The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	0	3642	5593263		Planktothrix_phage(100.0%)	3	NA	NA
WP_153857086.1|714_1635_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_012006427.1|1690_2938_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_135316175.1|2937_3642_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.9	5.1e-33
>prophage 2
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	10334	18283	5593263		Bacillus_phage(25.0%)	8	NA	NA
WP_153857090.1|10334_11435_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.1	7.7e-20
WP_153857091.1|11635_12121_+	heme-degrading domain-containing protein	NA	NA	NA	NA	NA
WP_153857092.1|12351_14040_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.8e-26
WP_037420478.1|14217_15072_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.7	1.7e-46
WP_085116314.1|15105_15915_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017892489.1|15911_16310_-	SirB2 family protein	NA	NA	NA	NA	NA
WP_153857093.1|16361_17198_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_012006414.1|17197_18283_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	46.7	8.2e-06
>prophage 3
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	21951	25836	5593263	tRNA	Tupanvirus(50.0%)	4	NA	NA
WP_041414469.1|21951_22899_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.2	2.1e-45
WP_153857097.1|23084_23363_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_112348087.1|23676_24267_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_153857098.1|24306_25836_-	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	32.3	2.4e-59
>prophage 4
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	30165	33261	5593263		Herpes_simplex_virus(100.0%)	1	NA	NA
WP_153857101.1|30165_33261_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.3	5.5e-156
>prophage 5
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	44389	45874	5593263		Staphylococcus_phage(100.0%)	1	NA	NA
WP_153857110.1|44389_45874_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.2	1.8e-11
>prophage 6
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	52551	52767	5593263		Fusobacterium_phage(100.0%)	1	NA	NA
WP_026142313.1|52551_52767_-	helix-turn-helix transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	33.9	4.0e-05
>prophage 7
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	57496	68582	5593263	transposase,integrase	Pectobacterium_phage(33.33%)	15	57248:57262	68661:68675
57248:57262	attL	AAAAAAAGACCGAAT	NA	NA	NA	NA
WP_137231231.1|57496_58647_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	62.4	5.0e-94
WP_153857121.1|59030_60404_-	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	49.0	5.7e-113
WP_153857122.1|60400_61207_-	replication protein RepO	NA	A0A2H4JAA4	uncultured_Caudovirales_phage	47.0	5.6e-36
WP_153857123.1|61203_61563_-	HNH endonuclease	NA	A0A1C9LVX4	Vibrio_phage	44.8	2.4e-10
WP_013813293.1|61565_61784_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	62.3	4.9e-19
WP_013813294.1|61810_62263_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	54.0	9.8e-30
WP_041416161.1|62325_62532_-	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	39.0	2.9e-05
WP_013813295.1|62612_62999_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	56.9	1.1e-32
WP_013813297.1|63442_63757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013813298.1|63767_64046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153857124.1|64096_66253_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	36.1	3.6e-106
WP_153857125.1|66249_66750_+	hypothetical protein	NA	H9C156	Pectobacterium_phage	72.9	2.7e-60
WP_013813301.1|66791_66968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153857126.1|67183_67525_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.2	2.5e-09
WP_153857127.1|67499_68582_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	49.9	4.8e-99
68661:68675	attR	AAAAAAAGACCGAAT	NA	NA	NA	NA
>prophage 8
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	71795	74716	5593263		Pectobacterium_phage(50.0%)	4	NA	NA
WP_012006365.1|71795_72026_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	64.7	1.3e-17
WP_153857130.1|72058_73012_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_135316118.1|73184_73610_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_153857131.1|74047_74716_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	31.8	3.0e-19
>prophage 9
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	96635	97382	5593263		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_153857145.1|96635_97382_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.7	1.9e-17
>prophage 10
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	102077	103723	5593263		Streptococcus_virus(50.0%)	2	NA	NA
WP_153857148.1|102077_103085_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	39.7	4.9e-05
WP_153857149.1|103084_103723_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	38.7	2.0e-28
>prophage 11
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	107048	108174	5593263		Ralstonia_phage(50.0%)	2	NA	NA
WP_004719003.1|107048_107285_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	47.1	1.0e-09
WP_020826338.1|107439_108174_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.9	2.2e-15
>prophage 12
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	119175	119415	5593263		Enterobacteria_phage(100.0%)	1	NA	NA
WP_153857159.1|119175_119415_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	56.6	1.9e-16
>prophage 13
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	129069	133850	5593263		Morganella_phage(50.0%)	4	NA	NA
WP_153857167.1|129069_129990_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	45.0	7.8e-66
WP_153857168.1|130100_130385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153857169.1|130584_131820_+	multidrug efflux MFS transporter MdtG	NA	NA	NA	NA	NA
WP_153857170.1|132296_133850_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	58.1	1.3e-158
>prophage 14
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	151140	156359	5593263		Planktothrix_phage(50.0%)	3	NA	NA
WP_153857182.1|151140_153081_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	37.6	4.4e-34
WP_153857183.1|153084_154449_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_153857184.1|154856_156359_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.1	3.8e-54
>prophage 15
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	164366	164561	5593263		Enterobacteria_phage(100.0%)	1	NA	NA
WP_153857188.1|164366_164561_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	54.1	6.7e-12
>prophage 16
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	168168	206480	5593263	tail,head,terminase,holin,integrase	Salmonella_phage(25.0%)	49	167223:167237	213676:213690
167223:167237	attL	AGCGCCAACTCGCTG	NA	NA	NA	NA
WP_153857193.1|168168_169299_+	acyltransferase family protein	NA	A0A166XZF2	Gordonia_phage	27.8	1.4e-11
WP_153857194.1|169329_169875_-	hypothetical protein	NA	A9YX14	Burkholderia_phage	51.7	7.5e-16
WP_153857195.1|169867_170539_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	51.9	7.0e-56
WP_167519970.1|170535_171726_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	57.9	7.9e-119
WP_153857197.1|171722_172076_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	65.0	7.6e-38
WP_167519889.1|172075_172825_-	translation initiation factor IF-2	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	66.0	2.0e-59
WP_153857198.1|172826_173771_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	41.6	1.7e-71
WP_153857199.1|173802_174108_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	49.5	9.6e-21
WP_153860819.1|174094_174691_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	56.1	4.6e-51
WP_153857200.1|174690_176703_-	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	40.9	6.2e-124
WP_153857201.1|176692_176848_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	52.0	1.8e-07
WP_153857202.1|176880_177324_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	36.0	1.4e-17
WP_153857203.1|177334_177778_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	68.8	8.4e-50
WP_153857204.1|177787_179269_-	DUF3383 family protein	NA	A0A0P0I492	Acinetobacter_phage	50.2	4.7e-129
WP_153860820.1|179272_179713_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	56.5	2.0e-43
WP_153857205.1|179815_180208_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	66.2	3.1e-40
WP_153857206.1|180207_180714_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	40.0	1.7e-22
WP_153857207.1|180710_181121_-	DUF4054 domain-containing protein	NA	A0A2H4J1A6	uncultured_Caudovirales_phage	51.1	1.7e-28
WP_153857208.1|181089_181509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153857209.1|181551_182499_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	58.5	3.7e-103
WP_153857210.1|182509_183013_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	52.7	2.5e-34
WP_153857211.1|183023_184289_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	45.2	5.8e-80
WP_153857212.1|184297_184495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153860821.1|184545_185094_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.4	9.1e-46
WP_153857213.1|185149_186619_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	53.4	1.6e-150
WP_153857214.1|186835_188134_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4JCM3	uncultured_Caudovirales_phage	60.4	1.2e-141
WP_153857215.1|188145_188877_-	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	33.3	5.9e-08
WP_153857216.1|189284_189671_-	DUF2570 family protein	NA	NA	NA	NA	NA
WP_153857217.1|189667_190102_-	glycoside hydrolase family protein	NA	R9TMH8	Aeromonas_phage	56.6	2.3e-36
WP_153860822.1|190085_190400_-|holin	holin	holin	E7C9S8	Salmonella_phage	66.7	2.7e-26
WP_153857218.1|190603_191050_+	hypothetical protein	NA	A0A077KCC4	Edwardsiella_phage	32.7	1.9e-09
WP_153857219.1|191631_192132_-	DUF1133 family protein	NA	I6S672	Salmonella_phage	58.1	2.6e-47
WP_153857220.1|192128_192416_-	DUF1364 family protein	NA	A0A0M3LQ97	Mannheimia_phage	65.3	1.3e-30
WP_153857221.1|192412_193006_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	65.0	8.5e-74
WP_153857222.1|193074_193266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153857223.1|193510_195808_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.6	1.1e-228
WP_153857224.1|196163_196655_-	hypothetical protein	NA	H9C166	Pectobacterium_phage	46.8	9.0e-29
WP_153857225.1|196698_198114_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.2	4.1e-175
WP_153857226.1|198113_198719_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	44.0	2.6e-41
WP_167519890.1|198715_199561_-	hypothetical protein	NA	A0A1C9LVZ5	Vibrio_phage	43.3	8.3e-14
WP_153857228.1|199563_199782_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	58.0	5.4e-18
WP_153857229.1|199807_200260_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	58.3	1.6e-32
WP_153857230.1|200321_200525_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	47.4	3.1e-07
WP_167519891.1|200609_201005_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	60.2	7.7e-39
WP_153857232.1|201836_202154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153857233.1|202193_204347_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	40.8	2.0e-125
WP_153857234.1|204343_204844_+	hypothetical protein	NA	H9C156	Pectobacterium_phage	76.5	7.5e-63
WP_122078423.1|205238_205463_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	40.6	6.2e-09
WP_153857235.1|205463_206480_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	63.9	2.2e-125
213676:213690	attR	AGCGCCAACTCGCTG	NA	NA	NA	NA
>prophage 17
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	223482	223911	5593263		Morganella_phage(100.0%)	1	NA	NA
WP_153857248.1|223482_223911_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	49.0	3.7e-26
>prophage 18
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	227918	229130	5593263		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_153857251.1|227918_229130_+	5-aminolevulinate synthase	NA	V5LQ39	Emiliania_huxleyi_virus	30.1	1.1e-38
>prophage 19
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	239273	241177	5593263		Enterobacteria_phage(100.0%)	2	NA	NA
WP_153857262.1|239273_239801_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	61.3	1.7e-25
WP_153857263.1|239857_241177_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	79.4	9.1e-185
>prophage 20
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	252970	256065	5593263	protease,holin	Vibrio_phage(50.0%)	2	NA	NA
WP_153857274.1|252970_254965_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.5	2.0e-21
WP_004942825.1|255405_256065_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	48.4	2.8e-41
>prophage 21
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	260478	262533	5593263		Bacillus_phage(100.0%)	1	NA	NA
WP_153857281.1|260478_262533_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	24.6	1.4e-14
>prophage 22
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	277267	279172	5593263		Tupanvirus(100.0%)	1	NA	NA
WP_153857292.1|277267_279172_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	27.0	7.5e-47
>prophage 23
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	288040	288814	5593263		Bacillus_virus(100.0%)	1	NA	NA
WP_153857299.1|288040_288814_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	9.2e-28
>prophage 24
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	291914	300878	5593263	tRNA	Bacillus_virus(25.0%)	7	NA	NA
WP_153857301.1|291914_293615_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.9	3.5e-19
WP_153857302.1|293869_295075_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_153857303.1|295297_296698_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	2.1e-78
WP_153860825.1|297004_298111_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.8	2.1e-121
WP_112364278.1|298356_299547_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_012006155.1|299615_300263_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_153857304.1|300329_300878_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	3.2e-06
>prophage 25
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	314914	323096	5593263		Morganella_phage(50.0%)	7	NA	NA
WP_006320799.1|314914_315136_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	45.2	1.8e-08
WP_004717375.1|315357_315567_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	69.2	2.7e-19
WP_153857309.1|316095_317502_+	DUF1338 family protein	NA	NA	NA	NA	NA
WP_153857310.1|317503_318484_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_153857311.1|318483_320232_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	1.3e-58
WP_153857312.1|320267_322559_-	ComEC family protein	NA	NA	NA	NA	NA
WP_004942652.1|322811_323096_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	39.1	9.2e-10
>prophage 26
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	327387	328473	5593263		Streptococcus_phage(100.0%)	1	NA	NA
WP_153857314.1|327387_328473_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.9	7.5e-84
>prophage 27
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	333089	342584	5593263		Tetraselmis_virus(66.67%)	5	NA	NA
WP_153857317.1|333089_335372_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	40.8	6.9e-156
WP_012006131.1|335672_336413_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.8	7.2e-22
WP_153857318.1|336464_337610_-	MFS transporter	NA	NA	NA	NA	NA
WP_153857319.1|337824_338751_-	pseudouridine-5-phosphate glycosidase	NA	NA	NA	NA	NA
WP_153857320.1|338747_342584_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	32.9	4.1e-44
>prophage 28
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	347525	373682	5593263	protease,tRNA	Escherichia_phage(28.57%)	20	NA	NA
WP_153857326.1|347525_348143_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.7	2.2e-24
WP_153857327.1|348192_349053_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	38.1	3.4e-31
WP_153857328.1|349054_349672_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.8	8.0e-75
WP_153857329.1|349682_352136_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.1	1.2e-214
WP_135315910.1|352405_353698_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.6	4.0e-92
WP_153857330.1|353808_355152_-	AAA family ATPase	NA	G3MBE0	Bacillus_virus	39.4	9.9e-78
WP_135315908.1|355159_355771_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_153857331.1|355969_359554_-	cell division protein FtsK	NA	G1DAY1	Mycobacterium_virus	47.8	8.2e-87
WP_004928318.1|359674_360169_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_153857332.1|360836_361808_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	2.7e-61
WP_153857333.1|361885_362767_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012006110.1|362863_363481_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_153857334.1|363657_365424_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.7	8.3e-24
WP_153857335.1|365426_367163_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	32.1	5.7e-17
WP_153857336.1|367193_367919_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211347.1|368025_368244_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_153857337.1|368450_370730_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.7	7.4e-166
WP_004928347.1|370757_371078_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	8.2e-15
WP_012006105.1|371437_371659_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	3.0e-16
WP_153857338.1|371735_373682_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	38.9	1.5e-37
>prophage 29
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	387767	390770	5593263		Agrobacterium_phage(33.33%)	4	NA	NA
WP_153857348.1|387767_388604_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A223VZK2	Agrobacterium_phage	31.0	5.0e-11
WP_037426521.1|388751_389075_-	heavy metal-binding domain-containing protein	NA	M4STD1	Rhodobacter_phage	44.2	1.7e-15
WP_012006090.1|389236_389785_+	lipoprotein	NA	NA	NA	NA	NA
WP_071593000.1|390020_390770_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.4	4.0e-28
>prophage 30
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	394235	403140	5593263		Streptococcus_phage(25.0%)	10	NA	NA
WP_115182857.1|394235_395363_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	26.3	9.7e-26
WP_153857350.1|395431_395911_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_012006081.1|396107_396953_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_153857351.1|396949_397915_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_012006079.1|397940_399074_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	3.2e-29
WP_153857352.1|399209_400319_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_153857353.1|400727_401207_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_153857354.1|401368_402271_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	31.7	1.3e-36
WP_153857355.1|402328_402634_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_012006074.1|402876_403140_+	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	70.5	1.7e-26
>prophage 31
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	411917	412682	5593263		Escherichia_phage(100.0%)	1	NA	NA
WP_153857363.1|411917_412682_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	30.6	1.6e-19
>prophage 32
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	416470	419509	5593263		Stx2-converting_phage(50.0%)	2	NA	NA
WP_167519893.1|416470_417676_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	46.1	2.8e-95
WP_153857366.1|418141_419509_+	pyridoxal-phosphate dependent enzyme	NA	A0A1X9I5F1	Streptococcus_phage	36.5	6.4e-48
>prophage 33
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	427765	428665	5593263		Cellulophaga_phage(100.0%)	1	NA	NA
WP_012006049.1|427765_428665_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	84.2	1.5e-08
>prophage 34
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	434210	436305	5593263		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_012006042.1|434210_434825_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	30.1	1.3e-13
WP_012006041.1|434898_436305_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	29.6	7.0e-42
>prophage 35
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	444380	447436	5593263		Escherichia_phage(33.33%)	3	NA	NA
WP_153857386.1|444380_445262_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	40.2	9.5e-45
WP_153857387.1|445262_445796_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.9	8.0e-55
WP_153857388.1|446419_447436_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.5	3.3e-81
>prophage 36
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	450641	452408	5593263		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_153857390.1|450641_452408_-	type I secretion system permease/ATPase	NA	F2Y1V6	Organic_Lake_phycodnavirus	34.3	2.9e-16
>prophage 37
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	456399	457470	5593263		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_153857392.1|456399_457470_-	acyltransferase family protein	NA	A0A2H4JA46	uncultured_Caudovirales_phage	27.1	7.0e-10
>prophage 38
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	460518	466413	5593263		Bacillus_phage(33.33%)	5	NA	NA
WP_153857394.1|460518_461892_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.9	2.1e-30
WP_153857395.1|461952_463368_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.7	1.8e-53
WP_153857396.1|463383_464541_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_153857397.1|464584_465598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153857398.1|465621_466413_-	polysaccharide pyruvyl transferase family protein	NA	A0A1V0SAR6	Catovirus	32.4	1.5e-20
>prophage 39
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	475654	479746	5593263		Bacillus_phage(66.67%)	3	NA	NA
WP_153857406.1|475654_476548_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.3	3.1e-51
WP_153857407.1|476593_477493_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.3	1.5e-58
WP_153857408.1|478159_479746_+	CBS domain-containing protein	NA	A0A0R6PEZ3	Moraxella_phage	48.1	4.2e-43
>prophage 40
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	483214	488790	5593263	tRNA	Saccharomonospora_phage(33.33%)	5	NA	NA
WP_012006010.1|483214_483796_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_012006009.1|483922_484564_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.4	1.9e-34
WP_153857410.1|484808_485438_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_153857411.1|485489_486602_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_153857412.1|486762_488790_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.8	8.8e-54
>prophage 41
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	497113	498622	5593263		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_012005997.1|497113_498622_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	4.5e-10
>prophage 42
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	502527	506773	5593263		Cellulophaga_phage(50.0%)	4	NA	NA
WP_153857423.1|502527_503190_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	1.3e-54
WP_153857424.1|503437_504595_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_153857425.1|504701_505619_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012005990.1|505645_506773_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.7e-36
>prophage 43
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	512268	521264	5593263		Planktothrix_phage(25.0%)	8	NA	NA
WP_153857429.1|512268_514146_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.0	3.7e-14
WP_153857430.1|514165_515110_-	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_153857431.1|515454_515991_-	DUF924 family protein	NA	E3T4R4	Cafeteria_roenbergensis_virus	29.6	2.0e-13
WP_153857432.1|516084_517323_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_153857433.1|517325_518081_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_153857434.1|518137_519730_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.0e-57
WP_153857435.1|519921_520338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153857436.1|520361_521264_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	23.3	3.0e-14
>prophage 44
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	543529	553973	5593263	holin	Catovirus(25.0%)	9	NA	NA
WP_153857458.1|543529_545197_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.8	2.8e-53
WP_153857459.1|545267_546740_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_153857460.1|546760_547357_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_153857461.1|547770_549810_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.9	3.8e-20
WP_153857462.1|549881_550172_-	pentapeptide MXKDX repeat protein	NA	NA	NA	NA	NA
WP_153857463.1|550231_551020_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_153857464.1|551030_551642_-	cytochrome B	NA	NA	NA	NA	NA
WP_153857465.1|551789_552503_+	response regulator	NA	W8CYM9	Bacillus_phage	37.2	1.0e-33
WP_153860829.1|552506_553973_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	31.0	2.8e-17
>prophage 45
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	564263	571757	5593263		Escherichia_phage(80.0%)	10	NA	NA
WP_153857474.1|564263_564935_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.9	4.1e-32
WP_153857475.1|565075_565702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153860830.1|565716_566322_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_153857476.1|566314_567082_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_153857477.1|567206_567692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153857478.1|567675_567876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153857479.1|567907_568672_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	62.1	1.5e-78
WP_153857481.1|568951_569866_+	NAD-binding protein	NA	A0A077SLF7	Escherichia_phage	72.8	1.1e-112
WP_153857482.1|569862_571128_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	65.5	1.8e-145
WP_153857483.1|571124_571757_+	aldolase	NA	A0A077SK32	Escherichia_phage	77.1	4.2e-87
>prophage 46
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	576664	586434	5593263		Enterobacteria_phage(25.0%)	9	NA	NA
WP_012005917.1|576664_577183_-	outer membrane protein OmpX	NA	K7PJP9	Enterobacteria_phage	32.8	1.9e-16
WP_153857489.1|577581_578469_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_153857490.1|578615_579083_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_012005914.1|579445_579949_+	DNA starvation/stationary phase protection protein Dps	NA	A0A2K9VDB4	Lactobacillus_phage	25.0	4.5e-07
WP_046374121.1|580484_581228_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_012005911.1|581333_581993_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_012005910.1|581989_582712_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	1.1e-35
WP_153857491.1|582866_585083_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
WP_153857492.1|585129_586434_-	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.2	1.8e-15
>prophage 47
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	604552	609269	5593263		Bacillus_phage(50.0%)	4	NA	NA
WP_153857504.1|604552_606751_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	2.0e-43
WP_153857505.1|606765_607200_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_153860832.1|607204_607522_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_153857506.1|608171_609269_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	53.5	8.9e-109
>prophage 48
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	612547	614002	5593263		Mycobacterium_phage(100.0%)	1	NA	NA
WP_153857511.1|612547_614002_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	26.6	1.4e-13
>prophage 49
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	617747	618683	5593263		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_153857515.1|617747_618683_-	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.0	4.6e-13
>prophage 50
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	643906	645405	5593263		Staphylococcus_phage(50.0%)	2	NA	NA
WP_153857538.1|643906_644605_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	2.2e-12
WP_153860835.1|644613_645405_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.0	1.2e-11
>prophage 51
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	658805	661067	5593263		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_153860836.1|658805_660446_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.5	2.7e-08
WP_041418497.1|660602_661067_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	52.0	9.1e-39
>prophage 52
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	664166	665000	5593263		Pithovirus(100.0%)	1	NA	NA
WP_012005843.1|664166_665000_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.0	3.7e-14
>prophage 53
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	671201	672351	5593263	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_137231231.1|671201_672351_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	62.4	5.0e-94
>prophage 54
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	676389	677136	5593263		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_153857556.1|676389_677136_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.2	8.6e-15
>prophage 55
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	684190	688314	5593263		Erwinia_phage(66.67%)	6	NA	NA
WP_153857565.1|684190_685216_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	23.4	9.7e-09
WP_012005829.1|685208_685877_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_153860838.1|685897_686716_+	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_153857566.1|686773_687418_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153857567.1|687593_687851_+	DUF1471 domain-containing protein	NA	A0A1B2IAF4	Erwinia_phage	46.4	1.9e-06
WP_153857568.1|688056_688314_+	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	49.1	8.6e-07
>prophage 56
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	698353	700817	5593263		Escherichia_phage(50.0%)	4	NA	NA
WP_153857578.1|698353_698989_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	47.6	8.6e-48
WP_153857579.1|698985_699282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153857580.1|699313_700045_-	solute-binding protein	NA	NA	NA	NA	NA
WP_153857581.1|700037_700817_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.2	7.9e-11
>prophage 57
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	717680	718223	5593263		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_153857595.1|717680_718223_+	GNAT family N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	43.6	1.4e-27
>prophage 58
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	738411	739542	5593263	transposase	Phage_Gifsy-1(100.0%)	1	NA	NA
WP_153857614.1|738411_739542_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	88.0	2.3e-192
>prophage 59
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	742787	745460	5593263	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_167519899.1|742787_743462_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	37.7	3.6e-12
WP_000631725.1|743458_743806_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_153857617.1|743825_745460_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.9	1.8e-142
>prophage 60
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	757756	758716	5593263		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_153857629.1|757756_758716_-	D-2-hydroxyacid dehydrogenase family protein	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	28.1	9.4e-14
>prophage 61
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	762840	767952	5593263		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	4	NA	NA
WP_153857634.1|762840_764211_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.3	7.8e-54
WP_153857635.1|764516_765206_+	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_153857636.1|765224_766211_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_153857637.1|766221_767952_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	1.5e-22
>prophage 62
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	774417	775335	5593263		Streptococcus_phage(100.0%)	1	NA	NA
WP_012005753.1|774417_775335_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	27.6	4.8e-23
>prophage 63
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	778855	779566	5593263		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_153857644.1|778855_779566_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.4	2.6e-16
>prophage 64
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	783414	784689	5593263		Klosneuvirus(100.0%)	1	NA	NA
WP_153857648.1|783414_784689_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.3	1.1e-20
>prophage 65
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	787807	791719	5593263		Planktothrix_phage(50.0%)	5	NA	NA
WP_153857652.1|787807_788875_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-22
WP_153857653.1|788875_789565_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_153857654.1|789561_790335_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012005736.1|790621_790765_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_153857655.1|790933_791719_-	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	27.2	5.2e-10
>prophage 66
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	797781	799254	5593263		Cedratvirus(100.0%)	1	NA	NA
WP_153857661.1|797781_799254_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	29.2	5.5e-13
>prophage 67
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	806252	813040	5593263		Edwardsiella_phage(25.0%)	5	NA	NA
WP_153857667.1|806252_807308_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	47.4	2.9e-80
WP_115183047.1|807512_808118_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_153857668.1|808114_811327_+	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	28.3	4.7e-33
WP_153857669.1|811326_812277_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	38.6	5.1e-12
WP_153857670.1|812314_813040_-	nicotinamide riboside transporter PnuC	NA	A0A2I7SAC7	Vibrio_phage	29.0	2.7e-21
>prophage 68
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	836902	837694	5593263		Kaumoebavirus(100.0%)	1	NA	NA
WP_153857679.1|836902_837694_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	29.4	1.5e-09
>prophage 69
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	844437	845868	5593263		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_153857685.1|844437_845868_-	deoxyribodipyrimidine photo-lyase	NA	F2Y1K1	Organic_Lake_phycodnavirus	31.8	1.8e-56
>prophage 70
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	849564	854993	5593263		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_153857687.1|849564_851634_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.0	4.4e-32
WP_153857688.1|851653_852223_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_153857689.1|852299_854993_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.7	2.0e-13
>prophage 71
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	870990	872655	5593263	tRNA	Escherichia_phage(100.0%)	1	NA	NA
WP_153857700.1|870990_872655_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	86.4	9.1e-291
>prophage 72
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	881125	882790	5593263		Mimivirus(100.0%)	1	NA	NA
WP_153857704.1|881125_882790_+	asparagine synthase B	NA	A0A1X9VNR2	Mimivirus	38.7	1.4e-84
>prophage 73
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	887196	888252	5593263		Pseudomonas_phage(100.0%)	1	NA	NA
WP_012005655.1|887196_888252_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.0	1.4e-47
>prophage 74
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	894126	894852	5593263		Planktothrix_phage(100.0%)	1	NA	NA
WP_012005648.1|894126_894852_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	7.1e-30
>prophage 75
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	897876	900459	5593263	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_153857712.1|897876_900459_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.8	1.1e-186
>prophage 76
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	906762	915934	5593263		Synechococcus_phage(16.67%)	11	NA	NA
WP_153857719.1|906762_907836_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	44.9	2.0e-12
WP_017891907.1|908014_909226_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	50.8	3.9e-105
WP_009636895.1|909337_909601_+	YbeD family protein	NA	NA	NA	NA	NA
WP_167519902.1|909735_910404_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_012005634.1|910396_911362_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_006324068.1|911457_911667_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_153857720.1|911886_912948_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.2	9.4e-15
WP_153857721.1|913181_913565_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	54.2	1.2e-23
WP_153857722.1|913866_914463_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153857723.1|914468_915659_+	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	27.4	2.3e-25
WP_002210315.1|915724_915934_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	5.9e-22
>prophage 77
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	920594	927994	5593263		Bacillus_virus(33.33%)	7	NA	NA
WP_167519973.1|920594_921347_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.2	6.9e-20
WP_153857728.1|921377_921887_-	VOC family protein	NA	NA	NA	NA	NA
WP_017891897.1|922053_922533_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_167519903.1|922670_922832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153857729.1|922837_924286_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.3	1.8e-16
WP_153857730.1|924778_925330_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_153857731.1|926038_927994_-	acyltransferase family protein	NA	A0A193GZ69	Enterobacter_phage	46.7	8.8e-67
>prophage 78
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	931848	977048	5593263	tail,lysis,head,terminase,holin,integrase,tRNA	Salmonella_phage(30.95%)	65	928142:928156	938307:938321
928142:928156	attL	ATCAGAAACTGACTG	NA	NA	NA	NA
WP_153857735.1|931848_933078_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A248SL35	Klebsiella_phage	32.5	7.0e-38
WP_153857736.1|933133_933397_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	34.5	6.3e-05
WP_153857737.1|933803_934415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153857738.1|934398_935484_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	32.7	9.6e-39
WP_153857739.1|935655_936483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153857740.1|936485_938543_-	hypothetical protein	NA	NA	NA	NA	NA
938307:938321	attR	ATCAGAAACTGACTG	NA	NA	NA	NA
WP_153857191.1|938658_938832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153857741.1|938869_939133_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_153857742.1|939133_940165_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_153857743.1|940206_940896_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	46.3	7.4e-29
WP_153857744.1|940888_941560_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	51.4	1.5e-55
WP_153857745.1|941556_942744_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	59.0	1.2e-119
WP_153860847.1|942743_943097_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	65.0	1.0e-37
WP_167519904.1|943096_943846_-	translation initiation factor IF-2	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	7.0e-81
WP_153857746.1|943847_944792_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	41.9	5.5e-75
WP_153857747.1|944823_945129_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	50.0	1.2e-20
WP_153860849.1|945115_945712_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	55.6	4.1e-52
WP_153857200.1|945711_947724_-	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	40.9	6.2e-124
WP_153857201.1|947713_947869_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	52.0	1.8e-07
WP_153857202.1|947901_948345_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	36.0	1.4e-17
WP_153857203.1|948355_948799_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	68.8	8.4e-50
WP_153857204.1|948808_950290_-	DUF3383 family protein	NA	A0A0P0I492	Acinetobacter_phage	50.2	4.7e-129
WP_153860820.1|950293_950734_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	56.5	2.0e-43
WP_153857205.1|950836_951229_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	66.2	3.1e-40
WP_153857206.1|951228_951735_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	40.0	1.7e-22
WP_153857207.1|951731_952142_-	DUF4054 domain-containing protein	NA	A0A2H4J1A6	uncultured_Caudovirales_phage	51.1	1.7e-28
WP_153857208.1|952110_952530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153857209.1|952572_953520_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	58.5	3.7e-103
WP_153857210.1|953530_954034_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	52.7	2.5e-34
WP_153857211.1|954044_955310_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	45.2	5.8e-80
WP_153857212.1|955318_955516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153860821.1|955566_956115_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.4	9.1e-46
WP_153857748.1|956170_957640_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	53.6	4.3e-151
WP_153857749.1|957856_959155_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4JCM3	uncultured_Caudovirales_phage	60.1	2.1e-141
WP_153857750.1|959166_959901_-	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	42.0	8.2e-10
WP_153857751.1|959936_960383_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	47.3	1.4e-20
WP_153857752.1|960379_960814_-	glycoside hydrolase family protein	NA	R9TMH8	Aeromonas_phage	55.9	1.8e-36
WP_153857753.1|960800_961148_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	69.0	4.9e-29
WP_153857754.1|961508_961787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153857755.1|961874_962306_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	68.3	1.1e-41
WP_153860850.1|962305_963196_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPA6	Escherichia_phage	56.2	2.4e-80
WP_153857756.1|963249_965127_-	AAA family ATPase	NA	Q5G8S8	Enterobacteria_phage	60.2	1.6e-230
WP_153857757.1|966169_966367_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	81.5	4.0e-20
WP_153857758.1|966438_966618_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_153857759.1|966670_966904_-	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	42.5	1.1e-08
WP_153857760.1|967034_967649_+	helix-turn-helix domain-containing protein	NA	Q76H56	Enterobacteria_phage	44.6	7.9e-14
WP_153857761.1|967911_968262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153857762.1|968278_968611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153857763.1|968610_968829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153857764.1|968828_969212_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	41.4	2.0e-15
WP_167519905.1|969296_969650_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_153857766.1|969666_969924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153857767.1|969920_970109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153857768.1|970105_970324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167519906.1|970313_970622_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153857770.1|970624_970843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153857771.1|970844_971651_+	DNA-binding protein	NA	B1GS65	Salmonella_phage	47.9	1.6e-19
WP_153860851.1|971683_972019_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	60.7	1.0e-28
WP_153857772.1|972015_972603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153857773.1|972708_972930_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	51.4	3.4e-12
WP_153857774.1|972926_973196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167519974.1|974062_974272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012005607.1|974503_975370_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.4	9.0e-32
WP_012005606.1|975380_975593_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_153857775.1|975662_977048_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.7	1.3e-43
>prophage 79
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	980457	981225	5593263		Tupanvirus(100.0%)	1	NA	NA
WP_153857779.1|980457_981225_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2K9L1R4	Tupanvirus	33.4	5.5e-49
>prophage 80
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	985496	989717	5593263	protease	Planktothrix_phage(50.0%)	5	NA	NA
WP_153857782.1|985496_986183_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	2.3e-30
WP_167519975.1|986153_986792_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_153857784.1|986817_987594_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_153857785.1|987674_988529_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_153857786.1|988565_989717_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	8.5e-86
>prophage 81
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1003648	1004797	5593263		Streptococcus_phage(100.0%)	1	NA	NA
WP_153857796.1|1003648_1004797_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.8	2.8e-49
>prophage 82
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1008338	1013903	5593263		uncultured_Mediterranean_phage(33.33%)	5	NA	NA
WP_167519907.1|1008338_1010204_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.0	2.8e-115
WP_012005576.1|1010339_1010945_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_012005575.1|1010944_1011274_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_153857801.1|1011315_1013268_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	37.4	4.7e-44
WP_017891861.1|1013351_1013903_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.5	5.0e-28
>prophage 83
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1026912	1027626	5593263		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_153857808.1|1026912_1027626_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.6	3.7e-15
>prophage 84
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1033957	1035934	5593263		Tetraselmis_virus(100.0%)	1	NA	NA
WP_153857812.1|1033957_1035934_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.4	3.3e-162
>prophage 85
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1040580	1044127	5593263		Bacillus_phage(100.0%)	2	NA	NA
WP_153857816.1|1040580_1042359_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.9	8.9e-42
WP_153857817.1|1042351_1044127_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	5.4e-47
>prophage 86
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1048677	1049376	5593263		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_153857819.1|1048677_1049376_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	69.0	2.3e-86
>prophage 87
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1052575	1057672	5593263	protease	Burkholderia_virus(25.0%)	4	NA	NA
WP_017891836.1|1052575_1052848_-	DNA-binding protein HU-beta	NA	A4JWM7	Burkholderia_virus	59.6	4.2e-20
WP_112347696.1|1053064_1055419_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	53.3	2.7e-227
WP_012005536.1|1055614_1056886_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.2	1.6e-130
WP_012005535.1|1057048_1057672_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	64.4	4.5e-65
>prophage 88
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1079566	1081266	5593263		Staphylococcus_phage(50.0%)	2	NA	NA
WP_012005513.1|1079566_1080037_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.0	7.1e-31
WP_153857835.1|1080156_1081266_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.1	3.6e-49
>prophage 89
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1086644	1094285	5593263	tRNA	uncultured_Mediterranean_phage(75.0%)	7	NA	NA
WP_153857839.1|1086644_1087379_-	tetrathionate reductase subunit TtrB	NA	A0A077SL61	Escherichia_phage	34.1	1.1e-22
WP_153857840.1|1087532_1089290_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_153857841.1|1089264_1089873_+	response regulator	NA	NA	NA	NA	NA
WP_012005505.1|1089942_1090911_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.3	4.5e-40
WP_153857842.1|1090921_1092769_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_012005503.1|1092794_1093127_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	34.1	7.5e-11
WP_012005502.1|1093160_1094285_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.8	1.3e-91
>prophage 90
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1106349	1115354	5593263		Bacillus_phage(50.0%)	6	NA	NA
WP_153857850.1|1106349_1107456_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	48.5	6.6e-96
WP_153857851.1|1107663_1108602_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_153857852.1|1108618_1109935_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	32.1	2.9e-29
WP_012005482.1|1109959_1110649_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	37.6	9.7e-37
WP_153857853.1|1110873_1112106_+	exonuclease subunit SbcD	NA	NA	NA	NA	NA
WP_153857854.1|1112102_1115354_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	27.7	8.7e-11
>prophage 91
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1122788	1128063	5593263		Staphylococcus_phage(50.0%)	2	NA	NA
WP_153857862.1|1122788_1124309_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	5.9e-18
WP_012005468.1|1127151_1128063_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	64.6	6.0e-103
>prophage 92
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1153417	1154200	5593263		Escherichia_phage(100.0%)	1	NA	NA
WP_153857887.1|1153417_1154200_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.0	1.5e-17
>prophage 93
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1157521	1159198	5593263		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_153857891.1|1157521_1159198_+	alpha-keto acid decarboxylase family protein	NA	E5EQ70	Micromonas_sp._RCC1109_virus	20.3	1.1e-14
>prophage 94
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1180747	1183843	5593263		Tupanvirus(100.0%)	1	NA	NA
WP_153857904.1|1180747_1183843_+	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	23.4	3.7e-27
>prophage 95
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1189963	1190488	5593263		Escherichia_phage(100.0%)	1	NA	NA
WP_153860856.1|1189963_1190488_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.8	6.5e-17
>prophage 96
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1197696	1200063	5593263		Streptococcus_phage(100.0%)	2	NA	NA
WP_167519909.1|1197696_1198950_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	1.1e-97
WP_012005410.1|1198959_1200063_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.9	2.0e-60
>prophage 97
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1215721	1216303	5593263		Caulobacter_phage(100.0%)	1	NA	NA
WP_004949058.1|1215721_1216303_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	2.8e-13
>prophage 98
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1226880	1228233	5593263		Enterobacteria_phage(100.0%)	1	NA	NA
WP_153857931.1|1226880_1228233_-	purine/pyrimidine permease	NA	Q9KX94	Enterobacteria_phage	30.1	5.0e-29
>prophage 99
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1231639	1232383	5593263		Planktothrix_phage(100.0%)	1	NA	NA
WP_012005380.1|1231639_1232383_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.5	4.9e-34
>prophage 100
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1253991	1258248	5593263		Bradyrhizobium_phage(33.33%)	5	NA	NA
WP_153857953.1|1253991_1254732_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.1	2.8e-42
WP_153857954.1|1254804_1255272_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	8.8e-50
WP_012005355.1|1255268_1255988_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_153857955.1|1256032_1256788_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_153857956.1|1256820_1258248_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	31.8	6.1e-09
>prophage 101
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1261571	1262375	5593263		Klosneuvirus(100.0%)	1	NA	NA
WP_153857960.1|1261571_1262375_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SKP9	Klosneuvirus	30.1	1.3e-29
>prophage 102
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1282792	1285366	5593263		Enterobacteria_phage(100.0%)	1	NA	NA
WP_153857975.1|1282792_1285366_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.7	2.6e-127
>prophage 103
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1291337	1294225	5593263		Escherichia_coli_O157_typing_phage(50.0%)	3	NA	NA
WP_153857979.1|1291337_1292411_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	2.4e-90
WP_153857980.1|1292995_1293760_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_153857981.1|1294006_1294225_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	65.3	1.6e-22
>prophage 104
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1304549	1309982	5593263	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_002209449.1|1304549_1304735_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	3.8e-12
WP_153857984.1|1304987_1307615_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.2	2.4e-80
WP_153857985.1|1307748_1308255_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_012005289.1|1308319_1309381_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.6	6.3e-112
WP_153857986.1|1309493_1309982_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.7	2.0e-28
>prophage 105
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1317371	1323739	5593263		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_012005281.1|1317371_1319927_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	24.3	8.0e-28
WP_012005279.1|1321045_1322032_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	38.6	1.0e-07
WP_012005278.1|1322357_1322984_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	1.2e-33
WP_153857992.1|1322977_1323739_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.2	6.0e-56
>prophage 106
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1328571	1331825	5593263		Bacillus_virus(33.33%)	4	NA	NA
WP_153857996.1|1328571_1329294_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.8	1.5e-16
WP_012005269.1|1329346_1329664_-	DUF3561 family protein	NA	NA	NA	NA	NA
WP_153857997.1|1329748_1330378_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	41.0	7.5e-28
WP_167519910.1|1330379_1331825_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.5	1.6e-33
>prophage 107
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1340930	1341602	5593263		Vibrio_phage(100.0%)	1	NA	NA
WP_153858001.1|1340930_1341602_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	35.0	9.5e-13
>prophage 108
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1345326	1346862	5593263		Catovirus(100.0%)	1	NA	NA
WP_153858003.1|1345326_1346862_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.7	1.4e-88
>prophage 109
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1350291	1357263	5593263	holin	Bacillus_virus(20.0%)	7	NA	NA
WP_012005248.1|1350291_1351149_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	1.6e-28
WP_153858006.1|1351159_1352683_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	33.2	6.0e-63
WP_153858007.1|1352719_1353910_-	methionine gamma-lyase	NA	A0A0B5JD48	Pandoravirus	29.1	5.1e-17
WP_153858008.1|1353956_1354328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153858009.1|1354338_1355529_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_112362966.1|1356098_1356395_-|holin	holin	holin	E7C9S8	Salmonella_phage	52.4	2.7e-20
WP_153858011.1|1356876_1357263_-	M15 family peptidase	NA	A9DET4	Yersinia_phage	54.5	3.4e-31
>prophage 110
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1362212	1365227	5593263		Streptococcus_phage(50.0%)	2	NA	NA
WP_012005243.1|1362212_1363508_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.2	3.7e-130
WP_153858016.1|1363589_1365227_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.2	4.3e-152
>prophage 111
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1369211	1373432	5593263	protease	Hokovirus(50.0%)	2	NA	NA
WP_153858019.1|1369211_1371932_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	28.9	3.9e-49
WP_153858020.1|1371998_1373432_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.8	4.2e-26
>prophage 112
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1377667	1378012	5593263		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_012005231.1|1377667_1378012_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.0	4.5e-27
>prophage 113
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1386383	1387427	5593263		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_012005223.1|1386383_1387427_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.9	2.0e-102
>prophage 114
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1414796	1422515	5593263		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
WP_153858048.1|1414796_1416515_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.5	2.3e-58
WP_153858049.1|1416832_1418641_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	23.3	9.4e-39
WP_153860863.1|1419103_1420051_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_112364390.1|1420767_1420851_+	leu operon leader peptide	NA	NA	NA	NA	NA
WP_017891594.1|1420940_1422515_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	27.9	2.6e-08
>prophage 115
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1433327	1436043	5593263		Bacillus_virus(50.0%)	3	NA	NA
WP_153858057.1|1433327_1434032_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	33.5	5.3e-22
WP_100220746.1|1434135_1434237_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_153858058.1|1434348_1436043_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.2	1.0e-58
>prophage 116
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1444104	1451333	5593263	integrase	Escherichia_phage(33.33%)	4	1437906:1437921	1452555:1452570
1437906:1437921	attL	ACGCTGCAGCAGTTCC	NA	NA	NA	NA
WP_153858065.1|1444104_1444683_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	48.6	3.6e-45
WP_153858066.1|1444842_1445613_-	DedA family protein	NA	NA	NA	NA	NA
WP_153858067.1|1445797_1448161_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	26.3	1.5e-33
WP_153858068.1|1448426_1451333_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	38.6	1.8e-23
1452555:1452570	attR	GGAACTGCTGCAGCGT	NA	NA	NA	NA
>prophage 117
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1459053	1465162	5593263	transposase	Salmonella_phage(33.33%)	6	NA	NA
WP_153858071.1|1459053_1459905_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	38.2	1.7e-06
WP_153858072.1|1459944_1461834_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_012005171.1|1462027_1462510_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	45.8	7.5e-28
WP_167519913.1|1462652_1463117_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_153860865.1|1463113_1463914_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_137231231.1|1464012_1465162_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	62.4	5.0e-94
>prophage 118
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1471879	1473028	5593263		Halovirus(100.0%)	1	NA	NA
WP_099063244.1|1471879_1473028_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.3	5.2e-51
>prophage 119
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1486118	1496275	5593263	tRNA	Bodo_saltans_virus(25.0%)	9	NA	NA
WP_153858084.1|1486118_1488935_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.6	6.9e-65
WP_012005148.1|1488967_1489906_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_110605907.1|1489913_1490000_-	DUF2575 family protein	NA	NA	NA	NA	NA
WP_167519914.1|1490039_1490180_-	DUF2575 family protein	NA	NA	NA	NA	NA
WP_012005147.1|1490296_1490557_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_004950031.1|1490625_1491525_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_041418458.1|1491724_1492891_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.4	7.5e-90
WP_012005145.1|1493127_1494255_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	31.5	1.3e-25
WP_012005144.1|1494361_1496275_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	47.0	5.1e-144
>prophage 120
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1499421	1500375	5593263		Cyanophage(100.0%)	1	NA	NA
WP_135315054.1|1499421_1500375_-	transaldolase	NA	A0A127KNC6	Cyanophage	32.7	1.8e-12
>prophage 121
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1513642	1523981	5593263		Bacillus_phage(50.0%)	8	NA	NA
WP_153858097.1|1513642_1515571_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.6	1.8e-11
WP_153858098.1|1516317_1516932_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_153858099.1|1516928_1518176_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.3	1.2e-13
WP_153858100.1|1518212_1518710_+	OmpA family protein	NA	NA	NA	NA	NA
WP_153858101.1|1518975_1520643_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.8	1.1e-38
WP_153858102.1|1520673_1521585_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153858103.1|1521683_1522685_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012005121.1|1522721_1523981_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	46.3	9.0e-89
>prophage 122
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1530887	1532210	5593263		Geobacillus_virus(100.0%)	1	NA	NA
WP_099063152.1|1530887_1532210_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	38.9	4.5e-75
>prophage 123
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1537058	1540257	5593263		Salmonella_phage(50.0%)	3	NA	NA
WP_004857650.1|1537058_1537220_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	69.8	1.7e-13
WP_153858108.1|1537377_1537992_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_012005105.1|1538667_1540257_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	26.1	3.7e-31
>prophage 124
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1553833	1554574	5593263		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_153858122.1|1553833_1554574_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.1	1.1e-09
>prophage 125
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1574403	1575210	5593263		NY_014_poxvirus(100.0%)	1	NA	NA
WP_153858137.1|1574403_1575210_+	alpha/beta fold hydrolase	NA	A0A223FN69	NY_014_poxvirus	29.4	4.5e-25
>prophage 126
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1582762	1584013	5593263		Pteropox_virus(100.0%)	1	NA	NA
WP_153858145.1|1582762_1584013_-	phospholipase	NA	A0A1B1MR92	Pteropox_virus	23.7	4.1e-25
>prophage 127
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1588410	1665597	5593263	transposase,tail,head,terminase,portal,holin,integrase,capsid,tRNA	Cronobacter_phage(60.61%)	83	1589743:1589767	1620448:1620472
WP_153858148.1|1588410_1589367_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.7	3.7e-71
1589743:1589767	attL	AAAAAAGACGCCCGCAGGCGTCTTG	NA	NA	NA	NA
WP_142816379.1|1589989_1590145_-	Hok/Gef family protein	NA	A0A1I9LJU7	Stx_converting_phage	57.1	1.5e-06
WP_153858149.1|1591307_1593032_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	60.3	1.6e-173
WP_153858150.1|1593040_1593586_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	56.6	1.2e-45
WP_153858151.1|1593557_1594283_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	44.4	5.8e-48
WP_153858152.1|1594272_1594791_-|tail	tail fiber assembly protein	tail	Q37843	Escherichia_phage	61.5	6.6e-54
WP_153858153.1|1594793_1596854_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	62.3	3.0e-102
WP_153858154.1|1596863_1597454_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	68.4	4.1e-76
WP_153858155.1|1597446_1598631_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	70.5	1.5e-154
WP_153858156.1|1598623_1598959_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	59.6	8.6e-31
WP_153858157.1|1598955_1601034_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	43.8	1.7e-153
WP_142814694.1|1601035_1601215_-	hypothetical protein	NA	A5X9I8	Aeromonas_virus	63.0	7.1e-08
WP_153858158.1|1601223_1601499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153858159.1|1601601_1601985_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	40.5	1.9e-13
WP_153858160.1|1601984_1602326_-	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	77.2	1.2e-40
WP_153858161.1|1602322_1602613_-|holin	holin	holin	C7BGD7	Burkholderia_phage	45.3	1.0e-11
WP_153858162.1|1602617_1603073_-	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	53.0	5.2e-39
WP_153858163.1|1603075_1604215_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	61.2	2.8e-129
WP_153858164.1|1604217_1604916_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.7	2.7e-71
WP_153858165.1|1604909_1605386_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	38.0	9.7e-28
WP_153858166.1|1605382_1605856_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	58.9	2.3e-37
WP_153858167.1|1605965_1606670_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	58.2	8.9e-70
WP_153858168.1|1606672_1607704_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	53.7	7.3e-97
WP_153858169.1|1607732_1608809_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	41.5	7.8e-33
WP_153858170.1|1608986_1610792_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	54.8	1.2e-187
WP_153858171.1|1610788_1611862_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	62.1	1.1e-122
WP_153858172.1|1611918_1612185_+	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	59.5	5.0e-26
WP_167519915.1|1612278_1614687_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	47.4	9.1e-199
WP_153858174.1|1614782_1615136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153858175.1|1615132_1615453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153858176.1|1615455_1615668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153858177.1|1615657_1616278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153858178.1|1616285_1616621_-	DUF5347 family protein	NA	NA	NA	NA	NA
WP_153858179.1|1616966_1617449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153858180.1|1617456_1617678_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_153858181.1|1617674_1617929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153858182.1|1617897_1618323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153858183.1|1618319_1618568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153858184.1|1618564_1618903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153858185.1|1619001_1619310_+	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	51.1	5.3e-19
WP_153858186.1|1619376_1620378_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	55.0	1.5e-107
WP_153858187.1|1620490_1621411_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
1620448:1620472	attR	AAAAAAGACGCCCGCAGGCGTCTTG	NA	NA	NA	NA
WP_153858188.1|1621577_1622456_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_112363093.1|1622542_1623397_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_153858189.1|1623417_1624188_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_115183346.1|1624200_1625592_-	GntP family permease	NA	NA	NA	NA	NA
WP_153858190.1|1625667_1626591_-	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_153860870.1|1626608_1627790_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_012005046.1|1627813_1628467_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_153858191.1|1628477_1629176_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_017891493.1|1629345_1630248_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153858192.1|1631349_1631742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153858193.1|1632087_1633164_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_153858194.1|1633332_1633668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153858195.1|1633861_1635235_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_153858196.1|1635298_1636009_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_153858197.1|1636249_1638430_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_004953088.1|1638496_1638700_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_153858198.1|1638712_1639675_+	GTPase	NA	NA	NA	NA	NA
WP_153858199.1|1639786_1640050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153858200.1|1640046_1640778_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_153858201.1|1640809_1641832_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	29.6	6.5e-29
WP_153858202.1|1642118_1643561_+	PTS cellobiose/arbutin/salicin transporter subunit IIBC	NA	NA	NA	NA	NA
WP_153858203.1|1643577_1645008_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_153858204.1|1645089_1645509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153858205.1|1645511_1646069_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_153858206.1|1646149_1646554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153858207.1|1646789_1647041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153858208.1|1646961_1647270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153858209.1|1647524_1648643_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_017891471.1|1648775_1649747_+	5'-nucleotidase	NA	NA	NA	NA	NA
WP_153858210.1|1649843_1651166_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_112347975.1|1651170_1651467_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_153858211.1|1651674_1652310_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_153858212.1|1652565_1653642_-	Fic family protein	NA	NA	NA	NA	NA
WP_012005020.1|1654519_1655590_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_153858213.1|1655589_1656684_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_037424420.1|1656964_1658476_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.4	6.0e-47
WP_012005017.1|1658560_1659010_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_012005016.1|1659023_1661900_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.1	1.8e-140
WP_026142174.1|1662096_1662600_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_153858214.1|1662647_1663637_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_153858215.1|1663989_1665597_+|holin	glucose-methanol-choline oxidoreductase	holin	A0A1V0S9J5	Catovirus	30.1	8.0e-58
>prophage 128
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1679978	1684097	5593263		Hokovirus(50.0%)	4	NA	NA
WP_153858226.1|1679978_1680776_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	28.0	3.0e-13
WP_153858227.1|1680897_1681854_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_153858228.1|1681853_1682858_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_012005001.1|1683161_1684097_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	5.0e-52
>prophage 129
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1693101	1695810	5593263		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_153858235.1|1693101_1695810_-	magnesium-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.0	5.3e-38
>prophage 130
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1702962	1705626	5593263		Vibrio_phage(50.0%)	2	NA	NA
WP_153858240.1|1702962_1705101_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.9	1.1e-269
WP_153858241.1|1705161_1705626_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	54.6	3.0e-50
>prophage 131
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1710674	1712184	5593263		Bacillus_virus(50.0%)	2	NA	NA
WP_153858246.1|1710674_1711463_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.0	2.2e-13
WP_012004974.1|1711479_1712184_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.6	3.1e-06
>prophage 132
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1720802	1721111	5593263		Adoxophyes_orana_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_153858255.1|1720802_1721111_+	GIY-YIG nuclease family protein	NA	B6S2G7	Adoxophyes_orana_nucleopolyhedrovirus	45.1	4.1e-11
>prophage 133
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1731658	1733620	5593263		Klosneuvirus(100.0%)	1	NA	NA
WP_153858265.1|1731658_1733620_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A1V0SIR5	Klosneuvirus	34.2	2.6e-50
>prophage 134
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1739008	1741696	5593263		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_153858266.1|1739008_1741696_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.1	4.6e-26
>prophage 135
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1747079	1749011	5593263	protease	Micromonas_pusilla_virus(100.0%)	1	NA	NA
WP_012004941.1|1747079_1749011_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E6G3	Micromonas_pusilla_virus	43.1	2.8e-118
>prophage 136
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1752424	1754145	5593263		Bacillus_phage(100.0%)	2	NA	NA
WP_012004937.1|1752424_1753087_+	two-component system response regulator PmrA	NA	W8CYM9	Bacillus_phage	36.0	8.4e-30
WP_153858270.1|1753083_1754145_+	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	22.6	4.8e-11
>prophage 137
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1757296	1759111	5593263		Indivirus(33.33%)	3	NA	NA
WP_012004932.1|1757296_1758268_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	26.8	1.0e-07
WP_153858273.1|1758317_1758668_-	putative DNA-binding transcriptional regulator	NA	A0A0C4UQZ2	Shigella_phage	47.5	6.3e-08
WP_153858274.1|1758850_1759111_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	66.7	1.4e-17
>prophage 138
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1763851	1767234	5593263		uncultured_Caudovirales_phage(66.67%)	3	NA	NA
WP_012004925.1|1763851_1764856_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	43.8	1.8e-71
WP_153858278.1|1764893_1766447_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	53.8	3.5e-10
WP_153858279.1|1766703_1767234_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	4.6e-55
>prophage 139
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1785526	1788199	5593263	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_167519899.1|1785526_1786201_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	37.7	3.6e-12
WP_000631725.1|1786197_1786545_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_153857617.1|1786564_1788199_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.9	1.8e-142
>prophage 140
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1793505	1807158	5593263	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
WP_153858292.1|1793505_1795992_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	2.3e-67
WP_012004900.1|1796051_1796477_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_012004899.1|1796709_1798008_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	36.4	5.3e-68
WP_017891360.1|1798105_1798306_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_135314827.1|1798368_1799376_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_153858293.1|1799379_1800639_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.0	3.6e-05
WP_012004895.1|1800707_1801988_-	GTPase HflX	NA	NA	NA	NA	NA
WP_153858294.1|1802083_1802392_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_153858295.1|1802506_1803448_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_153858296.1|1803440_1805333_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.7	4.8e-62
WP_153858297.1|1805355_1807158_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	4.1e-18
>prophage 141
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1811150	1811696	5593263		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_061807516.1|1811150_1811696_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	39.9	3.8e-28
>prophage 142
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1818695	1820492	5593263		Lactobacillus_phage(100.0%)	1	NA	NA
WP_153858301.1|1818695_1820492_+	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.9	9.0e-18
>prophage 143
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1825331	1827316	5593263		Vibrio_phage(50.0%)	2	NA	NA
WP_006322060.1|1825331_1826978_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	67.7	7.9e-186
WP_153858305.1|1827022_1827316_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	35.8	1.4e-08
>prophage 144
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1839719	1847904	5593263		Synechococcus_phage(33.33%)	5	NA	NA
WP_153858313.1|1839719_1841321_-	tryptophan 7-halogenase	NA	A0A1Z1LWL6	Synechococcus_phage	34.4	4.1e-62
WP_153858314.1|1842064_1842811_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_153858315.1|1842976_1843726_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	34.7	2.7e-08
WP_153858316.1|1843838_1845155_-	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_153858317.1|1845945_1847904_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	38.6	4.2e-85
>prophage 145
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1857256	1861576	5593263	tRNA	Pandoravirus(33.33%)	6	NA	NA
WP_153858319.1|1857256_1857826_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	S4VW33	Pandoravirus	30.1	8.3e-10
WP_099065716.1|1857833_1858379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012147203.1|1858404_1858878_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_153858320.1|1858849_1859971_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_012147205.1|1860104_1860614_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	8.8e-19
WP_153858321.1|1860631_1861576_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	3.2e-06
>prophage 146
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1880861	1886467	5593263		Klosneuvirus(33.33%)	7	NA	NA
WP_012147227.1|1880861_1882046_-	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	25.1	1.3e-12
WP_153858324.1|1882116_1884231_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.8	6.8e-57
WP_004951199.1|1884328_1884799_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_004930426.1|1884895_1885270_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_153858325.1|1885412_1885700_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_153858326.1|1885709_1886069_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_153858327.1|1886077_1886467_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	46.8	8.8e-19
>prophage 147
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1892514	1896888	5593263		Tupanvirus(50.0%)	4	NA	NA
WP_153858331.1|1892514_1894428_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.3	2.7e-76
WP_153858332.1|1894439_1895288_-	taurine dioxygenase	NA	NA	NA	NA	NA
WP_153858333.1|1895284_1896124_-	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
WP_153858334.1|1896120_1896888_-	taurine ABC transporter ATP-binding subunit	NA	G3M9Y6	Bacillus_virus	36.5	6.8e-39
>prophage 148
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1909943	1918887	5593263		environmental_Halophage(16.67%)	7	NA	NA
WP_153860877.1|1909943_1912019_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	71.9	1.0e-52
WP_153858342.1|1912055_1913273_-	acetylornithine/succinyldiaminopimelate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.9	1.1e-30
WP_012147260.1|1913404_1913980_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.6	3.0e-68
WP_153858343.1|1914078_1915605_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	42.7	3.9e-78
WP_153858344.1|1915745_1916471_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_153858345.1|1916470_1918156_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	71.0	3.0e-217
WP_153858346.1|1918317_1918887_-	peptidylprolyl isomerase A	NA	A0A1V0S9I2	Catovirus	31.0	3.5e-08
>prophage 149
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1923562	1924714	5593263		Brochothrix_phage(100.0%)	1	NA	NA
WP_153858348.1|1923562_1924714_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.2	4.3e-29
>prophage 150
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1933985	1934798	5593263		Vibrio_phage(100.0%)	1	NA	NA
WP_153858355.1|1933985_1934798_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.6	4.0e-66
>prophage 151
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1938295	1939537	5593263		Enterobacteria_phage(100.0%)	1	NA	NA
WP_153858358.1|1938295_1939537_-	DNA uptake porin HofQ	NA	D0U174	Enterobacteria_phage	24.1	2.1e-13
>prophage 152
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1949945	1954543	5593263		Bacillus_phage(66.67%)	5	NA	NA
WP_012147293.1|1949945_1951565_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.1	1.0e-137
WP_017894292.1|1951691_1951955_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_153858366.1|1951951_1952431_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_153858367.1|1952447_1953827_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.0	3.8e-08
WP_004709363.1|1953823_1954543_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 153
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1966445	1968851	5593263		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_153858376.1|1966445_1968851_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.1e-13
>prophage 154
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	1976681	1979129	5593263		Dickeya_phage(100.0%)	1	NA	NA
WP_153858381.1|1976681_1979129_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	8.0e-33
>prophage 155
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2010512	2011190	5593263		Bacillus_virus(100.0%)	1	NA	NA
WP_153858401.1|2010512_2011190_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	32.9	2.7e-23
>prophage 156
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2032976	2034476	5593263		Bacillus_virus(100.0%)	1	NA	NA
WP_153858419.1|2032976_2034476_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	27.7	1.3e-14
>prophage 157
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2041520	2043563	5593263		Indivirus(100.0%)	1	NA	NA
WP_153858426.1|2041520_2043563_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.8	2.4e-43
>prophage 158
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2049388	2055739	5593263		Ectocarpus_siliculosus_virus(50.0%)	3	NA	NA
WP_153858431.1|2049388_2051173_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.8	7.6e-25
WP_153858432.1|2051162_2052014_-	response regulator	NA	NA	NA	NA	NA
WP_153858433.1|2052637_2055739_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A127AWU5	Bacillus_phage	27.5	7.3e-07
>prophage 159
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2062588	2064583	5593263		Bacillus_phage(100.0%)	1	NA	NA
WP_153858435.1|2062588_2064583_+	cyclic di-GMP phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	31.8	3.1e-11
>prophage 160
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2083659	2085306	5593263		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_153858448.1|2083659_2085306_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	32.3	4.8e-66
>prophage 161
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2092103	2093618	5593263		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_153858453.1|2092103_2093618_-	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.5	9.3e-08
>prophage 162
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2101723	2103595	5593263		Acinetobacter_phage(100.0%)	1	NA	NA
WP_153858456.1|2101723_2103595_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	28.7	3.0e-08
>prophage 163
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2108826	2111507	5593263		Synechococcus_phage(50.0%)	3	NA	NA
WP_153858459.1|2108826_2109558_+	redoxin family protein	NA	A0A1D8KSL1	Synechococcus_phage	57.9	6.4e-47
WP_153858460.1|2109635_2111084_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_153858461.1|2111246_2111507_+	toxin HicA	NA	A0A2P1A0R7	Gordonia_phage	65.0	3.6e-08
>prophage 164
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2131736	2140240	5593263		Erwinia_phage(33.33%)	8	NA	NA
WP_153858473.1|2131736_2133071_+	HslU--HslV peptidase ATPase subunit	NA	A0A173GFL6	Erwinia_phage	29.3	2.1e-43
WP_153858474.1|2133164_2134082_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_012147469.1|2134162_2134648_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_012147470.1|2134705_2134945_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_153858475.1|2135484_2136330_+	MIP family channel protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.9	5.2e-16
WP_130382914.1|2136373_2137882_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_017894418.1|2138012_2139023_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_153858476.1|2139055_2140240_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	25.7	5.4e-11
>prophage 165
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2148135	2150204	5593263		Feldmannia_irregularis_virus(50.0%)	2	NA	NA
WP_004953234.1|2148135_2148834_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	9.0e-06
WP_017894427.1|2148830_2150204_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.8	1.4e-18
>prophage 166
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2154103	2162419	5593263		Rhizobium_phage(20.0%)	8	NA	NA
WP_012147490.1|2154103_2154352_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	50.7	3.2e-14
WP_012147491.1|2154380_2154815_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_153858485.1|2155114_2156659_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_153858486.1|2156668_2158003_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	36.7	2.8e-08
WP_153858487.1|2158005_2158968_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_153858488.1|2159017_2160043_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	80.8	2.3e-18
WP_012147497.1|2160052_2161249_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.0	4.1e-35
WP_153858489.1|2161489_2162419_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	34.5	1.2e-29
>prophage 167
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2166885	2167872	5593263		Catovirus(100.0%)	1	NA	NA
WP_153858494.1|2166885_2167872_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	33.7	6.7e-07
>prophage 168
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2176673	2181366	5593263		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_012147511.1|2176673_2177159_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	45.1	5.8e-28
WP_012147512.1|2177159_2177969_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	29.6	3.8e-24
WP_004392084.1|2178169_2178337_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_004953342.1|2178348_2178585_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_153858503.1|2178848_2179532_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_167470802.1|2179712_2180930_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.7	5.1e-41
WP_012147515.1|2180907_2181366_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.8	1.9e-49
>prophage 169
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2188051	2193154	5593263		Pseudomonas_phage(33.33%)	4	NA	NA
WP_167519981.1|2188051_2189758_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	21.5	1.4e-23
WP_012147536.1|2190069_2190693_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	7.5e-20
WP_004953385.1|2190747_2191023_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_153858506.1|2191042_2193154_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	2.1e-10
>prophage 170
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2197444	2198845	5593263		environmental_Halophage(100.0%)	1	NA	NA
WP_153858510.1|2197444_2198845_+	purine/pyrimidine permease	NA	H9YQ34	environmental_Halophage	83.6	1.4e-58
>prophage 171
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2202281	2203431	5593263	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_137231231.1|2202281_2203431_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	62.4	5.0e-94
>prophage 172
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2207626	2213885	5593263		Erysipelothrix_phage(33.33%)	4	NA	NA
WP_012147548.1|2207626_2209450_-	ribosome-dependent GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	43.1	3.0e-21
WP_012147549.1|2209820_2211230_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_012147550.1|2211414_2212464_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.6	7.6e-09
WP_012147551.1|2212472_2213885_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	26.4	2.4e-05
>prophage 173
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2218197	2221002	5593263		uncultured_virus(100.0%)	1	NA	NA
WP_153858521.1|2218197_2221002_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.4	1.0e-68
>prophage 174
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2235614	2241488	5593263		Enterobacteria_phage(33.33%)	5	NA	NA
WP_153858528.1|2235614_2236502_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	25.5	4.3e-05
WP_012147567.1|2236525_2237491_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_153858529.1|2237497_2239003_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	1.9e-16
WP_153858530.1|2239010_2239430_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_153858531.1|2239619_2241488_-	low affinity potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	30.3	2.7e-65
>prophage 175
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2247278	2301824	5593263	transposase,tRNA,integrase	Escherichia_phage(29.41%)	48	2262529:2262588	2293721:2296337
WP_012147575.1|2247278_2249168_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_153858534.1|2249304_2249925_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_037421253.1|2250565_2250949_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_135314551.1|2250969_2251791_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_004093904.1|2251840_2252080_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_004950476.1|2252137_2252608_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_153858535.1|2252622_2253156_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_012004483.1|2253168_2254710_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_012004484.1|2254768_2255632_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_012004485.1|2255664_2257047_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_004950490.1|2257067_2257487_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_153858536.1|2257783_2259154_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	28.8	4.3e-20
WP_153858537.1|2259365_2261195_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	42.4	4.0e-130
WP_153858538.1|2261353_2262181_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_153858539.1|2262164_2262557_+	hypothetical protein	NA	NA	NA	NA	NA
2262529:2262588	attL	TTGCGTATTCTGGTGAAGATGAACAGTGATTCCGGAGGAACGTGAACGCGTTATTTCCTA	NA	NA	NA	NA
WP_153858540.1|2262628_2263366_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_153858541.1|2263382_2264927_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	1.0e-126
WP_153858542.1|2266875_2268525_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_153858543.1|2268529_2270059_+	transcriptional antiterminator	NA	NA	NA	NA	NA
WP_153858544.1|2270030_2271626_+	transcriptional antiterminator	NA	NA	NA	NA	NA
WP_153858545.1|2271890_2273540_-	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_153858546.1|2273573_2273999_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_153860886.1|2274296_2274959_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	47.6	8.7e-35
WP_153858547.1|2274958_2276626_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_153858548.1|2276625_2277597_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_153858549.1|2278172_2278352_+	hypothetical protein	NA	A0A0N7C1X7	Escherichia_phage	76.9	2.1e-07
WP_153858550.1|2278777_2281600_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	47.3	2.7e-101
WP_167519921.1|2281780_2281960_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153858552.1|2282071_2282422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153858553.1|2282590_2284417_-	hypothetical protein	NA	A0A289ZVR2	Serratia_phage	30.0	2.2e-64
WP_153858554.1|2285281_2285509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153858555.1|2286580_2286832_+	YoeB-YefM toxin-antitoxin system antitoxin YefM	NA	NA	NA	NA	NA
WP_153858556.1|2286828_2287083_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_153858557.1|2287101_2287404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153858558.1|2287570_2287768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153858559.1|2288093_2288798_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	97.0	1.2e-135
WP_153858560.1|2289302_2290127_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	51.5	4.9e-19
WP_153858561.1|2290974_2291253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129937179.1|2291362_2291620_-	hypothetical protein	NA	A0A222YZA7	Escherichia_phage	48.4	1.1e-12
WP_147095702.1|2291613_2292249_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	69.3	5.3e-82
WP_153858540.1|2293820_2294558_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_153858541.1|2294574_2296119_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	1.0e-126
WP_153860887.1|2296307_2297150_+	reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	29.4	4.1e-13
2293721:2296337	attR	TTGCGTATTCTGGTGAAGATGAACAGTGATTCCGGAGGAACGTGAACGCGTTATTTCCTAACGCGCCCTGACTTCTTTTTATTACACCGACCGTTCACTTTCAGTCAACCTGTGCCAGTCGTTTTCTCATCGATTCGCCTTTCATGTCCAGCCGCTGGGCGTTGTGCATCAGCCTGTCCAGGATCGCATCAGCAAGTGTGTTATCTCCCACGCAGCCGTACCACCCCTCCGTTGGTAGCTGGCTTATCATCACCGTCGCGCTTTTACCGTAACGATCGTCCATCAGCTCCAGCAGATCGTTACGATGAGCTGCCTGGAGCGGCTCAAGCCCCCAGTCGTCCAGGATAAGCAGTTGTGTTTTCGACAACTGGGTCAGCTGTTTTCTGTAGCTGCCATCTGCCCGACCATGCGTCAGCTCGCCCAGCAACCGGCTCAGGCGCCAGTACTGCACGCTGTAACCCTGCTGGCAGGCGTTGTTACCCAGCGCGCAGCCCACGTAGGTTTTACCGCAGCCGCAGGGGCCGGTTATCAGCAGGTTCTGTCCACGCAGCACCCACTCGCTCTGGCTCAGTTGCGCGATTCGTGAACGCTCCAGGTTTCTGGCAGGCTGGTAGTCTATATCGTGAACCGAGGCCTCAAGCCTCAGCCGCGCTTTCTGCAACAGCCGTTTTTGCTTACGCTGGTCCCGCTCCAGCGATTCCCGGGTGACCAGCAGCGCCAGCCGTTCTTTGAACGACAGGTCTTCGTAAGTCCCCGGTTGTTCCATCTGCATCGACAGCGCGGCGGCCATGCCGGTCAGTTTCAGCTCAGACAGTTGTTTCATCAGCGTATGTGGCATTATCAGGCTCCTTGTTTCAGTGAAAGTGGCGTGGGCCACGGATGTTTTCATGCTCCTGGGGGAGCTCCGGCGACGGATGCGGGTCGCTATCCCGTGGAACGAGGTCACGGTTGGTTTTCAGGATCGACTTTATCTGCTTCAGGCGGTTCAGCCCTTCGCTGTTGGCAAGCTGGCAACTACCGTTGACCCGCGCCGCAGGATACTCGCGCGTCAGGCTCAGTAGCCCCAGGCACAAGCGATAGGCCTGCTCCGGATGCGCCTTTTCTGCCAGGCGATCGCTGATCCACTGCAGCGTATCGGGCCCCACGCTGGCAGCCCAGTTTTTCAGTCGTCCCGGCGTCCACTGCTGATGGTGACGGTGGCGTTCTGGCATGTGCTCCGCCGTCGTACTGTTTCCCGGATGGAGGCGGCGTGGATGGGTGGCTATCATCTGGTCTCCCACCCACACCTCAAGCAGGTTATCGAAGGCATGCAGTTCCACTTTATAGCCAACGTACTGGTGAGGAACCGAGTAGTGGTGCTGCTCATACTCAACGTGGTAATCGATATTCACCTTCGCTTTTTTAATATGCCGGTAGCGCCATGGATGCACCGGTAACTGACGAAGTGCGGGCCGGTCCAGCCTTTCGAAGGCCTGTCTGCGGTTACCGGGCAGCTTTTTGAAGGGACGTTCGTTGAGAGCCGCGACCAGCGTACGGATACAGTGGTTCAGCTCCGATAACGAGAAGAAGACCTGGTGACGCAGTCGGGCCAGGATCCATCTCTCCACCACCTGTACCCCGATTTCGGCTTTGGGTTTGTCTTTAGGTTTTCGCGGACGAGCGGGTATCACTGCCACCAGGTAGTGCTCCGCCAGTTGCTGATAAGCGGGATTCAGCTCGGGGTCGTAACGGCAGGCCTTGCTGACCGCGCTTTTCAGGTTGTCCGGCACCAGGATTTCAGGTACGCCGCCGAAGAACTCCAGCATCCTGACGTGGCTGAGCAGCCAGTCCTGAAGCGACTGCGTCCAGGTGGCCTCCGCGAAGGTGTAGCTTGAGGCCCCCAGTACGGCCACGAAGATCTGTGCCAGGCGGCATTCACCGGTATCAGGCGAGACAACCGGTACGGTGGGACCGCAGTAGTCGATAAAGCATTTTTCACCGGCAAGGTGTTGCTGGCGCATGGAGCGTTTTTGTAACTGACACCAGGCATGGTACCGGTAGCAGAACTGCGAGTAGCTGTAGGCCCTGACCGGCACCCGCTGGCAGTACTCCTCCCACAACAGGTGCCGGGTGACGCCTTTTTTACGCAGCTCCATATGGATATCAGCCCAGTCAGGATCTTCGAGCTCACCGGGGCGGCTGTCGGATTCTGGGTAGAGCAAGCTGGCAAGCCTGCTCTCTGACATCCCCTTTGGTAGCGGCCAGGAGACTCCGACGGCATCAAGACGTTTAAGCATTTTCTGGATTGCACCGGTACTGACGTCGGCGCACTGGCTGATCTGACGGAAGGAGAGTCCGGCCTCAAAACGTAGTCTTAAAATATCTCGGATTTTACGCATGTTGATTCTCTTGTTCGGCATATCTCTCTCCAGTGGGTTAAAGAGAAAGAGATAGCAGGAAAAATCAATGCGTTAAGAAAGATTCTGGAAACGTGAACAGCAATTCTGGTCAGATGAACACCGATTCTGGAGGTGATGCAAAATCGTGGTATTTTCCGCCGGAATACGCGTTCACGCAAAACCAGAATCAGCGTTCACGTTCCGCCAGAATGACCGTTCACGCTCGGCCAGAATACGCA	NA	NA	NA	NA
WP_167519899.1|2297159_2297834_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	37.7	3.6e-12
WP_000631725.1|2297830_2298178_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_153857617.1|2298197_2299832_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.9	1.8e-142
WP_167519972.1|2299865_2299961_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_153858562.1|2300405_2301824_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	34.2	1.2e-65
>prophage 176
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2305044	2319706	5593263	transposase	Escherichia_phage(14.29%)	10	NA	NA
WP_153858565.1|2305044_2307729_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	32.9	6.8e-94
WP_137231231.1|2308146_2309296_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	62.4	5.0e-94
WP_153858566.1|2312191_2312773_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	37.0	3.0e-23
WP_153858567.1|2312857_2314348_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_153858568.1|2314457_2315318_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_153860888.1|2315688_2316069_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.4	3.0e-32
WP_153858569.1|2316068_2317178_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	58.6	6.9e-101
WP_153858570.1|2317435_2318050_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_153858571.1|2318078_2319062_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	59.0	3.5e-72
WP_153858572.1|2319058_2319706_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	35.9	1.2e-25
>prophage 177
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2326823	2344150	5593263		Escherichia_phage(16.67%)	16	NA	NA
WP_153858579.1|2326823_2329619_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	47.3	5.4e-102
WP_167519923.1|2329683_2329977_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153858581.1|2330088_2330439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153858582.1|2330607_2332434_-	hypothetical protein	NA	A0A289ZVR2	Serratia_phage	30.0	1.7e-64
WP_153858583.1|2333298_2333526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153858584.1|2334195_2334354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153858585.1|2334835_2335876_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	38.3	3.0e-50
WP_012004489.1|2335968_2336925_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_153858586.1|2336926_2337817_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_012004491.1|2337865_2338642_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.3	1.3e-13
WP_153858587.1|2338653_2339388_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_012004493.1|2339556_2340396_+	ABC transporter substrate-binding protein	NA	A0A140XBD5	Dickeya_phage	76.3	5.5e-10
WP_153858588.1|2340474_2341188_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_153858589.1|2341189_2341930_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_153858590.1|2341922_2342588_-	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_012004497.1|2342812_2344150_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.8	5.6e-65
>prophage 178
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2355281	2361995	5593263		Rhizobium_phage(33.33%)	5	NA	NA
WP_012004507.1|2355281_2356382_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	1.1e-53
WP_153858597.1|2356550_2357636_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_153858598.1|2357654_2360069_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.3	3.3e-116
WP_153858599.1|2360192_2361008_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_153858600.1|2361053_2361995_-	ornithine cyclodeaminase family protein	NA	A0A1V0SL93	Klosneuvirus	24.7	1.2e-08
>prophage 179
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2367824	2368795	5593263		Synechococcus_phage(100.0%)	2	NA	NA
WP_004950577.1|2367824_2368238_+	heat shock chaperone IbpA	NA	A0A1Z1LWH0	Synechococcus_phage	37.8	1.4e-19
WP_135314580.1|2368366_2368795_+	heat shock chaperone IbpB	NA	A0A222YXB4	Synechococcus_phage	34.2	2.5e-14
>prophage 180
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2374621	2375599	5593263		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_153858610.1|2374621_2375599_-	glyoxylate/hydroxypyruvate reductase GhrB	NA	A7ITA6	Paramecium_bursaria_Chlorella_virus	27.2	8.4e-18
>prophage 181
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2402012	2404686	5593263		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_153858622.1|2402012_2403941_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.4	1.4e-11
WP_153858623.1|2404065_2404686_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.6	8.7e-61
>prophage 182
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2414196	2419390	5593263		Tupanvirus(50.0%)	5	NA	NA
WP_153858630.1|2414196_2416038_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	25.2	1.5e-12
WP_153858631.1|2416121_2416382_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_099062250.1|2416381_2416657_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_153858632.1|2416731_2417979_-	MdfA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_153858633.1|2418397_2419390_+	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	23.9	2.5e-09
>prophage 183
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2426707	2428249	5593263		Staphylococcus_phage(100.0%)	1	NA	NA
WP_153858640.1|2426707_2428249_+	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	4.0e-14
>prophage 184
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2434714	2442762	5593263	integrase	Enterobacteria_phage(66.67%)	11	2434518:2434540	2446566:2446588
2434518:2434540	attL	CGACTCCTGTGATCTTCCGCCAA	NA	NA	NA	NA
WP_037420598.1|2434714_2435899_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	67.6	2.2e-158
WP_153858645.1|2435895_2436726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084797459.1|2436846_2437143_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_084797460.1|2437159_2437291_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_153858646.1|2437489_2437666_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_153858647.1|2437658_2438012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153858648.1|2438056_2438338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167519982.1|2438340_2438685_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_153858650.1|2438694_2441376_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	31.3	4.4e-61
WP_153858651.1|2441799_2442546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153858652.1|2442549_2442762_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	67.9	3.2e-15
2446566:2446588	attR	CGACTCCTGTGATCTTCCGCCAA	NA	NA	NA	NA
>prophage 185
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2451859	2452829	5593263		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_153858658.1|2451859_2452447_-	histidine phosphatase family protein	NA	M1IB93	Acanthocystis_turfacea_Chlorella_virus	43.3	5.7e-38
WP_037426124.1|2452592_2452829_+	DUF4282 domain-containing protein	NA	A0A077KGV8	Edwardsiella_phage	43.7	5.7e-05
>prophage 186
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2456956	2457556	5593263		Pseudomonas_phage(100.0%)	1	NA	NA
WP_153858662.1|2456956_2457556_-	HD domain-containing protein	NA	B3FJI5	Pseudomonas_phage	38.9	1.3e-26
>prophage 187
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2465573	2467265	5593263		Orgyia_leucostigma_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_153858667.1|2465573_2467265_+	chitinase	NA	B0FDP2	Orgyia_leucostigma_nucleopolyhedrovirus	61.8	8.1e-202
>prophage 188
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2471566	2473533	5593263		Planktothrix_phage(50.0%)	2	NA	NA
WP_153858670.1|2471566_2472547_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	4.3e-14
WP_153858671.1|2472543_2473533_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.8	1.4e-17
>prophage 189
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2494333	2499774	5593263		Bacillus_phage(33.33%)	4	NA	NA
WP_012004628.1|2494333_2496358_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	1.2e-114
WP_012004629.1|2496540_2498037_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_153858683.1|2498043_2499330_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.7	1.3e-34
WP_012004631.1|2499447_2499774_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.7	2.5e-19
>prophage 190
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2504180	2510393	5593263		Catovirus(20.0%)	6	NA	NA
WP_153858685.1|2504180_2505311_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.3	3.9e-27
WP_153858686.1|2505307_2506570_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	26.3	4.3e-22
WP_153858687.1|2506566_2507634_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	2.1e-102
WP_153858688.1|2507685_2508567_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	65.6	2.8e-105
WP_153858689.1|2508544_2509276_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_153858690.1|2509262_2510393_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	39.9	2.6e-18
>prophage 191
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2527242	2531110	5593263		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_012004655.1|2527242_2528154_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	34.2	4.1e-19
WP_153858701.1|2528153_2528870_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_153858702.1|2528947_2531110_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.5	1.5e-115
>prophage 192
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2536756	2538589	5593263		Catovirus(100.0%)	1	NA	NA
WP_153858707.1|2536756_2538589_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.1	6.7e-85
>prophage 193
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2541928	2543008	5593263		Staphylococcus_phage(100.0%)	1	NA	NA
WP_153858711.1|2541928_2543008_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	44.3	1.8e-08
>prophage 194
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2550329	2551461	5593263		Vibrio_phage(50.0%)	2	NA	NA
WP_153858716.1|2550329_2550995_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	58.3	3.9e-59
WP_012004676.1|2551215_2551461_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	86.1	1.2e-10
>prophage 195
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2554975	2560464	5593263	protease	Streptococcus_phage(50.0%)	5	NA	NA
WP_153858720.1|2554975_2557291_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	37.8	8.7e-122
WP_153858721.1|2557371_2557596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153858722.1|2557906_2559370_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_153858723.1|2559422_2559800_+|protease	AprI/Inh family metalloprotease inhibitor	protease	NA	NA	NA	NA
WP_153858724.1|2559837_2560464_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	60.2	5.2e-29
>prophage 196
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2572930	2573509	5593263	integrase	Escherichia_phage(100.0%)	1	2571236:2571248	2577814:2577826
2571236:2571248	attL	CAGCCGCAGGGTG	NA	NA	NA	NA
WP_153860897.1|2572930_2573509_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	50.5	2.3e-47
WP_153860897.1|2572930_2573509_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	50.5	2.3e-47
2577814:2577826	attR	CACCCTGCGGCTG	NA	NA	NA	NA
>prophage 197
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2580673	2583462	5593263		Staphylococcus_phage(50.0%)	3	NA	NA
WP_012004692.1|2580673_2581345_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	26.2	2.8e-12
WP_012004693.1|2581334_2582288_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_153858744.1|2582604_2583462_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.1	2.7e-44
>prophage 198
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2591013	2593716	5593263		Cedratvirus(33.33%)	3	NA	NA
WP_012004701.1|2591013_2591781_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	A0A1M7XV31	Cedratvirus	27.2	4.9e-13
WP_153858748.1|2591784_2592486_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	4.9e-12
WP_153858749.1|2592528_2593716_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A1X9I5H2	Streptococcus_phage	27.9	7.8e-18
>prophage 199
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2597076	2598896	5593263		Planktothrix_phage(50.0%)	2	NA	NA
WP_153858751.1|2597076_2598150_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.4	2.3e-21
WP_153860898.1|2598149_2598896_+	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	25.9	4.7e-13
>prophage 200
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2610514	2613834	5593263		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_153858758.1|2610514_2612146_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.4e-39
WP_006323098.1|2612226_2612490_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_153858759.1|2612493_2613060_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_012004722.1|2613063_2613834_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.8	4.9e-29
>prophage 201
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2626050	2627811	5593263	transposase	Shigella_phage(50.0%)	2	NA	NA
WP_137231231.1|2626050_2627201_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	62.4	5.0e-94
WP_153860900.1|2627271_2627811_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.8	1.3e-17
>prophage 202
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2637926	2653608	5593263		uncultured_Mediterranean_phage(20.0%)	10	NA	NA
WP_153858769.1|2637926_2638877_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.5	8.4e-31
WP_017891327.1|2639965_2641150_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
WP_153858770.1|2641407_2641791_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_012004741.1|2641792_2642338_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.5	1.6e-13
WP_006323135.1|2642496_2642925_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_012004742.1|2642928_2643633_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_004953935.1|2643975_2644473_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_012004743.1|2644535_2644901_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_153858771.1|2645234_2649263_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.8	6.5e-24
WP_012004745.1|2649381_2653608_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.1	5.0e-67
>prophage 203
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2662143	2667609	5593263		Klosneuvirus(33.33%)	6	NA	NA
WP_153858780.1|2662143_2662830_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	31.2	4.8e-20
WP_012004756.1|2662878_2663469_+	YjaG family protein	NA	NA	NA	NA	NA
WP_012004757.1|2663657_2663930_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	55.6	4.7e-19
WP_153860901.1|2663978_2664638_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_153858781.1|2664684_2665968_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_153858782.1|2666019_2667609_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.3	9.6e-72
>prophage 204
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2690832	2694513	5593263		Dickeya_phage(100.0%)	1	NA	NA
WP_153858795.1|2690832_2694513_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	88.9	1.7e-26
>prophage 205
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2699031	2700024	5593263		Bacillus_virus(100.0%)	1	NA	NA
WP_153858801.1|2699031_2700024_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.3	1.8e-28
>prophage 206
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2722600	2723710	5593263		Mycoplasma_phage(100.0%)	1	NA	NA
WP_135318259.1|2722600_2723710_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	2.3e-16
>prophage 207
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2734492	2735101	5593263		Lactococcus_phage(100.0%)	1	NA	NA
WP_012147154.1|2734492_2735101_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.9	5.0e-13
>prophage 208
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2742744	2745266	5593263		Salmonella_phage(50.0%)	2	NA	NA
WP_012147143.1|2742744_2744169_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	75.7	5.8e-193
WP_012147142.1|2744186_2745266_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 209
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2749688	2756242	5593263		Tupanvirus(25.0%)	4	NA	NA
WP_153858828.1|2749688_2750741_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	45.3	3.6e-83
WP_153858829.1|2750963_2753798_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.8	4.1e-307
WP_017894189.1|2754075_2754612_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	90.6	2.5e-56
WP_153858830.1|2754691_2756242_-	transporter substrate-binding domain-containing protein	NA	J9SGR6	Pseudomonas_phage	33.9	1.9e-08
>prophage 210
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2760549	2761911	5593263		Moraxella_phage(100.0%)	1	NA	NA
WP_017894183.1|2760549_2761911_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.7	3.9e-162
>prophage 211
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2766016	2766937	5593263		Morganella_phage(100.0%)	1	NA	NA
WP_153858840.1|2766016_2766937_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	52.7	4.0e-78
>prophage 212
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2780503	2781547	5593263		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_012147106.1|2780503_2781547_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 213
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2793450	2803011	5593263		Moraxella_phage(100.0%)	1	NA	NA
WP_167519927.1|2793450_2803011_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	37.4	5.0e-30
>prophage 214
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2828927	2838089	5593263		Thermobifida_phage(20.0%)	11	NA	NA
WP_012147065.1|2828927_2829782_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	1.9e-05
WP_037410796.1|2829913_2830360_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_012147063.1|2830538_2830826_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_153858876.1|2830849_2832283_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_006317106.1|2832333_2833059_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	1.4e-22
WP_135318175.1|2833065_2833605_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_153858877.1|2833573_2834152_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_017894144.1|2834148_2834703_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	86.7	2.7e-61
WP_153858878.1|2834720_2835707_-	arabinose-5-phosphate isomerase KdsD	NA	E5EYK6	Acinetobacter_phage	35.8	1.5e-19
WP_153858879.1|2835727_2836705_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_012147056.1|2837273_2838089_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.2	2.0e-20
>prophage 215
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2842152	2844678	5593263	protease	uncultured_Mediterranean_phage(100.0%)	2	NA	NA
WP_153858883.1|2842152_2843211_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.1	2.5e-23
WP_153858884.1|2843307_2844678_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.8	6.2e-19
>prophage 216
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2848731	2849229	5593263	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_153858886.1|2848731_2849229_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.7	5.5e-26
>prophage 217
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2856961	2865493	5593263		Hokovirus(33.33%)	8	NA	NA
WP_153858889.1|2856961_2859301_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.4	1.6e-38
WP_153858890.1|2859538_2860192_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_153858891.1|2860188_2860920_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_153858892.1|2860965_2861541_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_004948462.1|2861550_2862141_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	3.2e-12
WP_153858893.1|2862192_2862585_-	YraN family protein	NA	NA	NA	NA	NA
WP_153858894.1|2862542_2864567_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_012147032.1|2864629_2865493_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.5	3.6e-49
>prophage 218
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2881150	2885284	5593263		Escherichia_phage(100.0%)	6	NA	NA
WP_167519985.1|2881150_2882125_-	TerC/Alx family metal homeostasis membrane protein	NA	A0A291LBC5	Escherichia_phage	34.9	8.9e-36
WP_153858906.1|2882386_2883118_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_153858907.1|2883119_2884100_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_012147012.1|2884150_2884663_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_153858908.1|2884655_2884979_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	43.2	1.2e-13
WP_153858909.1|2884993_2885284_-	toxin	NA	A0A222YWE2	Escherichia_phage	47.3	8.0e-17
>prophage 219
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2889012	2893499	5593263		Streptococcus_phage(66.67%)	3	NA	NA
WP_153858912.1|2889012_2890632_+	ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	26.7	1.1e-27
WP_153858913.1|2890645_2892112_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A1X9I5H2	Streptococcus_phage	29.5	4.8e-17
WP_153858914.1|2892233_2893499_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	1.1e-25
>prophage 220
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2899155	2907968	5593263	tRNA	Vibrio_phage(25.0%)	8	NA	NA
WP_012146997.1|2899155_2901099_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	2.0e-34
WP_153858920.1|2901149_2902898_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	6.0e-75
WP_001144069.1|2903034_2903250_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_153858921.1|2903574_2904588_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	8.7e-111
WP_153858922.1|2904623_2905262_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_153858923.1|2905369_2905729_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_153858924.1|2905860_2906685_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_153858925.1|2906723_2907968_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	46.0	2.8e-90
>prophage 221
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2913276	2917365	5593263		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_012146988.1|2913276_2914707_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	2.4e-37
WP_153858928.1|2914732_2915986_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_012146986.1|2916014_2916293_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_017894055.1|2916711_2917365_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.0	8.6e-43
>prophage 222
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2925631	2927458	5593263		Ralstonia_phage(50.0%)	2	NA	NA
WP_153858937.1|2925631_2926792_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	45.4	5.5e-93
WP_153858938.1|2926795_2927458_-	DUF1190 family protein	NA	A0A191ZBZ0	Erwinia_phage	48.0	2.1e-41
>prophage 223
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2938576	2944992	5593263		Bacillus_virus(100.0%)	5	NA	NA
WP_012146962.1|2938576_2940472_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.6	2.6e-92
WP_153858946.1|2940568_2941465_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_135318093.1|2941478_2941787_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_153858947.1|2941820_2942402_-	NADPH quinone reductase MdaB	NA	NA	NA	NA	NA
WP_153858948.1|2942718_2944992_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	33.6	2.2e-85
>prophage 224
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2965839	2969167	5593263	integrase	Escherichia_phage(50.0%)	2	2962259:2962272	2971214:2971227
2962259:2962272	attL	CGGCAGCGAGTCGG	NA	NA	NA	NA
WP_153858968.1|2965839_2966397_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.5	1.8e-49
WP_153858969.1|2967001_2969167_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	71.1	5.5e-102
2971214:2971227	attR	CCGACTCGCTGCCG	NA	NA	NA	NA
>prophage 225
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2972185	2973589	5593263		Pandoravirus(100.0%)	1	NA	NA
WP_153858972.1|2972185_2973589_+	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	32.1	3.8e-64
>prophage 226
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2979625	2980450	5593263		Staphylococcus_phage(100.0%)	1	NA	NA
WP_153858977.1|2979625_2980450_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.9	6.5e-64
>prophage 227
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	2990682	2992092	5593263		Bacillus_phage(100.0%)	1	NA	NA
WP_153860907.1|2990682_2992092_-	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.6	2.4e-18
>prophage 228
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3007739	3010071	5593263		uncultured_Caudovirales_phage(66.67%)	3	NA	NA
WP_153858993.1|3007739_3008582_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.3	3.4e-44
WP_153858994.1|3008559_3009456_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	43.6	1.0e-62
WP_153858995.1|3009456_3010071_-	helix-turn-helix domain-containing protein	NA	A0A2H4J122	uncultured_Caudovirales_phage	42.1	1.1e-36
>prophage 229
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3018608	3027426	5593263	transposase	Ralstonia_phage(20.0%)	7	NA	NA
WP_153859000.1|3018608_3020918_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.6	5.5e-44
WP_153859001.1|3020928_3021258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153859002.1|3021400_3021634_+	hypothetical protein	NA	W8ED25	Mycobacterium_phage	48.1	6.0e-07
WP_153859003.1|3021944_3024221_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	49.2	1.2e-144
WP_153859004.1|3024347_3024587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137231231.1|3024611_3025761_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	62.4	5.0e-94
WP_153859005.1|3027066_3027426_-	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	35.0	9.3e-07
>prophage 230
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3037271	3040892	5593263		Feldmannia_species_virus(100.0%)	1	NA	NA
WP_153859010.1|3037271_3040892_+	transporter substrate-binding domain-containing protein	NA	B5LWN0	Feldmannia_species_virus	28.6	1.2e-29
>prophage 231
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3080823	3081411	5593263		Mycobacterium_phage(100.0%)	1	NA	NA
WP_153859047.1|3080823_3081411_-	hypothetical protein	NA	G1FGA4	Mycobacterium_phage	38.6	2.6e-06
>prophage 232
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3087297	3089445	5593263		Bacillus_phage(100.0%)	1	NA	NA
WP_153859053.1|3087297_3089445_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.1	3.3e-35
>prophage 233
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3095403	3097494	5593263		Indivirus(100.0%)	1	NA	NA
WP_153859059.1|3095403_3097494_-	type I secretion system permease/ATPase	NA	A0A1V0SE00	Indivirus	31.8	2.2e-23
>prophage 234
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3103171	3104095	5593263		Staphylococcus_phage(100.0%)	1	NA	NA
WP_153859061.1|3103171_3104095_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.5	9.0e-22
>prophage 235
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3114237	3128684	5593263	transposase,holin	Bacteriophage(66.67%)	13	NA	NA
WP_153858541.1|3114237_3115782_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	1.0e-126
WP_153858540.1|3115798_3116536_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_167519933.1|3116591_3117137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167519934.1|3117823_3118558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167519935.1|3118545_3118917_-	RHS repeat-associated core domain-containing protein	NA	A0A1W5K0N1	Bacteriophage	74.1	2.5e-31
WP_153859070.1|3119103_3119373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153859071.1|3119453_3119843_-	M15 family peptidase	NA	A9DET4	Yersinia_phage	54.4	1.0e-35
WP_153859072.1|3119934_3120255_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_153859073.1|3120308_3120728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153859074.1|3121159_3122371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153859075.1|3122444_3126476_+	hypothetical protein	NA	B6SD27	Bacteriophage	33.3	3.1e-167
WP_153859076.1|3126426_3127560_+	hypothetical protein	NA	A0A1W5K0N1	Bacteriophage	72.6	2.0e-34
WP_153860915.1|3127649_3128684_+	hypothetical protein	NA	B6SD27	Bacteriophage	43.8	2.1e-27
>prophage 236
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3133860	3135726	5593263		Acanthocystis_turfacea_chlorella_virus(100.0%)	1	NA	NA
WP_153859078.1|3133860_3135726_+	low affinity potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	29.8	2.0e-68
>prophage 237
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3144258	3149924	5593263	transposase,integrase	Shigella_phage(33.33%)	4	3126768:3126782	3159294:3159308
3126768:3126782	attL	GAGTATCAGTGCAGC	NA	NA	NA	NA
WP_137231231.1|3144258_3145409_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	62.4	5.0e-94
WP_153859085.1|3145684_3147130_+	ATP-binding domain-containing protein	NA	A0A2I7R5Z1	Vibrio_phage	30.0	2.0e-44
WP_153859086.1|3147123_3148806_+	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_167519988.1|3148910_3149924_+|integrase	tyrosine-type recombinase/integrase	integrase	H7BUX8	unidentified_phage	21.0	4.5e-06
3159294:3159308	attR	GAGTATCAGTGCAGC	NA	NA	NA	NA
>prophage 238
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3166227	3169806	5593263		Hokovirus(100.0%)	1	NA	NA
WP_167519936.1|3166227_3169806_+	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	32.4	3.9e-36
>prophage 239
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3196783	3198208	5593263		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_020828582.1|3196783_3198208_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.7	1.8e-40
>prophage 240
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3210327	3224432	5593263	transposase	Mamastrovirus(16.67%)	14	NA	NA
WP_153859128.1|3210327_3211947_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	48.6	2.1e-18
WP_085118883.1|3212045_3212582_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	3.0e-17
WP_061807929.1|3212619_3213276_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_012146698.1|3213512_3214436_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.9	1.2e-21
WP_012146697.1|3214432_3215203_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_153859129.1|3215370_3216651_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_012146695.1|3216690_3217071_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_153859130.1|3217175_3218297_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	78.1	1.1e-170
WP_153859131.1|3218494_3219349_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_153859132.1|3219373_3220168_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_153859133.1|3220337_3221000_+	response regulator	NA	NA	NA	NA	NA
WP_153859134.1|3220996_3222355_+	two-component system sensor histidine kinase QseC	NA	W8CYF6	Bacillus_phage	25.1	4.1e-15
WP_153859135.1|3222381_3222882_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_153859136.1|3222881_3224432_-	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	32.0	2.9e-28
>prophage 241
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3227450	3229880	5593263		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_153860917.1|3227450_3229880_+	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	30.1	5.1e-40
>prophage 242
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3234981	3235779	5593263		Planktothrix_phage(100.0%)	1	NA	NA
WP_153859142.1|3234981_3235779_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	30.1	3.5e-14
>prophage 243
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3240214	3241369	5593263		Staphylococcus_phage(100.0%)	1	NA	NA
WP_012146676.1|3240214_3241369_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.4	9.0e-128
>prophage 244
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3257116	3261898	5593263		Trichoplusia_ni_ascovirus(50.0%)	4	NA	NA
WP_153859156.1|3257116_3257911_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.0	5.4e-07
WP_153859157.1|3257928_3258723_+	aspartate dehydrogenase	NA	NA	NA	NA	NA
WP_153859158.1|3258737_3260207_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_153860919.1|3260257_3261898_+	thiamine pyrophosphate-binding protein	NA	E5EQ70	Micromonas_sp._RCC1109_virus	24.6	1.7e-26
>prophage 245
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3272979	3274050	5593263		Bacillus_virus(100.0%)	1	NA	NA
WP_153859167.1|3272979_3274050_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	32.4	2.8e-27
>prophage 246
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3282612	3283311	5593263		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_153859174.1|3282612_3283311_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	31.5	3.0e-09
>prophage 247
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3297153	3298707	5593263		Staphylococcus_phage(100.0%)	1	NA	NA
WP_153859190.1|3297153_3298707_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.8	1.3e-12
>prophage 248
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3303578	3304817	5593263		Catovirus(100.0%)	1	NA	NA
WP_153859193.1|3303578_3304817_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.5	7.7e-101
>prophage 249
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3312961	3315841	5593263		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_153859201.1|3312961_3315841_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	52.8	4.6e-266
>prophage 250
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3320563	3321970	5593263		Hokovirus(100.0%)	1	NA	NA
WP_153859203.1|3320563_3321970_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	2.0e-12
>prophage 251
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3333215	3333911	5593263		Bacillus_phage(100.0%)	1	NA	NA
WP_012146598.1|3333215_3333911_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.0	3.7e-28
>prophage 252
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3337434	3346786	5593263	transposase,tRNA	Brevibacillus_phage(25.0%)	8	NA	NA
WP_153859216.1|3337434_3338334_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.7	3.3e-29
WP_135317816.1|3338361_3339078_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_153859217.1|3339084_3340818_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.0	6.8e-63
WP_153859218.1|3340863_3341211_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153859219.1|3341203_3341590_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_112363199.1|3341845_3342943_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_153859220.1|3342953_3344471_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	39.3	4.5e-87
WP_137231231.1|3345635_3346786_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	62.4	5.0e-94
>prophage 253
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3352754	3358059	5593263		Morganella_phage(33.33%)	5	NA	NA
WP_153859223.1|3352754_3352967_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	78.6	9.9e-25
WP_153859224.1|3354126_3354432_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_153859225.1|3354424_3355354_-	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	48.4	1.5e-08
WP_153859226.1|3355510_3356080_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_153860924.1|3356292_3358059_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.7	9.4e-44
>prophage 254
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3371014	3372751	5593263		Bacillus_phage(100.0%)	1	NA	NA
WP_153859237.1|3371014_3372751_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.1	2.3e-10
>prophage 255
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3378840	3398439	5593263		Bovine_gammaherpesvirus(14.29%)	17	NA	NA
WP_153859243.1|3378840_3380103_+	diaminopimelate decarboxylase	NA	A0A060D2X4	Bovine_gammaherpesvirus	28.0	3.2e-09
WP_153859244.1|3380136_3380439_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_153859245.1|3380444_3380789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153859246.1|3380928_3381939_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	28.2	3.2e-28
WP_153859247.1|3382093_3382549_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_153859248.1|3382545_3383565_-	HTH-type transcriptional regulator GalR	NA	NA	NA	NA	NA
WP_153859249.1|3383784_3386043_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	30.8	7.5e-70
WP_153859250.1|3386561_3388715_+	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	21.6	7.3e-14
WP_153859251.1|3388714_3389911_+	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_153859252.1|3389964_3391005_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_099063784.1|3391201_3391420_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_012146529.1|3391589_3392306_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.7	1.7e-47
WP_153859253.1|3392401_3393088_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_012146527.1|3393784_3394312_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_153859254.1|3394324_3396571_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.1	1.0e-10
WP_153859255.1|3396764_3397637_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017893814.1|3397644_3398439_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	62.3	2.9e-117
>prophage 256
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3404277	3419806	5593263	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_153860926.1|3404277_3407166_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.2	4.6e-72
WP_153859260.1|3407162_3410723_+	exodeoxyribonuclease V subunit beta	NA	A0A068EQC7	Bacillus_phage	22.8	3.3e-11
WP_153859261.1|3410719_3412585_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	27.9	3.7e-30
WP_153859262.1|3412627_3413953_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_135317762.1|3414192_3415446_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	29.6	1.1e-14
WP_153859263.1|3416120_3417263_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_012146512.1|3417350_3418157_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.1	4.2e-15
WP_153859264.1|3418147_3418582_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_153860927.1|3418600_3419806_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	35.9	1.7e-73
>prophage 257
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3423098	3426320	5593263		Bacillus_phage(50.0%)	3	NA	NA
WP_153859266.1|3423098_3423854_-	flap endonuclease Xni	NA	A0A0N7ACJ6	Bacillus_phage	32.0	1.5e-19
WP_153859267.1|3423910_3425275_-	DUF3412 domain-containing protein	NA	NA	NA	NA	NA
WP_153859268.1|3425474_3426320_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	39.1	1.5e-42
>prophage 258
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3440839	3441598	5593263		Flavobacterium_phage(100.0%)	1	NA	NA
WP_012146490.1|3440839_3441598_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	42.2	3.2e-25
>prophage 259
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3450522	3454674	5593263		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_012146481.1|3450522_3451116_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.4	1.0e-26
WP_153859278.1|3451185_3454674_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.3	2.7e-199
>prophage 260
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3465012	3466461	5593263		Acinetobacter_phage(100.0%)	1	NA	NA
WP_153859285.1|3465012_3466461_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	29.4	4.5e-44
>prophage 261
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3475238	3476270	5593263		Planktothrix_phage(100.0%)	1	NA	NA
WP_012146459.1|3475238_3476270_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	37.6	2.7e-35
>prophage 262
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3482824	3484135	5593263		Burkholderia_virus(100.0%)	1	NA	NA
WP_153859292.1|3482824_3484135_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.9	3.5e-43
>prophage 263
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3489581	3490001	5593263		Streptomyces_phage(100.0%)	1	NA	NA
WP_012146452.1|3489581_3490001_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	39.5	1.1e-11
>prophage 264
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3502924	3504127	5593263		Bacillus_virus(100.0%)	1	NA	NA
WP_012146439.1|3502924_3504127_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.3	3.8e-28
>prophage 265
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3512538	3516294	5593263		Skermania_phage(33.33%)	4	NA	NA
WP_153859312.1|3512538_3513510_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0N7CCA3	Skermania_phage	76.5	7.3e-139
WP_167519940.1|3513518_3515663_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.0	2.6e-205
WP_017893761.1|3515644_3516049_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_012146427.1|3516057_3516294_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	54.7	1.5e-18
>prophage 266
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3521781	3522678	5593263		Lactobacillus_phage(100.0%)	1	NA	NA
WP_153859315.1|3521781_3522678_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	28.7	9.7e-05
>prophage 267
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3529109	3529844	5593263		Streptococcus_phage(100.0%)	1	NA	NA
WP_153859323.1|3529109_3529844_-	methyltransferase domain-containing protein	NA	A0A1X9I6N4	Streptococcus_phage	43.2	7.1e-54
>prophage 268
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3541583	3544251	5593263	transposase	Shigella_phage(50.0%)	2	NA	NA
WP_137231231.1|3541583_3542734_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	62.4	5.0e-94
WP_012146396.1|3543768_3544251_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	42.9	9.2e-26
>prophage 269
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3549064	3553744	5593263		Pandoravirus(33.33%)	5	NA	NA
WP_112362805.1|3549064_3549748_-	uracil-DNA glycosylase	NA	S4VYQ4	Pandoravirus	47.0	1.2e-52
WP_012146388.1|3550092_3550476_+	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	70.2	1.2e-31
WP_153859336.1|3550662_3551610_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_153859337.1|3551602_3552358_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_153859338.1|3552418_3553744_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	27.3	1.2e-40
>prophage 270
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3560550	3567379	5593263		Streptococcus_phage(33.33%)	8	NA	NA
WP_012146377.1|3560550_3562347_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.3	2.5e-23
WP_153859345.1|3562383_3563361_+	signal peptidase I	NA	NA	NA	NA	NA
WP_012146375.1|3563543_3564224_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	29.1	4.0e-19
WP_012146374.1|3564220_3565129_+	GTPase Era	NA	NA	NA	NA	NA
WP_153859346.1|3565137_3565869_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_135317639.1|3565941_3566673_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_017893718.1|3566672_3567053_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_085118347.1|3567118_3567379_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.9e-17
>prophage 271
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3575772	3588110	5593263	tRNA	Bacillus_phage(33.33%)	7	NA	NA
WP_153859354.1|3575772_3576285_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	41.7	2.3e-06
WP_153859355.1|3576285_3577746_-	membrane-bound lytic murein transglycosylase MltF	NA	G0YQ82	Erwinia_phage	37.2	2.8e-09
WP_153859356.1|3578025_3581916_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.4	2.6e-126
WP_153859357.1|3582712_3584149_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.1	5.2e-16
WP_153859358.1|3584151_3585024_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_153859359.1|3585020_3586358_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	28.4	5.5e-12
WP_153859360.1|3586487_3588110_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	35.6	8.5e-92
>prophage 272
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3592414	3593443	5593263		Bacillus_virus(100.0%)	1	NA	NA
WP_153859364.1|3592414_3593443_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.5	2.8e-24
>prophage 273
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3601562	3602816	5593263		Aeromonas_phage(100.0%)	1	NA	NA
WP_153859369.1|3601562_3602816_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.3	2.3e-100
>prophage 274
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3609676	3616255	5593263		Faustovirus(20.0%)	8	NA	NA
WP_012146334.1|3609676_3610891_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.5	2.7e-34
WP_012146333.1|3610915_3611302_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.1	3.2e-53
WP_012146332.1|3611357_3611681_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	45.4	1.3e-20
WP_153859374.1|3611744_3612266_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_153859375.1|3612293_3614144_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.7	2.3e-101
WP_006318184.1|3614146_3614482_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_012146329.1|3614494_3614695_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_167519943.1|3614959_3616255_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	31.0	1.9e-33
>prophage 275
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3629350	3629776	5593263		Mollivirus(100.0%)	1	NA	NA
WP_012146321.1|3629350_3629776_+	nucleoside-diphosphate kinase	NA	A0A0M5KH58	Mollivirus	38.8	1.6e-13
>prophage 276
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3646870	3657755	5593263		Gordonia_phage(25.0%)	9	NA	NA
WP_153860933.1|3646870_3648247_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	32.0	4.6e-30
WP_012146304.1|3648417_3649881_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	5.7e-87
WP_153859393.1|3649982_3651560_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_153859394.1|3651708_3652626_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153860934.1|3652815_3653835_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2L2DIY2	Acanthamoeba_polyphaga_mimivirus	29.0	2.0e-30
WP_153859395.1|3654008_3654548_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_153859396.1|3654559_3654934_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_153859397.1|3655060_3655894_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_153859398.1|3655970_3657755_-	response regulator	NA	A0A2K9L0Z8	Tupanvirus	24.1	2.1e-14
>prophage 277
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3670833	3671805	5593263		Tetraselmis_virus(100.0%)	1	NA	NA
WP_153859409.1|3670833_3671805_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.8	5.2e-36
>prophage 278
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3678125	3689834	5593263	tRNA	Bacillus_phage(40.0%)	11	NA	NA
WP_153859415.1|3678125_3679598_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.3	2.0e-39
WP_153859416.1|3679656_3680946_-	MFS transporter	NA	NA	NA	NA	NA
WP_153860935.1|3681034_3682051_-	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_153859417.1|3682065_3683280_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.5	3.7e-47
WP_153859418.1|3683458_3684376_-	lipid kinase YegS	NA	NA	NA	NA	NA
WP_153859419.1|3684864_3686217_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	81.6	3.1e-172
WP_153859420.1|3686395_3686734_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_153859421.1|3687086_3687350_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_153859422.1|3687352_3687739_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_153860936.1|3687735_3688452_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	34.1	1.5e-32
WP_153859423.1|3688451_3689834_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	1.2e-25
>prophage 279
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3703697	3704048	5593263		Escherichia_phage(100.0%)	1	NA	NA
WP_153859432.1|3703697_3704048_-	putative DNA-binding transcriptional regulator	NA	C9DGL1	Escherichia_phage	40.9	3.7e-08
>prophage 280
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3716639	3725801	5593263		Salmonella_phage(28.57%)	15	NA	NA
WP_012146247.1|3716639_3717452_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.2	2.1e-14
WP_012146239.1|3717531_3718086_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_135317534.1|3718231_3718426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112362990.1|3718429_3718699_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_153859439.1|3718749_3719388_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	40.3	5.8e-28
WP_041419010.1|3719387_3720425_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.6	1.5e-70
WP_017893631.1|3720680_3721307_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_153859440.1|3721368_3722664_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.4	1.6e-64
WP_006316897.1|3722717_3722966_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_153859441.1|3723023_3723539_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_153859442.1|3723594_3723798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026142482.1|3723767_3724469_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_153859443.1|3724475_3725015_-	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	59.7	5.4e-51
WP_167519944.1|3725011_3725257_-	hypothetical protein	NA	J9Q735	Salmonella_phage	50.0	3.1e-14
WP_153859444.1|3725447_3725801_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	46.2	7.9e-19
>prophage 281
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3735396	3736110	5593263		Synechococcus_phage(100.0%)	1	NA	NA
WP_135317520.1|3735396_3736110_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	35.2	7.7e-37
>prophage 282
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3748620	3808195	5593263	transposase,tail,head,terminase,portal,holin,integrase,capsid	Cronobacter_phage(43.59%)	64	3757043:3757060	3800730:3800747
WP_153859462.1|3748620_3750660_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	30.8	3.9e-09
WP_112349006.1|3750898_3750958_+	protein YpfM	NA	NA	NA	NA	NA
WP_153859463.1|3751515_3752724_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	79.4	2.7e-183
WP_153859464.1|3752852_3755990_-	multidrug efflux RND transporter permease AcrD	NA	NA	NA	NA	NA
WP_017893610.1|3756272_3756551_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153859465.1|3756577_3757210_-	response regulator	NA	NA	NA	NA	NA
3757043:3757060	attL	CAGGATCACGTCCGGCGT	NA	NA	NA	NA
WP_153859466.1|3757372_3759055_-	nitrate/nitrite two-component system sensor histidine kinase NarQ	NA	NA	NA	NA	NA
WP_153859467.1|3759435_3760798_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.9	9.4e-76
WP_129938735.1|3760929_3761445_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_153859468.1|3762005_3763673_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	41.8	2.4e-121
WP_153859469.1|3763669_3764224_-	hypothetical protein	NA	A5X9J7	Aeromonas_virus	46.7	4.1e-30
WP_153859470.1|3764220_3764922_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	32.3	3.2e-27
WP_153859471.1|3764921_3765422_-|tail	tail fiber assembly protein	tail	Q37843	Escherichia_phage	42.6	3.0e-27
WP_153859472.1|3765424_3766996_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	44.4	2.4e-59
WP_153859473.1|3767083_3767686_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	54.7	2.7e-51
WP_153859474.1|3767678_3768863_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	63.1	6.6e-142
WP_153859475.1|3768852_3769191_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	70.0	4.3e-30
WP_153859476.1|3769183_3771097_-|tail	phage tail tape measure protein	tail	A0A2I7RNI7	Vibrio_phage	38.7	1.5e-103
WP_115058322.1|3771284_3771551_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	51.2	2.5e-17
WP_167519990.1|3771668_3772034_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	45.9	8.2e-11
WP_153859478.1|3772057_3772399_-	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	80.2	7.6e-43
WP_044550294.1|3772385_3772688_-|holin	holin	holin	S4TP56	Salmonella_phage	57.1	2.9e-22
WP_044550297.1|3772692_3773148_-	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	59.6	8.9e-47
WP_153859479.1|3773154_3774276_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	60.9	1.6e-126
WP_153859480.1|3774272_3774986_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	54.9	1.7e-60
WP_153859481.1|3774969_3775467_-|tail	phage tail protein	tail	Q94MZ1	Haemophilus_virus	30.3	1.6e-12
WP_153859482.1|3775463_3775955_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	48.4	6.5e-27
WP_153859483.1|3775951_3776758_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	55.8	3.9e-69
WP_153859484.1|3776760_3777813_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	58.4	1.4e-106
WP_153859485.1|3777870_3778755_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	40.0	8.9e-43
WP_153859486.1|3778926_3780726_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	54.7	7.3e-193
WP_153859487.1|3780722_3781772_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	67.7	1.4e-127
WP_153859488.1|3781774_3783595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153859489.1|3783605_3784433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153859490.1|3784510_3784780_+	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	61.6	7.4e-25
WP_153859491.1|3784806_3785172_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_153859492.1|3785168_3785444_-	addiction module toxin, HicA family	NA	R4JMD3	Burkholderia_phage	46.4	1.4e-15
WP_153859493.1|3785500_3786208_-	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	59.3	1.6e-71
WP_153859494.1|3786331_3786661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153859495.1|3789443_3790253_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A191ZD01	Erwinia_phage	47.0	3.8e-64
WP_153859496.1|3790249_3790870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153859497.1|3791032_3791269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153859498.1|3791359_3791662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071827023.1|3791774_3791948_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_153859499.1|3791947_3792382_-	tellurite resistance protein	NA	Q1MVI3	Enterobacteria_phage	90.6	2.6e-64
WP_153859500.1|3792489_3792714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153859501.1|3792710_3792929_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_153859502.1|3792932_3793181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115058342.1|3793183_3793453_-	regulator	NA	A0A0M4RCW1	Salmonella_phage	63.6	7.6e-30
WP_153859503.1|3793589_3793883_+	transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	59.8	3.3e-26
WP_153859504.1|3793949_3794936_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	64.4	3.6e-117
WP_153859505.1|3795249_3795747_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_167519945.1|3795736_3796003_+	chaperone NapD	NA	NA	NA	NA	NA
WP_153859506.1|3795999_3798486_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_153859507.1|3798541_3798991_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_012146196.1|3799002_3799620_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_153859508.1|3799751_3800327_+	GDP-mannose pyrophosphatase NudK	NA	NA	NA	NA	NA
WP_153859509.1|3800396_3802391_-	transketolase	NA	NA	NA	NA	NA
3800730:3800747	attR	CAGGATCACGTCCGGCGT	NA	NA	NA	NA
WP_153859510.1|3802408_3803359_-	transaldolase	NA	A0A127KNC6	Cyanophage	34.0	3.3e-11
WP_012146190.1|3803644_3804238_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	35.1	1.5e-22
WP_153859511.1|3804642_3805584_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153859512.1|3805681_3807181_-	chitinase	NA	D4N2A3	Lymantria_xylina_nucleopolyhedrovirus	28.9	1.1e-21
WP_153859513.1|3807477_3807804_+|holin	phage holin, lambda family	holin	Q2A0C6	Sodalis_phage	41.5	4.6e-13
WP_135317493.1|3807793_3808195_+	M15 family metallopeptidase	NA	A0A1P8DTR0	Salmonella_phage	63.2	1.9e-40
>prophage 283
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3822177	3844566	5593263		Bacillus_phage(20.0%)	23	NA	NA
WP_112362325.1|3822177_3823077_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	M4ZRP4	Bacillus_phage	28.4	6.3e-12
WP_061808110.1|3823282_3823708_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_153859520.1|3823750_3824149_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	45.8	2.1e-23
WP_153859521.1|3824324_3824789_+	DUF2919 family protein	NA	NA	NA	NA	NA
WP_153859522.1|3824922_3825507_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_153859523.1|3825674_3826574_+	Dyp-type peroxidase	NA	S4VXK8	Pandoravirus	34.1	6.5e-25
WP_153859524.1|3826776_3827799_+	thiosulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_012146168.1|3827798_3828632_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_017893587.1|3828631_3829507_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_153859525.1|3829496_3830585_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	40.7	7.9e-33
WP_153859526.1|3830667_3831549_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	40.3	1.1e-53
WP_012146164.1|3832003_3832684_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_153859527.1|3832689_3834012_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.1	3.5e-19
WP_012146162.1|3834087_3834597_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_012146161.1|3834646_3836374_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	32.9	1.1e-17
WP_004936458.1|3836420_3836678_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_012146160.1|3837073_3838042_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	52.1	8.2e-74
WP_153859528.1|3838226_3838988_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_135317470.1|3839209_3840208_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_153859529.1|3840286_3842308_+	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	48.5	5.8e-138
WP_012146156.1|3842307_3842523_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_153859530.1|3842557_3843550_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_153859531.1|3843645_3844566_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	22.3	4.3e-08
>prophage 284
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3859773	3864736	5593263		Tupanvirus(50.0%)	2	NA	NA
WP_153859543.1|3859773_3863718_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	24.1	5.3e-63
WP_153859544.1|3863932_3864736_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	24.3	4.6e-14
>prophage 285
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3881674	3883336	5593263		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_153859557.1|3881674_3883336_+	indolepyruvate decarboxylase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	22.8	1.0e-15
>prophage 286
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3896371	3896896	5593263		Escherichia_phage(100.0%)	1	NA	NA
WP_153859567.1|3896371_3896896_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	51.9	7.6e-26
>prophage 287
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3904975	3942637	5593263	tail,terminase,integrase	uncultured_Caudovirales_phage(30.0%)	37	3904755:3904781	3940666:3940692
3904755:3904781	attL	TTGTTATATCCGTTTAACTACGGGGAC	NA	NA	NA	NA
WP_153859575.1|3904975_3906145_+|integrase	tyrosine-type recombinase/integrase	integrase	G3CFG6	Escherichia_phage	81.5	8.6e-195
WP_153859576.1|3906128_3906311_-	DNA-binding protein	NA	G3CFG7	Escherichia_phage	63.3	3.2e-16
WP_153859577.1|3906312_3907707_-	ATP-dependent helicase	NA	Q3LZN8	Bacteriophage	75.8	9.9e-214
WP_153859578.1|3907819_3908089_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	68.5	2.9e-29
WP_153859579.1|3908095_3910192_-	DNA polymerase I	NA	Q775A3	Bordetella_phage	65.9	3.3e-269
WP_153859580.1|3910275_3911055_-	DUF2303 family protein	NA	I6NVL7	Burkholderia_virus	37.6	4.6e-35
WP_153859581.1|3911109_3911490_-	hypothetical protein	NA	A0A1B3AYR5	Gordonia_phage	42.6	4.4e-07
WP_153859582.1|3911545_3912094_-	DUF2815 family protein	NA	Q3LZQ2	Bacteriophage	60.1	9.1e-54
WP_153859583.1|3912105_3913422_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	56.2	2.3e-135
WP_153859584.1|3913424_3914291_-	hypothetical protein	NA	Q3LZP9	Bacteriophage	31.0	7.0e-16
WP_153859585.1|3915448_3915631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153859586.1|3915655_3915853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153859587.1|3916122_3916752_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	42.0	1.4e-34
WP_153859588.1|3916859_3917081_+	helix-turn-helix domain-containing protein	NA	Q716D6	Shigella_phage	56.5	1.9e-10
WP_153859589.1|3917084_3919250_+	replication protein	NA	B6SD24	Bacteriophage	72.4	2.7e-170
WP_153859590.1|3919572_3919809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153859591.1|3920092_3920545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153859592.1|3920555_3920780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153859593.1|3920783_3922409_+|tail	phage tail protein	tail	A0A2H4J3N6	uncultured_Caudovirales_phage	59.0	5.1e-177
WP_153859594.1|3922405_3922639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153859595.1|3922625_3923447_+	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	43.0	2.1e-46
WP_153859596.1|3923664_3924570_+	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	38.5	1.2e-42
WP_153859597.1|3924625_3925189_+	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	51.9	4.3e-51
WP_153859598.1|3925188_3927183_+	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	48.3	3.6e-185
WP_153859599.1|3927185_3927635_+	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	43.6	1.0e-23
WP_153859600.1|3927637_3928168_+	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	46.2	1.3e-09
WP_153859601.1|3928167_3930873_+	transglycosylase SLT domain-containing protein	NA	G9L6D3	Escherichia_phage	59.5	3.2e-301
WP_153859602.1|3930872_3933764_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	74.4	0.0e+00
WP_153859603.1|3933828_3934170_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	46.4	3.4e-19
WP_153859604.1|3934169_3935780_+|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	71.2	7.4e-229
WP_153859605.1|3935793_3937848_+	hypothetical protein	NA	T1S9Y2	Salmonella_phage	32.7	8.7e-41
WP_167519946.1|3937886_3939011_-	acyltransferase family protein	NA	C6ZR20	Salmonella_phage	26.4	3.0e-11
WP_153859607.1|3939467_3939974_+	glycoside hydrolase family protein	NA	I6PBN2	Cronobacter_phage	62.1	4.0e-48
WP_153859608.1|3939958_3940333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153859609.1|3940329_3940587_+	hypothetical protein	NA	A0A248XCT8	Klebsiella_phage	58.1	4.6e-16
WP_153859610.1|3940821_3941751_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	70.6	2.2e-108
3940666:3940692	attR	TTGTTATATCCGTTTAACTACGGGGAC	NA	NA	NA	NA
WP_153859611.1|3942004_3942637_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	W5SAS9	Pithovirus	26.2	9.6e-07
>prophage 288
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3958322	3959408	5593263		Pandoravirus(100.0%)	1	NA	NA
WP_012146087.1|3958322_3959408_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.4	2.0e-89
>prophage 289
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3975138	3976371	5593263		Brevibacillus_phage(100.0%)	1	NA	NA
WP_153859633.1|3975138_3976371_-	peptidase T	NA	A0A0K2CPK3	Brevibacillus_phage	39.1	2.1e-05
>prophage 290
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3987154	3987784	5593263		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_153859643.1|3987154_3987784_+	antibiotic acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	31.8	3.6e-14
>prophage 291
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3991789	3992464	5593263		Bacillus_phage(100.0%)	1	NA	NA
WP_153859646.1|3991789_3992464_+	transcriptional regulator TctD	NA	W8CYM9	Bacillus_phage	33.5	5.6e-29
>prophage 292
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	3995712	3996834	5593263		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_153859650.1|3995712_3996834_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.6	6.7e-19
>prophage 293
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4003552	4005070	5593263		Mollivirus(100.0%)	1	NA	NA
WP_012146042.1|4003552_4005070_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	7.5e-90
>prophage 294
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4008349	4009123	5593263		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_012146037.1|4008349_4009123_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	27.7	1.8e-07
>prophage 295
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4017636	4020853	5593263		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_153859662.1|4017636_4018293_+	sugar phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	25.7	4.8e-09
WP_153859663.1|4018345_4020223_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_017893493.1|4020253_4020853_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	33.8	1.7e-05
>prophage 296
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4039873	4040239	5593263		Burkholderia_phage(100.0%)	1	NA	NA
WP_153859669.1|4039873_4040239_-	helix-turn-helix domain-containing protein	NA	A0A1S5NNJ5	Burkholderia_phage	37.1	1.0e-08
>prophage 297
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4069960	4071397	5593263		Tupanvirus(100.0%)	1	NA	NA
WP_153859687.1|4069960_4071397_-	catalase	NA	A0A2K9L0T1	Tupanvirus	38.5	4.0e-101
>prophage 298
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4075409	4092740	5593263		Pseudomonas_phage(28.57%)	10	NA	NA
WP_153859690.1|4075409_4075670_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	65.1	3.8e-18
WP_012145987.1|4075673_4076804_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	1.5e-172
WP_012145986.1|4076874_4079163_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.9	1.4e-286
WP_012145985.1|4079600_4080326_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_153859691.1|4080538_4083187_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.7	1.3e-105
WP_153859692.1|4083350_4086224_+	two-component system sensor histidine kinase RcsC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.5	9.0e-36
WP_004947156.1|4086275_4086926_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_153859693.1|4086918_4089621_-	phosphotransferase RcsD	NA	A0A1V0SGX0	Hokovirus	25.6	1.1e-14
WP_153859694.1|4089642_4090797_-	MFS transporter	NA	NA	NA	NA	NA
WP_153859695.1|4091627_4092740_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.6	1.2e-113
>prophage 299
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4100254	4108376	5593263		Vibrio_phage(50.0%)	7	NA	NA
WP_130381454.1|4100254_4101265_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	4.8e-85
WP_012145970.1|4101349_4101634_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_153859703.1|4101796_4103554_-	DEAD/DEAH box helicase family protein	NA	M4Q3N1	Vibrio_phage	42.6	5.1e-98
WP_153859704.1|4103863_4104577_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_129939562.1|4104616_4105825_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	26.2	8.8e-25
WP_135317298.1|4106429_4106774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153859705.1|4106783_4108376_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.1	2.5e-19
>prophage 300
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4114325	4119211	5593263		Clostridioides_phage(50.0%)	5	NA	NA
WP_012145960.1|4114325_4114901_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	30.1	3.7e-13
WP_153859710.1|4115309_4116020_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_153859711.1|4116071_4117046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017893444.1|4117343_4117652_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_153859712.1|4117729_4119211_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.2	1.4e-45
>prophage 301
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4124766	4127247	5593263		Escherichia_phage(100.0%)	1	NA	NA
WP_153859716.1|4124766_4127247_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	32.0	3.7e-86
>prophage 302
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4133367	4134207	5593263		Catovirus(100.0%)	1	NA	NA
WP_153859721.1|4133367_4134207_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.0	2.3e-24
>prophage 303
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4140819	4147674	5593263		Indivirus(33.33%)	5	NA	NA
WP_153859725.1|4140819_4141608_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	25.1	2.8e-11
WP_153859726.1|4141706_4142633_-	EamA family transporter	NA	NA	NA	NA	NA
WP_153859727.1|4142920_4144909_-	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	30.4	9.4e-08
WP_012145935.1|4145170_4146166_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_153859728.1|4146162_4147674_-	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.4	2.5e-08
>prophage 304
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4155612	4156359	5593263		Escherichia_phage(100.0%)	1	NA	NA
WP_153859733.1|4155612_4156359_-	peptidase	NA	A0A0N7C1P9	Escherichia_phage	43.0	4.0e-44
>prophage 305
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4171146	4173418	5593263		Cedratvirus(33.33%)	3	NA	NA
WP_012145916.1|4171146_4172022_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.5	6.8e-11
WP_153859742.1|4172018_4172735_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	1.6e-13
WP_153859743.1|4172731_4173418_-	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	S4VR59	Pandoravirus	37.6	3.0e-22
>prophage 306
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4178487	4179309	5593263		Mycobacterium_virus(100.0%)	1	NA	NA
WP_153859748.1|4178487_4179309_+	alpha/beta fold hydrolase	NA	J7KIT2	Mycobacterium_virus	27.2	3.3e-15
>prophage 307
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4188723	4190019	5593263		Burkholderia_virus(100.0%)	1	NA	NA
WP_153859757.1|4188723_4190019_-	tricarballylate/proton symporter TcuC	NA	Q6JIH2	Burkholderia_virus	36.6	1.3e-63
>prophage 308
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4195821	4198911	5593263		Herpes_simplex_virus(100.0%)	1	NA	NA
WP_153859763.1|4195821_4198911_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	65.9	0.0e+00
>prophage 309
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4216149	4217823	5593263		Planktothrix_phage(100.0%)	1	NA	NA
WP_153859779.1|4216149_4217823_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	1.0e-18
>prophage 310
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4245954	4246710	5593263		Bacillus_virus(100.0%)	1	NA	NA
WP_153859805.1|4245954_4246710_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	37.3	1.6e-24
>prophage 311
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4251813	4252875	5593263		Bacillus_virus(100.0%)	1	NA	NA
WP_153859811.1|4251813_4252875_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	36.1	6.7e-29
>prophage 312
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4266082	4271127	5593263		Cronobacter_phage(50.0%)	2	NA	NA
WP_153859823.1|4266082_4268752_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.4	3.8e-97
WP_153859824.1|4268748_4271127_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.2	6.4e-19
>prophage 313
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4290411	4291242	5593263		Spodoptera_litura_multicapsid_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_153859840.1|4290411_4291242_-	chitin-binding protein	NA	Q91BI7	Spodoptera_litura_multicapsid_nucleopolyhedrovirus	35.5	7.1e-34
>prophage 314
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4300197	4302114	5593263		Acinetobacter_phage(100.0%)	1	NA	NA
WP_153859847.1|4300197_4302114_+	hypothetical protein	NA	U5PW98	Acinetobacter_phage	30.2	4.1e-08
>prophage 315
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4312210	4313695	5593263		Streptococcus_phage(100.0%)	1	NA	NA
WP_153859858.1|4312210_4313695_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A1X9I5H2	Streptococcus_phage	29.0	1.5e-13
>prophage 316
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4321467	4322526	5593263		Synechococcus_phage(100.0%)	1	NA	NA
WP_153859864.1|4321467_4322526_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	C7BUZ5	Synechococcus_phage	43.0	2.6e-09
>prophage 317
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4340585	4340798	5593263		Morganella_phage(100.0%)	1	NA	NA
WP_004946278.1|4340585_4340798_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.6	5.8e-25
>prophage 318
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4349483	4353080	5593263		Bacillus_virus(50.0%)	2	NA	NA
WP_044552178.1|4349483_4350182_+	MgtC family protein	NA	G3MA03	Bacillus_virus	37.7	8.9e-14
WP_153859886.1|4350380_4353080_+	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	23.0	1.7e-36
>prophage 319
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4372986	4374859	5593263		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_153859902.1|4372986_4373874_+	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	34.5	1.1e-35
WP_153859903.1|4373857_4374859_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	38.9	7.9e-56
>prophage 320
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4382802	4388980	5593263		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_153859913.1|4382802_4384740_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	35.5	5.7e-18
WP_153859914.1|4384825_4386268_-	protein kinase	NA	M1GVZ0	Acanthocystis_turfacea_Chlorella_virus	25.7	3.6e-09
WP_153859915.1|4386316_4388980_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.1	2.7e-82
>prophage 321
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4421843	4427830	5593263		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_153859933.1|4421843_4423514_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.4	2.8e-13
WP_153859934.1|4423613_4425239_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.5	2.3e-12
WP_026142427.1|4425267_4426140_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_153859935.1|4426139_4427189_+	chemotaxis-specific protein-glutamate methyltransferase CheB	NA	Q56AR1	Bacillus_thuringiensis_phage	34.4	1.3e-05
WP_012145701.1|4427440_4427830_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	30.4	1.3e-06
>prophage 322
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4441570	4442527	5593263		Bacillus_phage(100.0%)	1	NA	NA
WP_153859950.1|4441570_4442527_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	Q9ZXE4	Bacillus_phage	36.3	3.8e-15
>prophage 323
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4471072	4472482	5593263		Acinetobacter_phage(66.67%)	3	NA	NA
WP_012145656.1|4471072_4471825_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G9BWD6	Planktothrix_phage	41.5	1.7e-34
WP_153859972.1|4471856_4472270_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	35.8	1.6e-18
WP_153859973.1|4472299_4472482_-	addiction module toxin, HicA family	NA	A0A0D4DC32	Acinetobacter_phage	50.8	3.3e-13
>prophage 324
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4482557	4491324	5593263		Escherichia_phage(50.0%)	6	NA	NA
WP_153859979.1|4482557_4484705_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	68.9	1.1e-139
WP_004945903.1|4485389_4486175_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	74.9	1.2e-91
WP_153859980.1|4486247_4487117_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	28.2	8.5e-06
WP_167519992.1|4487122_4487680_-	4Fe-4S binding protein	NA	A0A077SL61	Escherichia_phage	41.0	6.4e-39
WP_153859981.1|4487679_4490013_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	24.6	2.7e-38
WP_153859982.1|4490421_4491324_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.7	2.2e-36
>prophage 325
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4500023	4501528	5593263		Planktothrix_phage(100.0%)	2	NA	NA
WP_153859989.1|4500023_4500860_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.8	1.2e-12
WP_153859990.1|4500856_4501528_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.3	2.3e-27
>prophage 326
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4507268	4508057	5593263		Bacillus_virus(100.0%)	1	NA	NA
WP_153859995.1|4507268_4508057_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.5	2.9e-29
>prophage 327
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4534602	4535346	5593263		Catovirus(100.0%)	1	NA	NA
WP_153860012.1|4534602_4535346_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.0	3.2e-09
>prophage 328
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4544754	4546299	5593263		Escherichia_phage(100.0%)	1	NA	NA
WP_153860018.1|4544754_4546299_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	43.6	1.6e-18
>prophage 329
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4554441	4555038	5593263	integrase	Escherichia_phage(100.0%)	1	4546713:4546728	4561184:4561199
4546713:4546728	attL	CTGGCGCTGTTGGGCG	NA	NA	NA	NA
WP_153860025.1|4554441_4555038_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	50.5	1.0e-50
WP_153860025.1|4554441_4555038_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	50.5	1.0e-50
4561184:4561199	attR	CTGGCGCTGTTGGGCG	NA	NA	NA	NA
>prophage 330
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4572050	4579746	5593263		Planktothrix_phage(60.0%)	7	NA	NA
WP_153860040.1|4572050_4573037_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.4	1.5e-14
WP_153860041.1|4573026_4573995_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.6	4.1e-17
WP_099064322.1|4573996_4574971_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	40.3	5.7e-59
WP_153860042.1|4575213_4576140_+	asparaginase	NA	NA	NA	NA	NA
WP_153860956.1|4576149_4577151_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_153860043.1|4577203_4578337_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.5	4.4e-26
WP_153860044.1|4578336_4579746_-	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	33.2	1.3e-35
>prophage 331
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4583802	4585017	5593263		Klosneuvirus(100.0%)	1	NA	NA
WP_153860049.1|4583802_4585017_+	bifunctional succinylornithine transaminase/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	1.5e-27
>prophage 332
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4590649	4593036	5593263		Enterobacteria_phage(50.0%)	4	NA	NA
WP_167519995.1|4590649_4591729_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	54.6	2.6e-105
WP_153860055.1|4591816_4592041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012145560.1|4592171_4592363_-	YebW family protein	NA	NA	NA	NA	NA
WP_153860056.1|4592589_4593036_+	peptidoglycan-binding protein LysM	NA	A0A1V0DZX0	Clostridioides_phage	44.4	2.8e-05
>prophage 333
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4598107	4598422	5593263		Pseudoalteromonas_phage(100.0%)	1	NA	NA
WP_012145550.1|4598107_4598422_+	DUF2591 family protein	NA	A0A0K0MDE9	Pseudoalteromonas_phage	35.5	2.4e-06
>prophage 334
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4602854	4603064	5593263		Morganella_phage(100.0%)	1	NA	NA
WP_002221949.1|4602854_4603064_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	5.3e-23
>prophage 335
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4609760	4611305	5593263		Moraxella_phage(100.0%)	1	NA	NA
WP_153860066.1|4609760_4611305_+	CBS domain-containing protein	NA	A0A0R6PEZ3	Moraxella_phage	46.1	2.7e-39
>prophage 336
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4615592	4625187	5593263		Pandoravirus(25.0%)	10	NA	NA
WP_153860069.1|4615592_4616966_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	31.7	6.4e-40
WP_153860070.1|4617407_4618415_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	27.8	4.4e-06
WP_012145530.1|4618478_4618724_+	YoaH family protein	NA	NA	NA	NA	NA
WP_153860071.1|4618757_4619936_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_012145528.1|4620178_4621561_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	9.3e-55
WP_153860072.1|4621649_4621973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153860073.1|4622012_4622321_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_153860074.1|4622391_4622751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012145524.1|4622844_4623408_-	lipoprotein	NA	NA	NA	NA	NA
WP_153860075.1|4623546_4625187_-	phosphotransferase	NA	A0A2P0VMP1	Tetraselmis_virus	23.8	2.7e-21
>prophage 337
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4631762	4633493	5593263	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_112363967.1|4631762_4633493_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L2F0	Tupanvirus	34.3	2.5e-89
>prophage 338
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4639357	4650683	5593263	tRNA	Bacillus_virus(33.33%)	13	NA	NA
WP_153860088.1|4639357_4640173_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	72.4	8.2e-51
WP_153860089.1|4640247_4640826_-	hydrolase	NA	NA	NA	NA	NA
WP_012145506.1|4641067_4641259_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_153860090.1|4641342_4643124_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	26.5	5.8e-09
WP_017893088.1|4643123_4643570_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_012145503.1|4643589_4644333_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012145502.1|4644406_4644928_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	28.4	4.9e-09
WP_153860091.1|4645040_4645655_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_012145500.1|4645675_4646680_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	27.8	8.1e-08
WP_153860092.1|4646754_4647540_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_153860093.1|4647536_4648295_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	32.7	1.3e-18
WP_153860094.1|4648373_4649339_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_153860095.1|4649360_4650683_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.8e-15
>prophage 339
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4655705	4665032	5593263	tRNA	Cyanophage(33.33%)	9	NA	NA
WP_012145492.1|4655705_4657181_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	1.6e-81
WP_153860099.1|4657333_4657975_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_167519952.1|4658538_4658907_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_012145489.1|4658893_4659223_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_153860100.1|4659280_4659625_-	RidA family protein	NA	NA	NA	NA	NA
WP_153860101.1|4659758_4661663_+	DEAD/DEAH box helicase family protein	NA	A0A127AW80	Bacillus_phage	31.9	3.2e-90
WP_153860102.1|4661743_4662445_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_153860103.1|4662545_4663136_+	Slp/YeaY family lipoprotein	NA	NA	NA	NA	NA
WP_153860104.1|4663343_4665032_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	6.5e-34
>prophage 340
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4671758	4715456	5593263	transposase,terminase,holin,capsid,plate	Erwinia_phage(47.17%)	70	NA	NA
WP_153860108.1|4671758_4673042_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	56.4	3.1e-137
WP_153860109.1|4673073_4673322_-	DUF1233 family excisionase	NA	S4TND0	Salmonella_phage	54.8	7.3e-19
WP_153860110.1|4673321_4673546_-	hypothetical protein	NA	A0A2H4J398	uncultured_Caudovirales_phage	59.2	3.6e-17
WP_137231231.1|4673870_4675021_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	62.4	5.0e-94
WP_153860111.1|4675093_4675636_-	HNH endonuclease	NA	D6PIK0	uncultured_phage	40.6	3.5e-26
WP_153860112.1|4675637_4676054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167519953.1|4676050_4676317_-	hypothetical protein	NA	K4FB20	Cronobacter_phage	67.9	2.0e-27
WP_153860114.1|4676497_4676638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153860115.1|4676630_4677161_-	hypothetical protein	NA	A0A0H4IQ56	Shigella_phage	69.1	1.2e-63
WP_153860116.1|4677147_4677441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153860117.1|4677437_4677764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153860960.1|4677828_4678008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153860118.1|4678202_4678685_-	hypothetical protein	NA	G8C7S9	Escherichia_phage	67.5	1.5e-55
WP_153860119.1|4678681_4679578_-	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	72.4	9.1e-120
WP_153860120.1|4679577_4679868_-	host nuclease inhibitor GamL	NA	NA	NA	NA	NA
WP_167519954.1|4679864_4680035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153860121.1|4680211_4680415_-	DUF551 domain-containing protein	NA	A0A2D2W4W0	Escherichia_phage	43.5	7.5e-06
WP_153860122.1|4680407_4680725_-	hypothetical protein	NA	R9TNI1	Aeromonas_phage	51.0	5.6e-16
WP_167519955.1|4680849_4681086_-	hypothetical protein	NA	I6S1T3	Salmonella_phage	71.8	4.5e-26
WP_153860124.1|4681927_4682386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153860125.1|4682691_4682901_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	73.1	1.0e-18
WP_153860126.1|4683543_4683894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153860961.1|4683939_4684590_-	helix-turn-helix domain-containing protein	NA	I6R0S2	Salmonella_phage	62.7	4.8e-78
WP_153860127.1|4684698_4684908_+	helix-turn-helix domain-containing protein	NA	I6S1U2	Salmonella_phage	79.7	2.7e-27
WP_153860128.1|4685022_4685325_+	hypothetical protein	NA	E5AGE8	Erwinia_phage	54.0	3.3e-21
WP_153860129.1|4685333_4685762_+	HNH endonuclease	NA	A0A0P0ICV0	Acinetobacter_phage	43.6	1.2e-29
WP_167519956.1|4685827_4685989_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	63.5	8.9e-10
WP_153860130.1|4685975_4686875_+	DNA replication protein	NA	F1C5C3	Cronobacter_phage	62.9	8.3e-105
WP_153860131.1|4686864_4688268_+	AAA family ATPase	NA	F1C5C4	Cronobacter_phage	62.5	4.7e-163
WP_149572826.1|4688267_4688435_+	hypothetical protein	NA	G3M9Z9	Bacillus_virus	53.5	1.1e-05
WP_153860132.1|4688427_4688817_+	hypothetical protein	NA	A0A2H4N7C3	Pectobacterium_phage	62.7	6.5e-22
WP_153860133.1|4688819_4689017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153860134.1|4689026_4689494_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	53.4	2.6e-41
WP_153860135.1|4689493_4689673_+	NinE family protein	NA	NA	NA	NA	NA
WP_167519957.1|4689833_4689953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167519958.1|4689945_4690575_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	53.8	3.3e-60
WP_153860138.1|4690571_4690799_+	hypothetical protein	NA	E5AGG2	Erwinia_phage	66.7	2.1e-25
WP_153860139.1|4690989_4691604_+	hypothetical protein	NA	F1C5D0	Cronobacter_phage	58.2	6.8e-58
WP_153860140.1|4691867_4692398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153860141.1|4692560_4692881_+|holin	holin	holin	F1C5D1	Cronobacter_phage	80.4	1.3e-41
WP_153860142.1|4692867_4693332_+	glycoside hydrolase family protein	NA	K7P890	Enterobacteria_phage	74.3	7.4e-57
WP_153860143.1|4693340_4693751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153860144.1|4694052_4694739_+	hypothetical protein	NA	A0A192Y918	Salmonella_phage	86.4	3.5e-111
WP_153860145.1|4694968_4695133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153860146.1|4695212_4695656_+	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	81.2	2.3e-55
WP_153860147.1|4695652_4697212_+|terminase	phage terminase large subunit	terminase	E5AGA3	Erwinia_phage	94.6	1.4e-296
WP_153860148.1|4697220_4698477_+	DUF1073 domain-containing protein	NA	E5AGA4	Erwinia_phage	62.2	2.9e-148
WP_153860149.1|4698466_4699276_+|capsid	minor capsid protein	capsid	E5AGA5	Erwinia_phage	61.3	2.8e-96
WP_153860150.1|4699288_4700470_+	DUF2213 domain-containing protein	NA	E5AGA6	Erwinia_phage	53.1	4.2e-104
WP_153860151.1|4700469_4700982_+	hypothetical protein	NA	E5AGA7	Erwinia_phage	58.8	1.0e-43
WP_153860152.1|4700993_4701932_+	DUF2184 domain-containing protein	NA	E5AGA8	Erwinia_phage	76.6	8.9e-134
WP_129938650.1|4701964_4702162_+	hypothetical protein	NA	E5AGA9	Erwinia_phage	69.4	6.0e-16
WP_153860153.1|4702161_4702569_+	DUF4054 domain-containing protein	NA	E5AGB0	Erwinia_phage	78.5	7.2e-56
WP_153860154.1|4702559_4703021_+	hypothetical protein	NA	E5AGB1	Erwinia_phage	60.8	4.5e-46
WP_153860155.1|4703017_4703362_+	hypothetical protein	NA	E5AGB2	Erwinia_phage	78.1	7.2e-49
WP_153860156.1|4703354_4703903_+	hypothetical protein	NA	E5AGB3	Erwinia_phage	72.5	1.9e-67
WP_153860157.1|4703915_4705256_+	DUF3383 family protein	NA	E5AGB4	Erwinia_phage	74.0	1.6e-184
WP_153860158.1|4705258_4705705_+	DUF3277 family protein	NA	E5AGB5	Erwinia_phage	86.5	7.3e-70
WP_153860159.1|4705740_4706178_+	hypothetical protein	NA	E5AGB6	Erwinia_phage	80.7	5.2e-60
WP_153860160.1|4706339_4707914_+	tape measure protein	NA	E5AGB7	Erwinia_phage	38.2	1.8e-86
WP_153860161.1|4707915_4708617_+	hypothetical protein	NA	E5AGB8	Erwinia_phage	63.8	7.7e-74
WP_153860162.1|4708695_4709313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153860163.1|4709466_4709973_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_153860164.1|4710049_4710385_+	hypothetical protein	NA	E5AGB9	Erwinia_phage	60.7	8.0e-37
WP_153860165.1|4710368_4711304_+	hypothetical protein	NA	E5AGC0	Erwinia_phage	81.0	2.4e-139
WP_153860166.1|4711303_4711978_+|plate	baseplate assembly protein	plate	E5AGC1	Erwinia_phage	70.1	4.3e-90
WP_153860167.1|4712381_4713800_+	hypothetical protein	NA	E5AGC3	Erwinia_phage	67.2	1.4e-175
WP_153860168.1|4713792_4714566_+	hypothetical protein	NA	E5AGC4	Erwinia_phage	62.8	4.4e-86
WP_153860169.1|4714572_4714806_+	phosphoglycolate phosphatase	NA	E5AGC5	Erwinia_phage	69.9	5.1e-22
WP_153860170.1|4714805_4715456_+	hypothetical protein	NA	E5AGC6	Erwinia_phage	43.8	4.2e-42
>prophage 341
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4727465	4729329	5593263		Salmonella_phage(50.0%)	2	NA	NA
WP_153860178.1|4727465_4728659_-	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	27.6	4.6e-26
WP_153860179.1|4728768_4729329_-	3'-5' exoribonuclease	NA	A0A2I7R065	Vibrio_phage	46.3	1.9e-38
>prophage 342
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4732636	4734242	5593263		Planktothrix_phage(100.0%)	2	NA	NA
WP_153860182.1|4732636_4733419_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.7	2.6e-14
WP_153860183.1|4733432_4734242_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.9	7.2e-15
>prophage 343
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4741227	4742496	5593263		Bacillus_phage(100.0%)	1	NA	NA
WP_112364545.1|4741227_4742496_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	32.2	2.0e-11
>prophage 344
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4748892	4754025	5593263		Artogeia_rapae_granulovirus(33.33%)	4	NA	NA
WP_153860193.1|4748892_4750173_-	chitinase	NA	D2J4H7	Artogeia_rapae_granulovirus	28.6	7.6e-27
WP_153860194.1|4750403_4751036_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.8	8.9e-21
WP_153860195.1|4751058_4752075_-	asparaginase	NA	NA	NA	NA	NA
WP_153860196.1|4752168_4754025_-	signal peptide peptidase SppA	NA	K4HZZ6	Acidithiobacillus_phage	26.2	1.4e-08
>prophage 345
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4757055	4770998	5593263		Bacillus_phage(33.33%)	14	NA	NA
WP_165366350.1|4757055_4758981_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	28.9	1.1e-37
WP_153860200.1|4758977_4759271_+	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_153860201.1|4759280_4759682_-	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_153860202.1|4759727_4760534_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_153860203.1|4760637_4761210_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.6	1.7e-18
WP_012145438.1|4761961_4762810_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	42.7	1.6e-12
WP_153860204.1|4762937_4763402_-	YchJ family protein	NA	NA	NA	NA	NA
WP_153860205.1|4763544_4764450_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_153860206.1|4764555_4765569_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_153860207.1|4765767_4766685_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	45.4	2.2e-60
WP_153860208.1|4766728_4768072_+	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	37.8	6.2e-80
WP_153860209.1|4768081_4769092_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006321188.1|4769309_4769717_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_153860210.1|4770413_4770998_+	thymidine kinase	NA	A0A0A0Q2F0	Pectobacterium_bacteriophage	52.6	9.0e-52
>prophage 346
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4781022	4783037	5593263		Planktothrix_phage(50.0%)	2	NA	NA
WP_153860214.1|4781022_4782039_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	30.7	4.1e-15
WP_153860215.1|4782035_4783037_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 347
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4799185	4800889	5593263		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_153860228.1|4799185_4800889_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	28.1	8.6e-18
>prophage 348
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4805296	4808257	5593263		Acinetobacter_phage(100.0%)	3	NA	NA
WP_153860231.1|4805296_4806661_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.1	1.6e-38
WP_153860232.1|4806661_4807660_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	2.5e-54
WP_153860233.1|4807675_4808257_-	C26 family cysteine hydrolase domain-containing family	NA	A0A0P0IKJ1	Acinetobacter_phage	37.0	1.3e-29
>prophage 349
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4815986	4823396	5593263	protease,transposase	Bodo_saltans_virus(33.33%)	5	NA	NA
WP_153860241.1|4815986_4817033_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.0	2.3e-21
WP_153860242.1|4817285_4817537_-	DUF2498 family protein	NA	NA	NA	NA	NA
WP_153860243.1|4817963_4820561_+	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.0	1.7e-89
WP_153860244.1|4820920_4821895_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_137231231.1|4822245_4823396_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	62.4	5.0e-94
>prophage 350
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4828104	4828698	5593263		Staphylococcus_phage(100.0%)	1	NA	NA
WP_012145380.1|4828104_4828698_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.8	1.1e-39
>prophage 351
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4836035	4840184	5593263		Escherichia_phage(50.0%)	3	NA	NA
WP_153860253.1|4836035_4838468_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A193GZ98	Escherichia_phage	37.5	1.8e-08
WP_153860254.1|4838472_4839372_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_153860255.1|4839518_4840184_+	fructose-6-phosphate aldolase	NA	M4QS02	Synechococcus_phage	32.2	1.4e-24
>prophage 352
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4845120	4847055	5593263		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_153860259.1|4845120_4847055_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	29.0	7.2e-05
>prophage 353
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4851325	4856943	5593263		Planktothrix_phage(66.67%)	5	NA	NA
WP_153860263.1|4851325_4852495_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	59.6	3.7e-129
WP_153860264.1|4852575_4853472_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153860265.1|4853472_4854663_-	peroxidase-related enzyme	NA	NA	NA	NA	NA
WP_012145361.1|4855136_4855949_-	peptide ABC transporter ATP-binding protein SapF	NA	G9BWD6	Planktothrix_phage	28.7	3.6e-14
WP_012145360.1|4855950_4856943_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	29.1	8.8e-07
>prophage 354
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4878669	4881420	5593263	tRNA	Escherichia_phage(33.33%)	3	NA	NA
WP_012145335.1|4878669_4879602_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	90.6	1.6e-135
WP_153860282.1|4879729_4880998_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	68.2	2.8e-167
WP_012145333.1|4880997_4881420_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	56.0	4.1e-30
>prophage 355
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4887082	4888075	5593263		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_012145328.1|4887082_4888075_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	44.5	2.2e-66
>prophage 356
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4892852	4896740	5593263		Catovirus(100.0%)	1	NA	NA
WP_153860290.1|4892852_4896740_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.9	2.0e-54
>prophage 357
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4902062	4903367	5593263		Bacillus_phage(100.0%)	1	NA	NA
WP_153860296.1|4902062_4903367_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	27.1	5.9e-19
>prophage 358
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4913649	4914174	5593263		Streptococcus_phage(100.0%)	1	NA	NA
WP_112362869.1|4913649_4914174_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	40.4	1.4e-24
>prophage 359
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4920463	4921576	5593263		Cedratvirus(100.0%)	1	NA	NA
WP_153860308.1|4920463_4921576_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	A0A285PWH2	Cedratvirus	27.8	1.9e-13
>prophage 360
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4935657	4936807	5593263	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_137231231.1|4935657_4936807_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	62.4	5.0e-94
>prophage 361
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4944656	4946133	5593263		Staphylococcus_phage(100.0%)	2	NA	NA
WP_153860330.1|4944656_4945370_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.7	2.8e-10
WP_153860331.1|4945362_4946133_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	3.2e-20
>prophage 362
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4949353	4951231	5593263		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_153860334.1|4949353_4951231_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	31.1	6.4e-75
>prophage 363
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4954869	4956414	5593263	transposase	Acidithiobacillus_phage(100.0%)	1	NA	NA
WP_153858541.1|4954869_4956414_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	1.0e-126
>prophage 364
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4962850	4966217	5593263		Streptococcus_phage(50.0%)	2	NA	NA
WP_153860341.1|4962850_4964956_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.4	3.4e-56
WP_153860342.1|4965179_4966217_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.2	1.7e-21
>prophage 365
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4974196	4975924	5593263		Tupanvirus(100.0%)	1	NA	NA
WP_153860349.1|4974196_4975924_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	25.4	1.5e-38
>prophage 366
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	4984834	4985950	5593263		Planktothrix_phage(100.0%)	1	NA	NA
WP_153860355.1|4984834_4985950_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.5	1.5e-23
>prophage 367
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5013955	5014906	5593263		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_153860375.1|5013955_5014906_-	2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	24.1	1.7e-15
>prophage 368
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5026801	5027929	5593263		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_153860385.1|5026801_5027929_+	agmatine deiminase family protein	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	32.4	1.5e-42
>prophage 369
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5037568	5039107	5593263		Hepacivirus(100.0%)	1	NA	NA
WP_153860392.1|5037568_5039107_+	long-chain-fatty-acid--CoA ligase	NA	Q75ZG1	Hepacivirus	28.7	1.7e-41
>prophage 370
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5052939	5053725	5593263		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_153860403.1|5052939_5053725_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	31.7	2.5e-20
>prophage 371
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5067849	5068824	5593263		Mollivirus(100.0%)	1	NA	NA
WP_153860412.1|5067849_5068824_-	Dyp-type peroxidase	NA	A0A0M5KAH8	Mollivirus	27.4	1.2e-19
>prophage 372
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5086084	5086627	5593263		Escherichia_phage(100.0%)	1	NA	NA
WP_012145153.1|5086084_5086627_+	electron transport protein HydN	NA	A0A077SL61	Escherichia_phage	28.0	3.2e-11
>prophage 373
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5093141	5097019	5593263		Bacillus_virus(50.0%)	2	NA	NA
WP_153860432.1|5093141_5095016_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.9	6.8e-16
WP_153860433.1|5095624_5097019_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.0	3.1e-26
>prophage 374
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5102741	5107417	5593263		Bacillus_phage(50.0%)	2	NA	NA
WP_153860437.1|5102741_5104835_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.3	8.6e-12
WP_153860438.1|5104894_5107417_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.6	4.9e-94
>prophage 375
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5113000	5115006	5593263		Mycobacterium_virus(50.0%)	2	NA	NA
WP_153860442.1|5113000_5113912_+	alpha/beta fold hydrolase	NA	G1DAB1	Mycobacterium_virus	23.5	3.3e-08
WP_153860443.1|5113992_5115006_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.8	1.5e-25
>prophage 376
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5127665	5130552	5593263		uncultured_Caudovirales_phage(100.0%)	4	NA	NA
WP_153860456.1|5127665_5128364_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.1	2.6e-90
WP_153860457.1|5128452_5128773_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	47.5	1.5e-21
WP_153860458.1|5128818_5130108_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.1	2.8e-170
WP_153860459.1|5130120_5130552_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	66.4	1.1e-46
>prophage 377
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5136714	5137788	5593263		Enterobacteria_phage(100.0%)	1	NA	NA
WP_153860465.1|5136714_5137788_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	42.1	3.9e-69
>prophage 378
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5147123	5148230	5593263		Bacillus_virus(100.0%)	1	NA	NA
WP_153860473.1|5147123_5148230_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	30.0	4.4e-23
>prophage 379
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5176371	5177133	5593263		Planktothrix_phage(100.0%)	1	NA	NA
WP_153860495.1|5176371_5177133_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.0	1.1e-30
>prophage 380
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5185842	5187784	5593263		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_153860501.1|5185842_5186790_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.7	1.4e-09
WP_153860502.1|5186779_5187784_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.3	1.1e-15
>prophage 381
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5202372	5203785	5593263		Pandoravirus(100.0%)	1	NA	NA
WP_153860517.1|5202372_5203785_-	family 1 glycosylhydrolase	NA	A0A0B5JD41	Pandoravirus	30.4	1.7e-48
>prophage 382
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5212952	5215088	5593263		Bacillus_phage(100.0%)	1	NA	NA
WP_153860973.1|5212952_5215088_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.0	3.1e-25
>prophage 383
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5228036	5236283	5593263		Acinetobacter_phage(60.0%)	5	NA	NA
WP_153860532.1|5228036_5229242_-	serine hydrolase	NA	A0A0Y0A2S9	Mycobacterium_phage	25.3	2.0e-08
WP_153860533.1|5229367_5231569_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	23.4	9.7e-22
WP_153860534.1|5231709_5232474_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	31.1	5.2e-31
WP_153860535.1|5232466_5234860_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	48.5	5.0e-205
WP_153860536.1|5234852_5236283_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	48.0	9.5e-111
>prophage 384
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5243166	5244246	5593263		Bacillus_virus(100.0%)	1	NA	NA
WP_153860543.1|5243166_5244246_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	28.8	8.9e-21
>prophage 385
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5247480	5251477	5593263	transposase	uncultured_virus(50.0%)	5	NA	NA
WP_012145017.1|5247480_5247807_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	56.9	1.3e-23
WP_153860547.1|5247955_5248324_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_153860548.1|5248414_5248714_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_153860549.1|5248753_5250241_-	MFS transporter	NA	NA	NA	NA	NA
WP_153860550.1|5250346_5251477_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	85.6	2.1e-185
>prophage 386
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5259123	5259813	5593263		Streptococcus_phage(100.0%)	1	NA	NA
WP_153860558.1|5259123_5259813_-	HTH domain-containing protein	NA	A0A1B0RXM1	Streptococcus_phage	31.7	5.5e-16
>prophage 387
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5266611	5267541	5593263		Burkholderia_virus(100.0%)	1	NA	NA
WP_153860564.1|5266611_5267541_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.8	2.9e-12
>prophage 388
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5278221	5281428	5593263		Hokovirus(100.0%)	1	NA	NA
WP_167519963.1|5278221_5281428_+	response regulator	NA	A0A1V0SGX0	Hokovirus	26.0	2.3e-32
>prophage 389
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5286973	5289109	5593263		Bacillus_phage(100.0%)	1	NA	NA
WP_153860578.1|5286973_5289109_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.3	1.0e-36
>prophage 390
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5309255	5310791	5593263		Staphylococcus_phage(100.0%)	1	NA	NA
WP_153860601.1|5309255_5310791_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	4.7e-15
>prophage 391
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5324509	5326030	5593263		Acinetobacter_phage(100.0%)	1	NA	NA
WP_153860610.1|5324509_5326030_+	dipeptide/tripeptide permease DtpA	NA	A0A0P0IY73	Acinetobacter_phage	30.0	8.1e-52
>prophage 392
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5333705	5334371	5593263		Golden_Marseillevirus(100.0%)	1	NA	NA
WP_153860620.1|5333705_5334371_+	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	32.0	8.8e-11
>prophage 393
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5340922	5342197	5593263	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_153860625.1|5340922_5342197_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.1	1.5e-83
>prophage 394
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5349224	5349746	5593263		Salmonella_phage(100.0%)	1	NA	NA
WP_153860629.1|5349224_5349746_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	68.6	5.6e-61
>prophage 395
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5357184	5358729	5593263	transposase	Acidithiobacillus_phage(100.0%)	1	NA	NA
WP_153858541.1|5357184_5358729_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	1.0e-126
>prophage 396
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5364133	5372113	5593263		Streptomyces_phage(16.67%)	9	NA	NA
WP_153860641.1|5364133_5364955_+	hydrolase	NA	A0A2H4PI41	Streptomyces_phage	43.9	5.4e-18
WP_153860642.1|5365148_5365727_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	44.2	5.8e-43
WP_004943739.1|5365780_5365870_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_017892660.1|5366193_5367219_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	30.5	2.1e-27
WP_153860643.1|5367215_5368160_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153860644.1|5368287_5369496_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.4	1.7e-15
WP_153860645.1|5369836_5370988_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.6	1.4e-83
WP_153860978.1|5371136_5371409_-	peptidase inhibitor I78 family protein	NA	NA	NA	NA	NA
WP_135316347.1|5371462_5372113_-	riboflavin synthase subunit alpha	NA	A0A2I2L4R9	Orpheovirus	35.2	6.8e-24
>prophage 397
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5378971	5384127	5593263		environmental_halophage(33.33%)	5	NA	NA
WP_153860651.1|5378971_5380192_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.9	6.4e-92
WP_153860652.1|5380188_5381481_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_153860653.1|5381455_5382202_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.9	8.4e-10
WP_026142350.1|5382244_5383741_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_037418650.1|5383755_5384127_-	Fe-S cluster assembly scaffold SufA	NA	A0A218MM00	uncultured_virus	38.8	1.7e-16
>prophage 398
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5390437	5396000	5593263		Hokovirus(33.33%)	4	NA	NA
WP_153860656.1|5390437_5392816_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.0	2.2e-168
WP_017892646.1|5393348_5394170_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_153860657.1|5394364_5395411_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	47.9	7.5e-81
WP_153860658.1|5395514_5396000_+	glutathione peroxidase	NA	A0A1S7DLQ4	Molluscum_contagiosum_virus	36.7	1.3e-11
>prophage 399
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5401452	5406804	5593263		Brazilian_cedratvirus(33.33%)	5	NA	NA
WP_153860664.1|5401452_5402238_+	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	1.3e-13
WP_153860665.1|5402286_5403729_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.7	1.4e-58
WP_153860666.1|5403982_5404720_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_153860667.1|5405274_5406288_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_083757602.1|5406345_5406804_-	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	34.4	4.2e-12
>prophage 400
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5410282	5425581	5593263	tRNA	Tupanvirus(33.33%)	15	NA	NA
WP_153860672.1|5410282_5412265_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.4	7.4e-21
WP_153860673.1|5412264_5413245_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	I1TED8	Salmonella_phage	34.2	4.0e-36
WP_153860674.1|5413231_5414386_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	28.7	1.4e-32
WP_153860675.1|5414784_5415540_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.8	1.9e-09
WP_153860676.1|5415565_5416117_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_153860677.1|5416158_5417166_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_153860678.1|5417341_5417782_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_004943604.1|5418353_5418650_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
WP_153860679.1|5418654_5421042_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	23.7	8.1e-06
WP_012144881.1|5421056_5422040_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.0	5.8e-35
WP_153860680.1|5422236_5422332_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004943595.1|5422401_5422758_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004931418.1|5422801_5422999_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_013812633.1|5423097_5423649_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	4.4e-16
WP_135316295.1|5423652_5425581_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	1.9e-130
>prophage 401
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5434764	5437802	5593263		Escherichia_phage(50.0%)	4	NA	NA
WP_017892622.1|5434764_5435430_-	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	50.0	5.3e-08
WP_153860689.1|5435539_5435839_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_153860690.1|5435970_5436915_+	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_012144868.1|5436911_5437802_+	manganese/iron ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	27.3	1.9e-08
>prophage 402
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5443860	5444409	5593263		Bacillus_phage(100.0%)	1	NA	NA
WP_037422530.1|5443860_5444409_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	36.1	3.7e-07
>prophage 403
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5449751	5451788	5593263		Moraxella_phage(100.0%)	1	NA	NA
WP_153860698.1|5449751_5451788_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.9	1.3e-84
>prophage 404
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5469335	5472787	5593263		Dickeya_phage(50.0%)	2	NA	NA
WP_153860713.1|5469335_5470679_-	malate permease	NA	A0A140XAH4	Dickeya_phage	54.4	7.2e-28
WP_153860714.1|5471167_5472787_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.8	1.2e-141
>prophage 405
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5512752	5512965	5593263		Morganella_phage(100.0%)	1	NA	NA
WP_012006483.1|5512752_5512965_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	75.7	1.2e-22
>prophage 406
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5522426	5522969	5593263		Phage_21(50.0%)	2	NA	NA
WP_153860751.1|5522426_5522615_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	88.9	1.7e-20
WP_153860984.1|5522774_5522969_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	53.2	6.7e-12
>prophage 407
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5527913	5570179	5593263	terminase,holin,integrase	Escherichia_phage(60.71%)	50	5538863:5538876	5569587:5569600
WP_167519969.1|5527913_5528972_+	acyltransferase family protein	NA	A0A0S2SXM2	Bacillus_phage	33.1	1.1e-20
WP_153860758.1|5529046_5529256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153860759.1|5531672_5532899_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.4	6.1e-151
WP_153860760.1|5532895_5533228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153860761.1|5533224_5533941_-	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	36.8	2.7e-21
WP_153860762.1|5533937_5534981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153860763.1|5534980_5535256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153860764.1|5535252_5535969_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	36.4	2.9e-28
WP_153860765.1|5535968_5537990_-	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	37.2	9.2e-19
WP_153860766.1|5538113_5538701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153860767.1|5538700_5539138_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	40.0	4.9e-26
5538863:5538876	attL	CAATGCGGTATCGG	NA	NA	NA	NA
WP_153860768.1|5539141_5540536_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	37.2	2.7e-70
WP_153860769.1|5540540_5541482_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	39.0	1.1e-51
WP_153860770.1|5541465_5541900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153860771.1|5541896_5542325_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	39.9	7.6e-24
WP_153860772.1|5542321_5542804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153860773.1|5542870_5543902_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	46.4	1.6e-75
WP_153860774.1|5543918_5544779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153860775.1|5544794_5546414_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_153860776.1|5546426_5547248_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	34.5	3.4e-36
WP_153860777.1|5547244_5548666_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	36.6	5.6e-87
WP_153860778.1|5548677_5550009_-|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	58.6	6.0e-152
WP_153860779.1|5550010_5550754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153857216.1|5551238_5551625_-	DUF2570 family protein	NA	NA	NA	NA	NA
WP_153860780.1|5551621_5552056_-	glycoside hydrolase family protein	NA	R9TMH8	Aeromonas_phage	57.3	1.4e-36
WP_153860781.1|5552042_5552390_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	69.0	4.9e-29
WP_153860782.1|5552956_5553232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153860783.1|5553303_5554017_-	antitermination protein	NA	NA	NA	NA	NA
WP_153860784.1|5554013_5554310_-	hypothetical protein	NA	A0A2H4FS95	Methylophilaceae_phage	52.6	6.2e-25
WP_153860785.1|5554306_5554903_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	56.6	3.9e-58
WP_153860786.1|5554955_5555135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153860787.1|5555491_5556145_-	hypothetical protein	NA	A0A2I7RAW6	Vibrio_phage	45.3	4.2e-05
WP_089187280.1|5556141_5556372_-	hypothetical protein	NA	A0A1V0E8D1	Vibrio_phage	47.4	1.1e-08
WP_153860788.1|5556352_5556856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153860789.1|5556852_5557275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153860985.1|5557279_5557735_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	49.0	1.1e-39
WP_153860790.1|5557724_5558660_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	63.8	2.8e-39
WP_153860986.1|5558659_5559553_-	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	57.0	2.8e-97
WP_153860791.1|5559873_5560320_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_153860792.1|5560330_5560579_-	transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	47.2	2.8e-10
WP_153860793.1|5560684_5561149_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	60.4	1.7e-45
WP_153860794.1|5561408_5561777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187287.1|5561807_5562005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187288.1|5562083_5562386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153860795.1|5562906_5566062_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	38.7	7.3e-148
WP_153860796.1|5566073_5567192_+	hypothetical protein	NA	A0A2I7RQF1	Vibrio_phage	49.8	5.7e-63
WP_153860797.1|5567188_5567377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071586680.1|5567447_5567693_+	excisionase	NA	NA	NA	NA	NA
WP_153860798.1|5567673_5568801_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	53.3	7.0e-109
WP_112362581.1|5568925_5570179_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	4.0e-20
5569587:5569600	attR	CCGATACCGCATTG	NA	NA	NA	NA
>prophage 408
NZ_CP045913	Serratia proteamaculans strain 336X chromosome, complete genome	5593263	5573269	5577286	5593263	transposase	Bodo_saltans_virus(50.0%)	4	NA	NA
WP_153860803.1|5573269_5574640_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.8	7.7e-110
WP_153860804.1|5574691_5575393_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_153860805.1|5575413_5575866_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_137231231.1|5576135_5577286_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	62.4	5.0e-94
