068_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000619475.1|4308156_4308471_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_097361574.1|4308467_4309616_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_001179690.1|4309742_4310570_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001661624.1|4310712_4311972_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_023197765.1|4311968_4313438_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217112.1|4313725_4314562_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000013291.1|4314714_4315563_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063541.1|4315559_4316594_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000378721.1|4317212_4317896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000566800.1|4318053_4319361_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_001091413.1|4319353_4319869_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000812816.1|4319887_4320871_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_097361573.1|4321199_4321820_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	3.2e-63
WP_011233226.1|4321826_4322579_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_021294276.1|4322590_4322986_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000580402.1|4323036_4324410_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_001033731.1|4324406_4325105_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001233463.1|4325255_4325756_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4325781:4325825	attL	CACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_079953016.1|4325932_4326913_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	97.9	1.5e-184
WP_099706372.1|4326982_4327336_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	100.0	1.2e-59
WP_024153929.1|4327407_4327869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422421.1|4327819_4328275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031607754.1|4328413_4328695_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	100.0	1.4e-50
WP_000078935.1|4328705_4328909_+	hypothetical protein	NA	A0A0M3ULI0	Salmonella_phage	98.5	1.2e-30
WP_000290619.1|4328919_4329126_+	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	100.0	4.3e-33
WP_000543629.1|4329115_4329346_+	hypothetical protein	NA	A0A0M4S6M9	Salmonella_phage	76.0	1.2e-28
WP_000482341.1|4329440_4329875_+	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	91.0	5.1e-68
WP_000946669.1|4329874_4330057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166617.1|4330100_4330313_+	hypothetical protein	NA	A0A0M4R514	Salmonella_phage	95.7	6.4e-32
WP_000620901.1|4330314_4331196_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	82.3	6.6e-131
WP_097361544.1|4331195_4331393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000128157.1|4331393_4332428_+	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	61.9	5.6e-129
WP_058648989.1|4332424_4334785_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	86.1	0.0e+00
WP_024153925.1|4334860_4335454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024153924.1|4335467_4336580_+	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	31.1	4.4e-31
WP_000014576.1|4336982_4338032_-|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	100.0	6.7e-207
WP_024153923.1|4338032_4339745_-	oxidoreductase	NA	A0A0M4S6K7	Salmonella_phage	98.6	0.0e+00
WP_024153922.1|4339898_4340744_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	98.2	1.4e-154
WP_001246220.1|4340784_4341831_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	99.7	3.7e-197
WP_044144072.1|4341873_4342722_+|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	96.5	4.7e-134
WP_024153920.1|4342824_4343313_+|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	96.9	1.5e-84
WP_001102549.1|4343312_4343513_+|tail	tail protein	tail	A0A0M4RTN6	Salmonella_phage	100.0	1.8e-31
WP_000543937.1|4343523_4343859_+|holin	phage holin, lambda family	holin	A0A0M3ULH4	Salmonella_phage	98.2	2.1e-53
WP_024153919.1|4343842_4344283_+	lysozyme	NA	A0A0M5M782	Salmonella_phage	97.9	1.4e-76
WP_024153918.1|4344383_4344914_+	DUF2514 family protein	NA	A0A0M4S5V1	Salmonella_phage	93.8	7.4e-45
WP_000917105.1|4344913_4345408_+|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	98.0	8.7e-80
WP_058648991.1|4345368_4346013_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	96.7	2.8e-115
WP_097361545.1|4346169_4346799_+|plate	phage baseplate assembly protein V	plate	A0A0M3ULA5	Salmonella_phage	97.6	9.3e-111
WP_000108899.1|4346795_4347158_+|plate	baseplate assembly protein	plate	A0A0M4S6L5	Salmonella_phage	99.2	3.3e-60
WP_024153915.1|4347154_4348066_+|plate	baseplate assembly protein	plate	A0A0M4REB7	Salmonella_phage	97.7	7.0e-160
WP_097361546.1|4348058_4348673_+|tail	phage tail protein I	tail	A0A1J0I2I4	Salmonella_phage	97.9	1.9e-108
WP_044144047.1|4348662_4350399_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	74.8	3.6e-197
WP_024153912.1|4350398_4350968_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	95.2	6.0e-101
WP_024153911.1|4351172_4351622_-|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	97.3	2.5e-78
WP_024153910.1|4351632_4354560_-|tail	phage tail tape measure protein	tail	A0A0M4R2V3	Salmonella_phage	92.5	0.0e+00
WP_000763324.1|4354560_4354677_-|tail	GpE family phage tail protein	tail	A0A0M3ULA8	Salmonella_phage	100.0	6.6e-15
WP_000047593.1|4354685_4355021_-	hypothetical protein	NA	A0A0M4RCV2	Salmonella_phage	99.1	3.0e-52
WP_001207579.1|4355035_4355551_-|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	95.9	3.9e-91
WP_000224787.1|4355563_4356757_-|tail	tail protein	tail	A0A0M4S6M1	Salmonella_phage	94.2	1.0e-214
WP_024153908.1|4356914_4358033_+	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	99.5	3.8e-192
WP_001251454.1|4358081_4358324_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001077320.1|4358574_4359477_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4358452:4358496	attR	CACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591793.1|4359661_4360624_+	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758711.1|4360827_4361817_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000750756.1|4361917_4362673_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000777314.1|4362937_4364272_+	MFS transporter	NA	NA	NA	NA	NA
WP_021294116.1|4364282_4365242_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000557881.1|4365251_4366292_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_001535809.1|4366354_4367077_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000060999.1|4367174_4367345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621105.1|4367360_4367492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001173083.1|4367581_4367932_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000113085.1|4367945_4369538_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_023197763.1|4369624_4370584_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001167255.1|4370839_4372375_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	8.3e-20
WP_000911133.1|4372368_4373412_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_000981826.1|4373408_4374410_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000090737.1|4374438_4375461_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774146.1|4375489_4376365_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_001738619.1|4376447_4376738_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001088050.1|4376747_4377512_+	epimerase	NA	NA	NA	NA	NA
WP_001216335.1|4377603_4378371_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802241.1|4378483_4379080_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155237.1|4379180_4379609_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000796303.1|4379715_4380462_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250624.1|4380558_4381569_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136809.1|4381680_4383189_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084285.1|4383209_4384055_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000051370.1|4384453_4384693_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872918.1|4384914_4385400_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139639.1|4385492_4386422_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293360.1|4386488_4387820_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000208240.1|4387829_4388360_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 10
NZ_CP045056	Salmonella enterica subsp. enterica serovar Muenchen strain LG24 chromosome, complete genome	4930424	4506977	4525129	4930424	tail,plate	Burkholderia_phage(40.0%)	23	NA	NA
WP_001177097.1|4506977_4507493_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
WP_000368203.1|4507502_4508984_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_000359500.1|4508986_4509619_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_020437568.1|4509611_4510727_-|plate	phage baseplate	plate	Q6QI99	Burkholderia_phage	51.7	3.4e-100
WP_001093501.1|4510717_4511077_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632048.1|4511240_4512788_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	2.5e-48
WP_020437570.1|4512787_4513717_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	3.9e-150
WP_000593184.1|4513713_4514076_-	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_017465888.1|4514403_4515126_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_017465889.1|4515135_4516179_-	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.9	6.5e-77
WP_001269716.1|4516166_4516376_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_020437572.1|4516375_4517329_-	hypothetical protein	NA	A4JWL1	Burkholderia_virus	51.5	1.0e-36
WP_153789630.1|4517328_4519680_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.2	2.4e-66
WP_001185655.1|4519776_4519905_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_020437574.1|4519864_4520182_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_020437575.1|4520233_4520758_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	3.6e-68
WP_000729853.1|4520757_4522185_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.4e-194
WP_097361551.1|4522174_4522372_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	51.0	5.6e-06
WP_000449439.1|4522368_4522824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777267.1|4522982_4523297_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.2	8.3e-20
WP_020437576.1|4523309_4523915_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	1.4e-60
WP_001226439.1|4523917_4524205_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_000615248.1|4524781_4525129_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP045054	Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence	270881	24836	146398	270881	integrase,portal,protease,holin,bacteriocin,terminase,plate,tail,lysis,transposase,head,capsid	Salmonella_phage(35.0%)	99	25114:25130	71709:71725
WP_097361660.1|24836_25511_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.2e-11
25114:25130	attL	AACAGCAGGTTATCATT	NA	NA	NA	NA
WP_057393574.1|26365_27262_+	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_139760138.1|29101_30016_+	pyocin	NA	NA	NA	NA	NA
WP_057395147.1|30012_30285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139760136.1|30877_30991_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	94.6	1.4e-09
WP_057395148.1|31026_31596_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.4	8.4e-95
WP_097361583.1|31595_32771_-|tail	tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	80.3	3.4e-50
WP_097361584.1|32757_33345_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	97.9	7.8e-112
WP_097361585.1|33347_34427_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	95.8	1.2e-198
WP_000605053.1|34419_34833_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	94.9	3.3e-72
WP_001273646.1|34837_35371_-|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	98.9	1.0e-94
WP_097361587.1|35370_36429_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.1	4.3e-201
WP_097361588.1|36425_37766_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	98.9	5.3e-249
WP_000497739.1|40933_41098_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779212.1|41101_41662_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	97.3	3.7e-103
WP_079953067.1|41658_42171_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	96.5	8.1e-89
WP_000702382.1|42142_42547_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	88.1	9.3e-64
WP_000927721.1|42543_42867_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.4e-54
WP_000601365.1|42869_43070_-	hypothetical protein	NA	S5FNU1	Shigella_phage	100.0	3.4e-27
WP_079781928.1|43119_44325_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	98.5	1.1e-221
WP_153789523.1|44339_44990_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	96.3	1.5e-116
WP_000466255.1|44967_46209_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_097361591.1|46208_46391_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	98.3	5.0e-25
WP_153789524.1|46402_46543_-	hypothetical protein	NA	Q8HAD6	Salmonella_phage	97.8	1.7e-17
WP_153789525.1|46591_48136_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.6	7.4e-311
WP_079953069.1|48132_48627_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	99.4	7.8e-89
WP_001135222.1|48757_49108_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	96.6	1.0e-63
WP_001292891.1|49168_49471_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	97.0	5.1e-51
WP_000501908.1|49547_49835_-	TonB family protein	NA	H6WZK5	Escherichia_phage	50.0	7.6e-20
WP_001050801.1|50012_50558_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	58.1	2.8e-07
WP_001527046.1|51171_51516_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_070801491.1|52437_53250_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	47.0	1.4e-63
WP_080198751.1|53541_54357_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	74.2	1.8e-106
WP_097361593.1|54353_55214_-	helix-turn-helix domain containing protein	NA	A0A1B5FPA6	Escherichia_phage	80.6	8.7e-128
WP_097361594.1|55213_56182_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	87.9	7.0e-166
WP_097361595.1|56178_57783_-	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	85.4	1.2e-274
WP_079953078.1|58842_59499_+	LexA family transcriptional regulator	NA	Q8W648	Enterobacteria_phage	74.3	1.8e-93
WP_000560246.1|59639_59837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361596.1|59839_60031_+	hypothetical protein	NA	A0A1B5FPB5	Escherichia_phage	53.2	1.4e-09
WP_079953080.1|60104_60299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000155900.1|60295_60481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079916472.1|60668_60878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079953081.1|60801_61218_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	56.4	7.2e-27
WP_097361597.1|61217_61418_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	71.7	1.9e-14
WP_079953083.1|61448_62354_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	77.6	2.9e-129
WP_070801904.1|62350_62917_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	39.4	1.8e-28
WP_079953084.1|62913_63138_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	65.8	1.2e-17
WP_079953085.1|63134_63599_+	ATPase	NA	A0A1B5FPC7	Escherichia_phage	51.7	4.4e-41
WP_000202173.1|63598_63814_+	hypothetical protein	NA	A0A248XD10	Klebsiella_phage	43.1	1.6e-06
WP_070789913.1|63964_64207_+	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	68.4	1.1e-22
WP_097361598.1|64232_65558_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	64.5	1.1e-164
WP_079953089.1|66049_67600_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.9	3.0e-09
WP_079953095.1|71585_71999_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	38.5	5.8e-13
71709:71725	attR	AATGATAACCTGCTGTT	NA	NA	NA	NA
WP_079953096.1|71998_72319_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	65.6	2.3e-33
WP_097361599.1|73344_74250_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	58.8	6.2e-84
WP_058644812.1|74416_75505_+	quinol oxidase	NA	NA	NA	NA	NA
WP_097361600.1|76478_77681_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.5	8.9e-78
WP_079953100.1|77620_77905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361601.1|77933_78689_-	AAA family ATPase	NA	K4HZD4	Acidithiobacillus_phage	41.8	3.8e-42
WP_097361602.1|81924_84126_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_023247018.1|84151_85486_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_097361603.1|85489_87223_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_097361604.1|87222_88170_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_153789526.1|88170_89895_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_097361605.1|90027_91239_+	MFS transporter	NA	NA	NA	NA	NA
WP_097361606.1|91254_92142_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_023247011.1|93847_94384_+	fimbrial protein	NA	NA	NA	NA	NA
WP_079953106.1|94509_95172_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_097361607.1|95182_97729_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_097361662.1|97859_98912_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_097361608.1|99074_99527_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_057394607.1|99666_100041_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_047643234.1|100224_100551_-	nucleoside transporter	NA	NA	NA	NA	NA
WP_077917243.1|100572_101199_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	4.1e-50
WP_097361454.1|101195_102425_-	DUF3440 domain-containing protein	NA	A0A068F1U8	Mycobacterium_phage	34.1	1.7e-60
WP_097361455.1|102418_103150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361456.1|103139_103670_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000984349.1|104192_104663_-	DUF2919 family protein	NA	NA	NA	NA	NA
WP_097361609.1|112655_114452_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_000493286.1|115588_115918_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_057394952.1|115898_116180_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	39.1	5.9e-09
WP_097361610.1|117069_118821_+	colicin	NA	NA	NA	NA	NA
WP_057394954.1|118823_119087_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_057394955.1|119170_119317_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_097361611.1|119840_122837_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.2	0.0e+00
WP_057393714.1|123000_123573_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	86.8	8.2e-82
WP_057393711.1|123693_124146_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_153789527.1|124177_125710_-	SidA/IucD/PvdA family monooxygenase	NA	NA	NA	NA	NA
WP_079953337.1|125706_125976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057394178.1|127628_127901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057393724.1|130145_132248_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	34.6	8.1e-10
WP_057393723.1|132386_132995_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	33.9	1.2e-17
WP_057393721.1|133483_133828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361613.1|135135_136283_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	4.3e-146
WP_153789528.1|136343_136616_-|bacteriocin	colicin-V (microcin-V bacteriocin)	bacteriocin	NA	NA	NA	NA
WP_139760163.1|136886_139001_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	2.7e-37
WP_097361615.1|138975_140217_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_097361663.1|140874_142425_-	MchC protein	NA	NA	NA	NA	NA
WP_057393929.1|145705_146398_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
