The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045978	Escherichia coli strain INSC1001 chromosome, complete genome	4630646	247635	297095	4630646	transposase,integrase	Streptococcus_phage(20.0%)	48	262897:262956	297205:297264
WP_000006255.1|247635_248133_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|248356_250096_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|250040_250826_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|250896_251952_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|252003_252297_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|252299_252698_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|252707_253160_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|253465_253732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|253664_254201_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|254257_255715_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|255975_256434_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|256525_257770_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000749863.1|259043_260099_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|260386_261490_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|261501_262755_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
262897:262956	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|263326_263668_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|263688_264006_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|264024_264246_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|264254_264731_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|264746_265205_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|265302_265542_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|265618_266086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|266108_266552_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|266551_266779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|267182_268004_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|268095_268959_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|269287_270181_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|270601_271753_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|274099_275116_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|275323_276727_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|276713_277646_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|277754_278801_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|280022_280361_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|280383_280734_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|280827_281982_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|282276_283185_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|283199_285167_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|285393_286776_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|286787_288398_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|288402_289161_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|289299_290304_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|291498_292230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|292320_292947_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|293218_293917_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|293943_294798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|294916_295141_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|295137_295578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|295694_297095_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
297205:297264	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP045978	Escherichia coli strain INSC1001 chromosome, complete genome	4630646	519137	582096	4630646	protease,tRNA,transposase,terminase,lysis,integrase	Enterobacteria_phage(50.0%)	67	564754:564800	586056:586102
WP_001295836.1|519137_519761_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|519731_520418_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|520414_522829_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|523259_527540_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|527579_527948_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|528638_528899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297301.1|528955_529129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|530130_531225_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|531293_532220_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|532449_532932_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|533009_533825_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|533914_535696_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|535708_536485_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|536584_537463_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|537631_539086_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|539145_540507_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|540563_541865_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|541886_543032_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|543259_544045_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|544055_545291_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|545312_546362_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|546678_548346_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|548355_549615_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|549625_550441_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|550437_551331_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|551525_552593_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|552589_553099_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|553216_553939_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|553941_554436_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|554609_555995_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|556030_556552_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|556659_556872_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|556873_557740_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|558210_558753_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|558972_559665_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|559695_562299_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|562277_563318_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|563328_563844_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|563846_564479_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
564754:564800	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|564813_565977_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|566096_566360_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|566682_566778_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000169527.1|566840_567140_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|567136_568003_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001070439.1|568313_568646_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|568693_568843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|568900_570427_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|570891_571443_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|571452_572250_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|572366_572468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|572464_572920_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|572919_573090_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|573082_573373_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|573369_573732_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|573728_573869_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|573954_574338_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|574735_575752_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|575756_576824_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|577396_577612_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|577611_578109_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|578325_578508_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|578598_578892_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|579182_579593_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|579878_580085_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|580249_580444_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|580832_581378_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|581352_582096_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
586056:586102	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP045978	Escherichia coli strain INSC1001 chromosome, complete genome	4630646	1192848	1214242	4630646	plate,tRNA,tail,portal,integrase	Shigella_phage(25.0%)	31	1184843:1184857	1220945:1220959
1184843:1184857	attL	CTTCAGCGTGGTTGT	NA	NA	NA	NA
WP_001297484.1|1192848_1193955_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1194008_1194470_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|1194479_1195133_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444484.1|1195304_1196555_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_000241967.1|1197048_1197714_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010723094.1|1197714_1198419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257372.1|1198876_1199770_+	cell death peptidase Lit	NA	NA	NA	NA	NA
WP_000741310.1|1199860_1200988_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
WP_000939945.1|1200968_1201214_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_011443584.1|1201250_1201562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001005353.1|1201958_1202267_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|1202441_1203116_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|1203206_1203407_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|1203450_1204008_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_001250269.1|1204183_1204363_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104929.1|1204352_1205720_+	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|1205731_1205914_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|1205913_1206387_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|1206313_1207105_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|1207095_1207680_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_000554703.1|1207683_1208313_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
WP_010723096.1|1208314_1208728_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000548498.1|1208699_1209302_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_024184299.1|1209301_1209796_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000905001.1|1209867_1210422_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000557907.1|1210528_1211362_+	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000943927.1|1211595_1211760_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_001295666.1|1211862_1212186_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|1212722_1212833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1212885_1213290_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|1213510_1214242_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
1220945:1220959	attR	ACAACCACGCTGAAG	NA	NA	NA	NA
>prophage 4
NZ_CP045978	Escherichia coli strain INSC1001 chromosome, complete genome	4630646	1396257	1437075	4630646	tRNA,tail,transposase,lysis,integrase	Escherichia_phage(45.16%)	43	1397404:1397422	1427779:1427797
WP_010723085.1|1396257_1397274_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
1397404:1397422	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000605090.1|1397546_1397804_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|1397853_1398804_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|1398955_1399708_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945011.1|1399902_1400418_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|1400428_1401955_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156451.1|1401991_1403437_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444929.1|1403436_1404747_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885458.1|1404922_1405831_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|1406160_1406724_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|1406744_1407977_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1408231_1409215_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1409692_1411066_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1411194_1412130_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1412181_1413417_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1413418_1413634_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1413712_1413922_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1413914_1414109_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1414165_1414975_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1414967_1417568_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1417669_1417945_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1418019_1418190_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1418189_1418411_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1418852_1419341_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1419337_1419493_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1419946_1420423_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1420546_1420843_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1420865_1421288_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1421300_1422158_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1422164_1422911_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1422933_1423494_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1423581_1423767_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1423963_1425421_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1425558_1425822_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1425802_1426162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|1427927_1428908_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
1427779:1427797	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_000279097.1|1429230_1432593_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|1432592_1433168_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1433265_1433856_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1434172_1434406_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1434474_1434588_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|1435366_1435801_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1435941_1437075_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 5
NZ_CP045978	Escherichia coli strain INSC1001 chromosome, complete genome	4630646	1629636	1648847	4630646	tail,lysis	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|1629636_1631097_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|1631185_1632469_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1633073_1633187_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1633255_1633489_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1633805_1634396_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1634493_1635069_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1635068_1636031_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1635981_1636551_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1636939_1637173_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1637230_1637641_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1637792_1637966_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1638137_1638293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1638371_1638437_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1638439_1638628_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1638638_1638851_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1639213_1639711_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1639707_1640241_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1640237_1640549_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1640553_1640769_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1641522_1641738_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1642038_1642251_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1642305_1642395_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1642672_1643425_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001393597.1|1643438_1644488_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	5.7e-113
WP_012304870.1|1644489_1644768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1644834_1645086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1645302_1645458_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1645529_1645817_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1645816_1646056_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1646080_1646386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1646588_1646921_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1647357_1647507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1647803_1648034_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1648117_1648525_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1648691_1648847_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 6
NZ_CP045978	Escherichia coli strain INSC1001 chromosome, complete genome	4630646	2108186	2116857	4630646		Escherichia_phage(28.57%)	8	NA	NA
WP_000272486.1|2108186_2109290_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_001393538.1|2109297_2110545_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100981.1|2110541_2111099_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_000783975.1|2111098_2111980_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001023610.1|2112037_2112937_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000699460.1|2112936_2114022_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_000183060.1|2114394_2115288_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116026.1|2115462_2116857_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 7
NZ_CP045978	Escherichia coli strain INSC1001 chromosome, complete genome	4630646	2466261	2477471	4630646	tail,integrase	Enterobacteria_phage(53.33%)	16	2464236:2464252	2481146:2481162
2464236:2464252	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2466261_2467194_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2467505_2468663_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2468815_2469178_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2469174_2470095_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|2470091_2471423_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2471457_2471739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2472037_2472478_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2472504_2473023_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2473072_2473348_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2473347_2473842_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000135673.1|2474564_2474927_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2474992_2475817_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2475944_2476481_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2476471_2476834_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2476833_2477139_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2477270_2477471_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2481146:2481162	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 8
NZ_CP045978	Escherichia coli strain INSC1001 chromosome, complete genome	4630646	2858053	2865192	4630646		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2858053_2860615_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2860720_2861377_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|2861427_2862195_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|2862390_2863299_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2863295_2864462_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|2864553_2865192_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
