The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038653	Citrobacter freundii strain 154 chromosome, complete genome	5143118	190298	195878	5143118		uncultured_Caudovirales_phage(57.14%)	8	NA	NA
WP_003030769.1|190298_191549_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	9.4e-22
WP_003030767.1|191685_192195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003030766.1|192411_192612_-	DinI-like family protein	NA	Q6UAW0	Klebsiella_phage	77.3	7.9e-24
WP_008320414.1|192691_192925_+	DNA polymerase V subunit	NA	A0A222YZE2	Escherichia_phage	78.8	4.3e-21
WP_008320415.1|193001_193700_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	3.8e-89
WP_003030762.1|193785_194106_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	3.2e-19
WP_003030761.1|194150_195440_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.4	1.2e-165
WP_003030760.1|195452_195878_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	7.3e-51
>prophage 2
NZ_CP038653	Citrobacter freundii strain 154 chromosome, complete genome	5143118	289803	299841	5143118	tRNA	Tupanvirus(14.29%)	10	NA	NA
WP_003030576.1|289803_290787_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_008323842.1|290802_293190_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003030571.1|293194_293494_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_003030570.1|293647_294628_+	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	1.5e-14
WP_003030569.1|294688_295240_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003030567.1|295239_295989_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
WP_003030566.1|296066_296531_+	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	2.7e-14
WP_003030564.1|296847_297561_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_008323845.1|297622_299065_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	5.9e-52
WP_003030561.1|299061_299841_-	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.3	1.2e-11
>prophage 3
NZ_CP038653	Citrobacter freundii strain 154 chromosome, complete genome	5143118	474944	482065	5143118	transposase	Escherichia_phage(33.33%)	6	NA	NA
WP_003028915.1|474944_475562_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	5.6e-76
WP_008324000.1|475572_476739_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	46.3	1.4e-83
WP_100216202.1|478191_479359_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	8.4e-166
WP_001201739.1|479752_480136_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_000609174.1|480132_480480_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001000409.1|480529_482065_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
>prophage 4
NZ_CP038653	Citrobacter freundii strain 154 chromosome, complete genome	5143118	536547	561834	5143118	plate,transposase,head,terminase	Escherichia_phage(37.5%)	30	NA	NA
WP_008324339.1|536547_537903_-|head	phage head morphogenesis protein	head	A9DEG6	Yersinia_phage	23.8	1.0e-05
WP_008324336.1|537889_539242_-	DUF1073 domain-containing protein	NA	NA	NA	NA	NA
WP_008324335.1|539238_540648_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	33.3	1.2e-57
WP_008324334.1|540634_541183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983774.1|541844_542192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008324333.1|542492_544025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008324332.1|544042_544558_+	recombinase	NA	Q5QBN4	Enterobacteria_phage	47.5	8.8e-35
WP_008324331.1|544670_545681_+	hypothetical protein	NA	K7PGY2	Enterobacteria_phage	60.7	1.4e-07
WP_008324330.1|545690_546059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008324328.1|546440_547073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008324325.1|547072_547309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008324324.1|547308_547539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008324322.1|547531_548287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008324319.1|548286_549696_-|plate	baseplate component	plate	A0A2D0YGH8	Vibrio_phage	23.4	1.6e-17
WP_008324318.1|549679_550030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008324317.1|550244_550622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008324316.1|550631_551342_-|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_008324315.1|551338_552292_-	hypothetical protein	NA	A0A1D8EQC7	Escherichia_phage	27.0	1.0e-07
WP_071687568.1|553370_553628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019450.1|554221_555202_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_153983773.1|556137_556413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071687565.1|556472_556658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071687563.1|556854_557214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071687562.1|557200_557464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062958097.1|557466_557736_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071687561.1|557745_558468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071687560.1|558475_558997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143186488.1|559007_559298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003019927.1|559543_559891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019450.1|560853_561834_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
>prophage 5
NZ_CP038653	Citrobacter freundii strain 154 chromosome, complete genome	5143118	788682	857147	5143118	holin,integrase,capsid,protease,tail,head,portal,terminase	Enterobacteria_phage(61.54%)	79	795519:795533	854816:854830
WP_032934880.1|788682_789729_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_003020620.1|789950_790712_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.7	3.0e-07
WP_003020622.1|790708_791299_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_003020625.1|791382_792258_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_003020628.1|792358_792979_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_003020630.1|792975_793854_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_071524452.1|793971_794034_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_003020636.1|794128_795691_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
795519:795533	attL	CTTGTATTGTCATTC	NA	NA	NA	NA
WP_003020639.1|795690_797286_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.6	3.2e-51
WP_003020643.1|797289_798648_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	1.0e-37
WP_003020645.1|798658_799852_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_003020647.1|799851_800658_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_003020649.1|800664_802149_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.8	8.3e-17
WP_003020652.1|802335_802611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003020655.1|802850_803309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003020658.1|803381_804098_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003020660.1|804666_805320_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_003020663.1|805718_806462_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_003020667.1|806516_807056_+	septation protein A	NA	NA	NA	NA	NA
WP_003020670.1|807221_807623_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_003020673.1|807687_808407_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_003020675.1|808631_808928_+	YciI family protein	NA	NA	NA	NA	NA
WP_008322423.1|809079_809751_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.5	1.4e-80
WP_008322424.1|810035_810794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003826234.1|811477_811867_-	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.1	1.0e-51
WP_008322426.1|811945_812188_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	4.4e-29
WP_008322427.1|812322_813747_-	hypothetical protein	NA	A0A1V0E5M2	Salmonella_phage	51.1	1.0e-112
WP_008322428.1|813819_814458_-	hypothetical protein	NA	A0A1X7QGJ8	Escherichia_phage	30.8	6.5e-11
WP_008322429.1|814454_814727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008322430.1|814972_818143_-	host specificity protein J	NA	O64335	Escherichia_phage	85.6	0.0e+00
WP_008322431.1|818306_818552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322435.1|818682_819273_-|tail	tail assembly protein	tail	K7PH91	Enterobacterial_phage	77.9	1.0e-74
WP_008322436.1|819328_819754_-	hypothetical protein	NA	K7PLY8	Enterobacterial_phage	36.9	6.6e-12
WP_008322437.1|819783_820494_-	peptidase P60	NA	K7P6F5	Enterobacteria_phage	94.1	8.2e-140
WP_008322439.1|821247_821595_-	hypothetical protein	NA	K7PJT2	Enterobacteria_phage	69.6	2.3e-39
WP_008322440.1|821598_824115_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	70.6	0.0e+00
WP_071524448.1|824092_824413_-|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	69.8	2.7e-34
WP_008322442.1|824421_824829_-|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	60.7	5.9e-26
WP_008322443.1|824865_825603_-|tail	tail protein	tail	O64327	Escherichia_phage	69.4	1.6e-93
WP_003034811.1|825610_826009_-|tail	tail protein	tail	K7P7G5	Enterobacteria_phage	82.6	1.2e-60
WP_008322445.1|826005_826560_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	91.4	8.0e-74
WP_008322446.1|826569_826923_-|tail	tail attachment protein	tail	K7P6U9	Enterobacteria_phage	75.2	2.0e-46
WP_008322448.1|826934_827339_-	DNA-packaging protein FI	NA	K7PM13	Enterobacteria_phage	52.2	1.4e-22
WP_008322450.1|827384_828410_-|capsid	major capsid protein	capsid	K7PGW9	Enterobacteria_phage	92.4	4.3e-182
WP_003826193.1|828477_828810_-|head	head decoration protein	head	E4WL24	Enterobacteria_phage	82.7	5.0e-47
WP_008322451.1|828819_830145_-	S49 family peptidase	NA	O64320	Escherichia_phage	78.7	4.9e-186
WP_003826190.1|830125_831718_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	92.1	9.7e-290
WP_003034782.1|831714_831921_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	95.5	3.2e-28
WP_008322455.1|831920_833843_-|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	97.5	0.0e+00
WP_000453624.1|833817_834363_-|terminase	terminase small subunit	terminase	E4WL18	Enterobacteria_phage	100.0	1.2e-95
WP_008322456.1|834833_835220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162009215.1|835907_836414_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_008322460.1|836410_836959_-	lysozyme	NA	K7PM52	Enterobacteria_phage	96.2	3.8e-100
WP_001568784.1|836930_837209_-|holin	holin	holin	K7PGZ9	Enterobacteria_phage	97.8	5.1e-45
WP_032934886.1|837459_837870_+	hypothetical protein	NA	K7P7K4	Enterobacteria_phage	99.3	2.1e-71
WP_008322464.1|838027_838843_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	96.7	1.1e-140
WP_008322465.1|838839_838974_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	100.0	1.4e-13
WP_008322467.1|838970_839579_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	63.7	5.3e-47
WP_008322477.1|839787_840387_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	96.0	7.7e-107
WP_008322478.1|840822_841473_-	hypothetical protein	NA	K7PGV7	Enterobacterial_phage	50.0	2.9e-06
WP_008322479.1|841469_841889_-	HNH endonuclease	NA	E7EKU5	Edwardsiella_phage	74.1	2.5e-59
WP_008322480.1|841890_842250_-	hypothetical protein	NA	A0A193GYX5	Enterobacter_phage	91.4	1.9e-07
WP_008322481.1|842246_843056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008322482.1|843052_843364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008322484.1|843382_844132_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	86.7	4.8e-122
WP_008322485.1|844134_845082_-	phage protein	NA	G9L6A8	Escherichia_phage	30.1	6.4e-23
WP_008322486.1|845249_845789_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	86.0	5.0e-81
WP_008322487.1|845814_846036_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	67.6	1.1e-21
WP_008322488.1|846146_846845_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	79.3	1.0e-102
WP_149335231.1|846857_846956_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_008322489.1|847149_848052_+	serine dehydrogenasease	NA	NA	NA	NA	NA
WP_008322501.1|848251_848476_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	66.2	5.2e-16
WP_008322503.1|848794_849001_+	phage encoded cell division inhibitor protein	NA	K7PM31	Enterobacteria_phage	98.5	9.6e-33
WP_008322507.1|849313_851869_+	exodeoxyribonuclease VIII	NA	K7P6V4	Enterobacteria_phage	47.9	1.7e-232
WP_008322509.1|851883_852924_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	75.6	5.9e-155
WP_008322517.1|852963_853206_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	82.3	2.6e-29
WP_008322518.1|853251_853452_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	82.5	1.9e-25
WP_008322520.1|853444_854638_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	84.4	5.1e-203
WP_003020678.1|855137_857147_+	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	45.3	4.2e-64
854816:854830	attR	GAATGACAATACAAG	NA	NA	NA	NA
>prophage 6
NZ_CP038653	Citrobacter freundii strain 154 chromosome, complete genome	5143118	989048	1082627	5143118	plate,holin,integrase,protease,capsid,tail,transposase,terminase	Escherichia_phage(23.26%)	115	1000408:1000438	1082700:1082730
WP_153983769.1|989048_989930_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_003034960.1|990122_992171_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	1.2e-87
WP_003034957.1|992190_992877_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_003034953.1|992973_993471_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_003034950.1|993599_994883_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_003034947.1|994851_997485_+	PqiB family protein	NA	NA	NA	NA	NA
WP_008322657.1|997564_998986_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_029139506.1|999086_999323_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_003034941.1|999425_999617_+	YebW family protein	NA	NA	NA	NA	NA
WP_003034937.1|999617_1000259_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.5	8.7e-56
1000408:1000438	attL	CACATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_153983871.1|1000743_1001415_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	2.0e-79
WP_153983768.1|1001407_1002676_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	81.5	1.0e-204
WP_121581545.1|1002677_1003097_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.9	2.7e-34
WP_088902117.1|1003174_1003417_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	4.4e-29
WP_153983739.1|1003550_1004945_-|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	52.4	3.2e-111
WP_048231685.1|1005007_1005661_-	hypothetical protein	NA	Q5G8V8	Enterobacteria_phage	92.6	2.3e-112
WP_048231682.1|1005660_1005972_-	hypothetical protein	NA	Q5G8V9	Enterobacteria_phage	93.2	1.5e-50
WP_153983767.1|1005971_1009181_-	DUF1983 domain-containing protein	NA	G8C7R4	Escherichia_phage	69.1	0.0e+00
WP_038641010.1|1009236_1009836_-|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	92.0	2.5e-97
WP_153983766.1|1009823_1010555_-	peptidase P60	NA	G8C7R2	Escherichia_phage	89.7	4.2e-139
WP_153983765.1|1010567_1011341_-|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	90.2	3.5e-136
WP_058659081.1|1011337_1011688_-	hypothetical protein	NA	G8C7R0	Escherichia_phage	92.2	4.0e-55
WP_128317018.1|1011775_1012162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023311691.1|1014616_1015387_-	helix-turn-helix transcriptional regulator	NA	A0A2I7S9A5	Vibrio_phage	37.5	6.1e-40
WP_023311692.1|1015521_1015779_+	transcriptional regulator	NA	M1PVU4	Vibrio_phage	64.6	2.1e-16
WP_150319569.1|1015778_1017824_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	48.2	7.8e-175
WP_038637759.1|1017835_1018729_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	59.8	4.7e-100
WP_023311925.1|1018739_1019030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038637762.1|1019042_1019249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063617270.1|1019238_1019883_+	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	64.6	9.3e-74
WP_038637769.1|1019884_1020118_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032663812.1|1020107_1020299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983717.1|1020377_1020593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983716.1|1020603_1021323_+	DUF2786 domain-containing protein	NA	A0A0S4L2R2	Pseudomonas_phage	32.2	1.5e-16
WP_153983714.1|1021908_1022274_+	DUF4406 domain-containing protein	NA	A0A1V0E824	Vibrio_phage	52.2	5.7e-20
WP_023311916.1|1022266_1022482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072049704.1|1022659_1022875_+	hypothetical protein	NA	A0A2D1GNS9	Pseudomonas_phage	64.8	2.0e-20
WP_072001475.1|1022936_1023413_+	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	63.0	9.6e-44
WP_023311913.1|1023357_1023792_+	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	47.0	5.2e-28
WP_032663808.1|1023791_1024298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023311911.1|1024376_1025021_+	glycoside hydrolase family 19 protein	NA	A0A248XCW5	Klebsiella_phage	56.8	2.5e-63
WP_023311729.1|1025017_1025281_+	DUF2644 domain-containing protein	NA	A0A2D1GNW8	Pseudomonas_phage	57.3	4.8e-13
WP_032663807.1|1025246_1025879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000171281.1|1025887_1026130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021567611.1|1026126_1026411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038637812.1|1026412_1026913_+	DUF1804 family protein	NA	L7P7L4	Pseudomonas_phage	53.4	5.2e-48
WP_153983713.1|1026905_1027115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983712.1|1027119_1028772_+|terminase	phage terminase large subunit	terminase	H6V8N6	Pseudomonas_phage	66.1	3.8e-212
WP_063161511.1|1028774_1030343_+	DUF935 domain-containing protein	NA	A0A0U5KSI0	unidentified_phage	44.6	1.0e-126
WP_085406139.1|1030329_1031589_+|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	34.8	1.1e-51
WP_047063499.1|1031585_1032128_+	phage virion morphogenesis protein	NA	A0A2H4J9E5	uncultured_Caudovirales_phage	37.1	3.7e-23
WP_063161512.1|1032244_1032454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096218649.1|1032509_1033625_+	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	41.2	1.6e-57
WP_045261517.1|1033636_1034029_+	hypothetical protein	NA	A0A2P9JZJ1	Alteromonadaceae_phage	48.0	4.1e-24
WP_021567604.1|1034042_1034951_+	hypothetical protein	NA	A0A2H4J778	uncultured_Caudovirales_phage	63.9	3.8e-105
WP_045261516.1|1034950_1035358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021567602.1|1035361_1035790_+	DUF1320 family protein	NA	A0A1B0T6F3	Thiobacimonas_phage	35.1	5.1e-12
WP_023311741.1|1035789_1036449_+	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	35.4	2.5e-21
WP_023311742.1|1036435_1036657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045261513.1|1036643_1038062_+|tail	tail sheath protein	tail	B7SDP8	Haemophilus_phage	42.2	2.7e-86
WP_023311695.1|1038075_1038450_+	hypothetical protein	NA	F6MIK8	Haemophilus_phage	54.9	9.6e-31
WP_045261512.1|1038450_1038843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045261511.1|1038977_1041218_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	35.3	1.4e-68
WP_127785760.1|1041214_1042546_+	multidrug DMT transporter permease	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	26.0	1.3e-32
WP_060570684.1|1042529_1043747_+|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	37.4	3.3e-72
WP_060570683.1|1043730_1044336_+|plate	phage baseplate assembly protein	plate	F6MIL4	Haemophilus_phage	56.4	2.0e-30
WP_060570682.1|1044425_1044776_+	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	60.0	2.6e-30
WP_060570681.1|1044775_1045843_+|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	43.8	9.6e-68
WP_096218656.1|1045839_1046412_+	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	42.2	4.1e-33
WP_153986006.1|1046411_1047485_+	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	34.9	9.2e-10
WP_003030316.1|1047494_1047863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983710.1|1047973_1048534_+	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	73.5	1.1e-73
WP_025759422.1|1049598_1049886_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	61.5	9.3e-18
WP_016247125.1|1049903_1050242_-	hypothetical protein	NA	G8C7Q5	Escherichia_phage	92.9	2.1e-53
WP_115186741.1|1050307_1051240_-|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	91.9	6.3e-156
WP_016247123.1|1051286_1051736_-	DUF4128 domain-containing protein	NA	G8C7Q2	Escherichia_phage	89.9	2.3e-71
WP_054623473.1|1051725_1052325_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	88.4	2.3e-98
WP_115186742.1|1052327_1052681_-	hypothetical protein	NA	G8C7Q0	Escherichia_phage	90.6	1.3e-53
WP_128317024.1|1052682_1053165_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	86.9	3.9e-77
WP_016156686.1|1053500_1054640_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	84.0	4.8e-174
WP_153983762.1|1054657_1055410_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	92.0	4.3e-123
WP_153983761.1|1055730_1056837_-	hypothetical protein	NA	G8C7P5	Escherichia_phage	90.5	1.5e-188
WP_153983760.1|1056838_1058242_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	91.3	1.7e-242
WP_153983759.1|1058246_1059818_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	92.5	4.3e-306
WP_153983758.1|1059814_1060303_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	77.2	9.2e-50
WP_019076560.1|1060334_1060973_-	hypothetical protein	NA	I6S676	Salmonella_phage	87.7	1.0e-109
WP_136398002.1|1061093_1061768_-	Fur-regulated protein	NA	M9NZE9	Enterobacteria_phage	71.1	9.0e-88
WP_153986008.1|1062182_1062707_-	DUF2514 family protein	NA	A0A291LBG9	Klebsiella_phage	33.8	5.1e-06
WP_153983756.1|1062685_1063234_-	glycoside hydrolase family protein	NA	K7PM52	Enterobacteria_phage	96.2	2.2e-100
WP_016066213.1|1063205_1063484_-|holin	holin	holin	K7PGZ9	Enterobacteria_phage	100.0	6.0e-46
WP_071701194.1|1063528_1064017_-	hypothetical protein	NA	A0A2P0PA94	Pectobacterium_phage	46.4	2.4e-18
WP_060683741.1|1064366_1064777_+	hypothetical protein	NA	K7P7K4	Enterobacteria_phage	96.3	3.3e-69
WP_153983755.1|1064934_1065717_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	74.6	1.1e-108
WP_001568781.1|1065713_1065854_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	95.7	1.2e-18
WP_153983754.1|1065850_1066459_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	62.6	3.5e-46
WP_153983753.1|1066461_1066668_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	69.1	4.5e-22
WP_153983752.1|1066667_1067267_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	95.0	8.0e-104
WP_153983751.1|1067701_1068370_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	71.1	3.2e-53
WP_153983750.1|1068366_1068642_-	hypothetical protein	NA	A0A077KAZ4	Edwardsiella_phage	84.7	5.8e-33
WP_153983870.1|1069280_1069505_-	hypothetical protein	NA	B8K1D2	Salmonella_phage	72.4	9.5e-18
WP_153983749.1|1069864_1070176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983748.1|1070178_1070931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983747.1|1070942_1071635_-	phage replication protein	NA	G8C7U6	Escherichia_phage	60.9	1.5e-77
WP_153983869.1|1071618_1072611_-	replication protein	NA	A5VW95	Enterobacteria_phage	75.0	2.7e-48
WP_099531221.1|1072795_1073335_-	regulator	NA	K7PJT7	Enterobacteria_phage	84.4	2.7e-79
WP_099531219.1|1073374_1073584_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	81.2	8.8e-26
WP_099531231.1|1073726_1074395_+	helix-turn-helix transcriptional regulator	NA	A0A2D1GM27	Escherichia_phage	67.8	3.0e-91
WP_103285403.1|1074416_1075571_+	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	27.8	1.9e-32
WP_039270078.1|1076027_1076243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983745.1|1076563_1076761_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_153983743.1|1077068_1079831_+	exodeoxyribonuclease VIII	NA	K7P6V4	Enterobacteria_phage	67.1	0.0e+00
WP_153983868.1|1079842_1080955_+	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	93.2	9.1e-194
WP_153983742.1|1080994_1081237_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	88.6	1.5e-32
WP_032170291.1|1081300_1081573_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	64.4	1.9e-28
WP_137398750.1|1081541_1082627_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	68.4	3.6e-147
1082700:1082730	attR	CACATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 7
NZ_CP038653	Citrobacter freundii strain 154 chromosome, complete genome	5143118	1332537	1342115	5143118	tRNA,protease	Bacillus_phage(28.57%)	8	NA	NA
WP_003036792.1|1332537_1333941_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.6	1.0e-32
WP_003036797.1|1333937_1334660_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
WP_003036800.1|1334795_1335128_+	YegP family protein	NA	NA	NA	NA	NA
WP_003036803.1|1335287_1336649_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.6	3.4e-203
WP_003036804.1|1336918_1339195_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
WP_003036810.1|1339225_1339546_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036813.1|1339869_1340094_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_003036815.1|1340168_1342115_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.3	1.6e-39
>prophage 8
NZ_CP038653	Citrobacter freundii strain 154 chromosome, complete genome	5143118	1396777	1405196	5143118	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_003027344.1|1396777_1398811_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	4.0e-54
WP_003027345.1|1399017_1399476_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	68.0	5.6e-49
WP_003027346.1|1399518_1399989_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
WP_003027347.1|1400035_1400755_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_003027348.1|1400751_1402437_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
WP_003027351.1|1402662_1403394_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.0e-105
WP_003027354.1|1403445_1403553_+	protein YohO	NA	NA	NA	NA	NA
WP_003027356.1|1403533_1404265_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003027357.1|1404248_1405196_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	1.2e-21
>prophage 9
NZ_CP038653	Citrobacter freundii strain 154 chromosome, complete genome	5143118	1496349	1539523	5143118	plate,holin,integrase,protease,tail,terminase	Escherichia_phage(40.0%)	52	1495127:1495186	1536662:1536793
1495127:1495186	attL	TCGAATATTCTTTCTTTATTCTTCTGCTCAAAAAACAAAGGGGTCAGCATTTAGCTAACC	NA	NA	NA	NA
WP_153983786.1|1496349_1496718_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_153983787.1|1497994_1498252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983788.1|1498287_1498992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110498441.1|1498993_1500412_-|plate	baseplate J-like family protein	plate	A0A0U2RJZ0	Escherichia_phage	45.3	1.2e-54
WP_003833581.1|1500408_1500741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088760183.1|1500737_1501454_-	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	30.8	7.0e-22
WP_110498442.1|1501450_1502491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110498443.1|1502490_1502766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983789.1|1502762_1503473_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	38.1	5.3e-30
WP_110498445.1|1503472_1505299_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	41.9	4.9e-19
WP_110498446.1|1505422_1505998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983790.1|1506000_1506438_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	38.9	7.0e-25
WP_131445529.1|1506439_1507834_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	38.3	6.5e-72
WP_110498448.1|1507839_1508778_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	39.2	2.2e-52
WP_131445535.1|1508761_1509193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110498450.1|1509189_1509615_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	43.3	3.6e-26
WP_110498451.1|1509623_1510112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131445541.1|1510177_1511209_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	46.5	5.1e-74
WP_110498452.1|1511226_1512099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131445543.1|1512119_1513694_-	NUDIX domain-containing protein	NA	Q6UJ14	Burkholderia_virus	49.5	1.7e-20
WP_153983791.1|1513694_1514570_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	43.9	1.1e-53
WP_153983792.1|1514541_1515981_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	38.0	1.3e-91
WP_153983793.1|1515980_1517252_-	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	38.8	4.6e-85
WP_148977527.1|1517241_1518213_-|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	33.5	1.3e-23
WP_153983794.1|1518274_1518685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131445557.1|1518674_1519220_-	DUF2514 domain-containing protein	NA	A0A291AXG6	Shigella_phage	28.7	1.3e-07
WP_110498460.1|1519222_1519639_-	structural protein	NA	A0A0E3GMJ2	Enterobacteria_phage	58.6	1.4e-43
WP_001648823.1|1519641_1519995_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.7	1.7e-53
WP_115643621.1|1520440_1521019_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	51.4	1.2e-43
WP_148977525.1|1521015_1521309_-	DUF1364 family protein	NA	A0A0U2KD41	Escherichia_phage	63.2	2.3e-32
WP_045441382.1|1521305_1521902_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	74.7	1.7e-82
WP_131445566.1|1522351_1522690_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	82.1	8.6e-47
WP_131445569.1|1522689_1524762_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	54.2	9.6e-205
WP_131445573.1|1524758_1525031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131445576.1|1525027_1526161_-	site-specific DNA-methyltransferase	NA	A0A060D598	Salmonella_phage	50.4	3.9e-99
WP_131445594.1|1526157_1526409_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	52.8	5.1e-12
WP_048241297.1|1526434_1526683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131445579.1|1526686_1527367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983795.1|1527405_1528794_-	replicative DNA helicase	NA	Q8HA30	Enterobacteria_phage	47.5	9.5e-108
WP_046595084.1|1528790_1529774_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	79.6	1.2e-43
WP_001648809.1|1529776_1530001_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	46.1	4.7e-09
WP_016152513.1|1530023_1530470_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.1	3.2e-25
WP_050186203.1|1530534_1530738_-	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	49.2	8.0e-08
WP_050186201.1|1530816_1531218_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	54.9	2.5e-37
WP_001648806.1|1531787_1532111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983796.1|1532156_1534430_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.5	2.9e-106
WP_001648803.1|1534429_1534984_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	61.5	6.1e-50
WP_016152506.1|1534986_1535169_+	hypothetical protein	NA	H9C155	Pectobacterium_phage	51.7	2.2e-09
WP_001648801.1|1535381_1535606_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_110498477.1|1535606_1536626_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.1	7.5e-94
WP_003035920.1|1536963_1538592_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
1536662:1536793	attR	TCGAATATTCTTTCTTTATTCTTCTGCTCAAAAAACAAAGGGGTCAGCATTTAGCTAACCCCTTGTTAAATTTGGCGGAAGCGTAGAGATTCGAACTCTAGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
WP_003035917.1|1538863_1539523_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	8.9e-48
>prophage 10
NZ_CP038653	Citrobacter freundii strain 154 chromosome, complete genome	5143118	1574261	1675513	5143118	integrase,capsid,tail,head,portal,transposase,terminase,tRNA	Cronobacter_phage(30.19%)	88	1569631:1569650	1672792:1672811
1569631:1569650	attL	TGCTGCTGCTGGATGAACCC	NA	NA	NA	NA
WP_003035832.1|1574261_1575662_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.9	5.0e-80
WP_117255451.1|1576324_1577647_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	34.2	7.0e-68
WP_117255452.1|1577661_1578522_-	DNA-binding protein	NA	I6R977	Salmonella_phage	49.2	6.4e-62
WP_015059991.1|1579566_1580364_-	carbapenem-hydrolyzing class D beta-lactamase OXA-48	NA	NA	NA	NA	NA
WP_025987686.1|1581276_1582482_+|transposase	IS4 family transposase	transposase	Q9E8P4	Bluetongue_virus	72.0	9.9e-170
WP_004187429.1|1582813_1583071_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_020277900.1|1583039_1583405_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_004187425.1|1583497_1583932_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.3	1.2e-29
WP_015059993.1|1583880_1585185_+	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	50.1	7.8e-112
WP_004187413.1|1585307_1585517_-	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	42.0	7.0e-07
WP_004187411.1|1585519_1585738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117255451.1|1585990_1587313_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	34.2	7.0e-68
WP_117255452.1|1587327_1588188_-	DNA-binding protein	NA	I6R977	Salmonella_phage	49.2	6.4e-62
WP_003035828.1|1588556_1589645_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	53.4	4.8e-99
WP_003035825.1|1589828_1591019_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_003035823.1|1591072_1591720_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003035820.1|1591748_1592297_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	32.6	3.5e-05
WP_008320228.1|1592474_1594226_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003035811.1|1594485_1598946_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_003035809.1|1598945_1599650_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_003035806.1|1599630_1600953_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_003035803.1|1600945_1601749_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_003035801.1|1601884_1602661_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_003035798.1|1602637_1603531_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_003035796.1|1603695_1604442_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003035793.1|1604438_1604621_-	protein YcaR	NA	NA	NA	NA	NA
WP_003035790.1|1604672_1605905_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003035787.1|1605946_1606924_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_003035784.1|1606920_1608669_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	2.4e-60
WP_003035783.1|1608705_1610970_-	ComEC family protein	NA	NA	NA	NA	NA
WP_003035780.1|1611176_1611461_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	39.1	9.2e-10
WP_003035776.1|1611620_1613294_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_003035772.1|1613407_1614091_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_153983834.1|1614262_1615546_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003035766.1|1615615_1616704_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.0	6.6e-80
WP_003035760.1|1616916_1617609_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_003035758.1|1617745_1619506_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_003035756.1|1619910_1620768_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_003035753.1|1620827_1623110_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	3.8e-162
WP_153983835.1|1623597_1624836_+	acyltransferase family protein	NA	A0A088CPR9	Enterobacteria_phage	28.8	7.3e-27
WP_153983836.1|1625973_1627671_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	58.9	1.4e-169
WP_048231835.1|1627670_1628180_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	48.5	1.9e-34
WP_048231758.1|1628226_1628925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048231836.1|1628956_1629331_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_153983837.1|1629345_1630995_-	hypothetical protein	NA	F1BUK3	Cronobacter_phage	61.7	1.7e-100
WP_048231759.1|1631015_1631549_-	protein phage	NA	F1BUK5	Cronobacter_phage	65.4	3.8e-65
WP_153983880.1|1631541_1632726_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	70.3	1.0e-158
WP_048231761.1|1632703_1633048_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	67.3	3.2e-33
WP_048231763.1|1633044_1634964_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	38.9	2.7e-113
WP_048231765.1|1635151_1635421_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	57.6	4.5e-22
WP_153983838.1|1635522_1635900_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	53.8	8.8e-24
WP_153983839.1|1635896_1636406_-	glycoside hydrolase family protein	NA	A0A218M4K3	Erwinia_phage	80.8	3.9e-75
WP_048231769.1|1636389_1636611_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	43.8	3.6e-09
WP_048231771.1|1636613_1637072_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	60.5	4.9e-45
WP_153983840.1|1637071_1638595_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	58.3	7.2e-109
WP_153983841.1|1638597_1639305_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	63.6	3.2e-75
WP_153983842.1|1639277_1639784_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.0	2.1e-36
WP_153983843.1|1639780_1640233_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	49.7	2.1e-32
WP_153983844.1|1640329_1641031_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	47.3	8.3e-52
WP_153983845.1|1641039_1642086_-|capsid	phage major capsid protein, P2 family	capsid	Q94MZ4	Haemophilus_virus	43.7	5.4e-71
WP_153983846.1|1642095_1642959_-|capsid	phage capsid protein	capsid	A5X9H4	Aeromonas_virus	37.0	3.3e-34
WP_153983847.1|1643140_1644922_+|terminase	terminase	terminase	A5X9H3	Aeromonas_virus	57.7	7.2e-201
WP_153983848.1|1644918_1645947_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	50.7	1.5e-102
WP_153983881.1|1646004_1646274_+	hypothetical protein	NA	F1BUM8	Cronobacter_phage	46.9	5.1e-18
WP_153983849.1|1646317_1646683_-	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	55.8	3.4e-33
WP_153983850.1|1646685_1646880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983851.1|1646882_1649546_-	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	46.8	1.6e-233
WP_153983852.1|1649806_1650367_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	34.4	6.5e-23
WP_153983853.1|1650376_1650712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983882.1|1650731_1651055_-	hypothetical protein	NA	Q1JS26	Enterobacteria_phage	65.3	5.9e-29
WP_153983854.1|1651191_1651491_+	XRE family transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	82.8	6.7e-43
WP_153983855.1|1651584_1652580_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	79.8	5.7e-155
WP_048231800.1|1652611_1653409_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	7.8e-22
WP_003035749.1|1653452_1654874_-	amino acid permease	NA	NA	NA	NA	NA
WP_003035748.1|1655087_1656236_-	MFS transporter	NA	NA	NA	NA	NA
WP_003035746.1|1656621_1657248_+	hydrolase	NA	NA	NA	NA	NA
WP_003035744.1|1657357_1658221_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_003035741.1|1658222_1658840_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	2.8e-75
WP_003035739.1|1658850_1661295_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.7	3.5e-222
WP_003035737.1|1661531_1662824_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.1	3.3e-94
WP_003035735.1|1662916_1664260_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	1.3e-80
WP_008320214.1|1664270_1664882_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_153983856.1|1664993_1669016_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	2.9e-88
WP_002439523.1|1669150_1669645_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_008320202.1|1670192_1671161_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	1.9e-62
WP_003035725.1|1671275_1673042_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.6	1.8e-23
1672792:1672811	attR	TGCTGCTGCTGGATGAACCC	NA	NA	NA	NA
WP_003035722.1|1673042_1674764_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.6	1.4e-15
WP_003035721.1|1674808_1675513_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 11
NZ_CP038653	Citrobacter freundii strain 154 chromosome, complete genome	5143118	2291882	2341182	5143118	capsid,transposase,integrase,protease	Stx2-converting_phage(33.33%)	41	2294588:2294605	2337075:2337092
WP_003838722.1|2291882_2292464_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_008321015.1|2292469_2292874_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_008321017.1|2292870_2293728_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_008321019.1|2293816_2295361_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
2294588:2294605	attL	GGCGAATGGCAAACCGAA	NA	NA	NA	NA
WP_008321021.1|2295372_2296509_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003838732.1|2296522_2296612_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_008321024.1|2296664_2297378_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_008321026.1|2297570_2299040_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_003838738.1|2299163_2299613_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_008321029.1|2299780_2300785_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.4e-23
WP_003838742.1|2300938_2302390_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_003838744.1|2302402_2303584_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_008321031.1|2303749_2305228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321033.1|2305755_2306958_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_008321035.1|2307078_2307279_-	glycogen synthase	NA	NA	NA	NA	NA
WP_008321037.1|2307508_2307718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321040.1|2307850_2308885_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_008321041.1|2308900_2309242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321043.1|2309810_2311970_-	hypothetical protein	NA	A0A2H4YH07	Raoultella_phage	36.2	6.6e-07
WP_008321044.1|2312018_2312414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321046.1|2312570_2313056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321048.1|2313069_2313987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321052.1|2314261_2314705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321055.1|2316744_2317305_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SCL7	Streptococcus_phage	34.6	1.8e-17
WP_008321059.1|2317985_2318378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321061.1|2319142_2320462_+|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	27.7	4.5e-06
WP_008321066.1|2321342_2322107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008321072.1|2322568_2323189_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_003029581.1|2323244_2323901_-	hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	82.1	6.2e-09
WP_003029582.1|2323929_2324238_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_077258089.1|2324747_2324918_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003029584.1|2325146_2326070_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_003029587.1|2326235_2327753_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000345204.1|2327890_2329261_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_003029589.1|2329260_2330661_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.1	2.0e-20
WP_003029591.1|2330690_2331695_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_008321087.1|2335237_2336698_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001548946.1|2336698_2338720_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
2337075:2337092	attR	TTCGGTTTGCCATTCGCC	NA	NA	NA	NA
WP_001201739.1|2338869_2339253_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_000609174.1|2339249_2339597_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001000409.1|2339646_2341182_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
>prophage 12
NZ_CP038653	Citrobacter freundii strain 154 chromosome, complete genome	5143118	2364583	2405637	5143118	plate,holin,integrase,capsid,tail	Salmonella_phage(48.21%)	62	2364352:2364397	2405652:2405697
2364352:2364397	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_061549414.1|2364583_2365129_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	87.2	3.1e-86
WP_153983797.1|2365204_2365573_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_153983798.1|2365582_2366704_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	61.5	1.2e-60
WP_061549416.1|2366703_2367384_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	81.4	2.5e-109
WP_153983799.1|2367380_2368580_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	82.7	1.8e-179
WP_016239889.1|2368580_2368934_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	76.1	1.1e-44
WP_048219596.1|2368933_2369674_-|plate	phage baseplate assembly protein V	plate	A0A0M5M1K7	Salmonella_phage	62.0	2.6e-72
WP_061549418.1|2369739_2370462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061549419.1|2370469_2371534_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	67.1	7.2e-140
WP_001160174.1|2371536_2371842_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	53.5	9.2e-24
WP_153983800.1|2371843_2372446_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	70.1	5.6e-65
WP_153983801.1|2372445_2374449_-	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	55.1	1.3e-193
WP_112899804.1|2374626_2375052_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	56.7	3.5e-37
WP_000257257.1|2375055_2375496_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	77.4	7.5e-59
WP_153983802.1|2375506_2376667_-	DUF3383 family protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.8	5.4e-157
WP_153983875.1|2376670_2377234_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.1	3.8e-79
WP_001515083.1|2377208_2377598_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	2.7e-68
WP_147679414.1|2377584_2378172_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	76.9	7.6e-75
WP_153983803.1|2378168_2378576_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	97.0	2.1e-71
WP_001040703.1|2378541_2378931_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	57.4	6.5e-30
WP_153983804.1|2378972_2379914_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	97.4	9.4e-176
WP_032177172.1|2379925_2380429_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	84.4	3.2e-74
WP_153983805.1|2380433_2381666_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	93.7	5.3e-219
WP_153983876.1|2381680_2382418_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	95.5	1.3e-108
WP_153983806.1|2382302_2383772_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	95.1	1.5e-268
WP_048219616.1|2383771_2385394_-	bacteriophage TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	4.5e-311
WP_153983807.1|2385396_2385870_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	68.0	3.6e-51
WP_001081498.1|2385901_2386522_-	hypothetical protein	NA	I6S676	Salmonella_phage	73.2	4.4e-89
WP_029403918.1|2386576_2386762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048219618.1|2386905_2387298_-	hypothetical protein	NA	A0A192Y6H8	Salmonella_phage	75.0	1.7e-46
WP_153983808.1|2387294_2387909_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	90.1	1.4e-98
WP_048219622.1|2387911_2388259_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	82.4	3.0e-47
WP_082138498.1|2388516_2389200_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	44.1	4.9e-41
WP_045354712.1|2389196_2389559_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	65.5	2.7e-38
WP_052674422.1|2389549_2390032_-	AsnC family protein	NA	A0A068CBG2	Acinetobacter_phage	51.5	5.2e-37
WP_044702921.1|2390028_2390328_-	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	88.0	5.1e-43
WP_061549425.1|2390317_2390770_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	53.1	3.4e-38
WP_061549426.1|2391010_2391349_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	85.7	4.9e-50
WP_061549427.1|2391341_2391743_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	75.0	1.5e-45
WP_082805395.1|2391735_2392422_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	85.4	9.6e-45
WP_061549428.1|2392423_2393119_-	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	32.3	5.0e-25
WP_153983809.1|2393115_2393283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048219627.1|2393279_2393570_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	65.2	1.8e-29
WP_153983810.1|2393569_2394967_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	63.8	3.3e-169
WP_108961704.1|2394963_2395776_-	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	45.0	7.9e-54
WP_000426372.1|2396244_2396565_-	hypothetical protein	NA	H6WRX6	Salmonella_phage	88.7	2.9e-44
WP_108961705.1|2396602_2396830_-	transcriptional regulator	NA	K7P6H5	Enterobacteria_phage	69.0	1.9e-18
WP_108961706.1|2396950_2397664_+	helix-turn-helix domain-containing protein	NA	M9NZE3	Enterobacteria_phage	83.1	1.7e-113
WP_061549435.1|2397675_2398104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061549442.1|2398217_2398427_+	hypothetical protein	NA	C6ZR45	Salmonella_phage	60.9	4.2e-12
WP_108961707.1|2398448_2398646_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	53.1	1.3e-10
WP_000501155.1|2399062_2399260_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_153983811.1|2399270_2399543_+	hypothetical protein	NA	S4TU79	Salmonella_phage	61.1	2.7e-27
WP_109863254.1|2399582_2400173_+	hypothetical protein	NA	A0A291AXG3	Shigella_phage	31.7	1.0e-10
WP_044702471.1|2400403_2400844_+	hypothetical protein	NA	Q6WYF0	Enterobacteria_phage	46.7	1.3e-26
WP_044702473.1|2400836_2401523_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	36.6	3.6e-15
WP_016243544.1|2401519_2402191_+	AAA family ATPase	NA	G9L667	Escherichia_phage	46.6	8.8e-51
WP_045399452.1|2402207_2402894_+	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	40.8	2.0e-26
WP_021571176.1|2402905_2403064_+	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	56.9	3.3e-09
WP_031275321.1|2403114_2403966_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	84.3	3.2e-138
WP_031275320.1|2403968_2404208_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	87.3	1.2e-31
WP_021242885.1|2404473_2405637_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	67.2	2.1e-153
2405652:2405697	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
>prophage 13
NZ_CP038653	Citrobacter freundii strain 154 chromosome, complete genome	5143118	2746486	2805562	5143118	transposase,integrase,capsid	Sodalis_phage(14.29%)	58	2750793:2750809	2813127:2813143
WP_003019184.1|2746486_2747449_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.2	2.7e-69
WP_003019187.1|2747679_2748495_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003019190.1|2748543_2749194_+	LysE family translocator	NA	NA	NA	NA	NA
WP_003019192.1|2749519_2750761_+	multidrug efflux MFS transporter MdtM	NA	NA	NA	NA	NA
2750793:2750809	attL	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_003019195.1|2750841_2752032_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_003019196.1|2752062_2753295_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_003019198.1|2753514_2754441_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003019200.1|2754516_2755797_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_003019202.1|2755810_2756275_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003019203.1|2756372_2757560_+	MFS transporter	NA	NA	NA	NA	NA
WP_003019205.1|2757750_2758152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322158.1|2758215_2759223_-	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	49.7	8.2e-85
WP_008322159.1|2759414_2759618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003033268.1|2760266_2761040_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_003033266.1|2761172_2762648_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.6	5.8e-47
WP_003033263.1|2762726_2763911_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_003033260.1|2764170_2765514_+	gluconate permease GntP	NA	NA	NA	NA	NA
WP_003033257.1|2765563_2766259_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_003033254.1|2766251_2767679_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_003033252.1|2767689_2768409_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_003029921.1|2768990_2770544_+	L-lactate permease	NA	NA	NA	NA	NA
WP_003031569.1|2771025_2771883_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_003031571.1|2771894_2773160_-	tyrosine permease	NA	NA	NA	NA	NA
WP_003031573.1|2773349_2774720_-	tyrosine phenol-lyase	NA	NA	NA	NA	NA
WP_003031575.1|2775498_2775861_+	endoribonuclease SymE	NA	NA	NA	NA	NA
WP_003031576.1|2776104_2776779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003031578.1|2776780_2777128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019450.1|2777506_2778487_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_153983877.1|2778531_2778810_+	cytoplasmic protein USSDB7A	NA	NA	NA	NA	NA
WP_100216202.1|2779172_2780340_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	8.4e-166
WP_143993159.1|2781455_2781647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983820.1|2781777_2782809_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_153983821.1|2782825_2783188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143993162.1|2783184_2783409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057056066.1|2784133_2784472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983878.1|2784464_2784728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983822.1|2784858_2785320_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_153983823.1|2785313_2786039_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153983824.1|2786247_2786403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157809232.1|2788133_2788694_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_153983825.1|2788690_2788912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142673817.1|2789307_2789859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008322865.1|2790037_2790478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322868.1|2790713_2790935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322871.1|2791563_2792277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983826.1|2792361_2793456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008322874.1|2793694_2794717_+	DNA methyltransferase	NA	Q96718	Paramecium_bursaria_Chlorella_virus	27.9	8.8e-26
WP_008322875.1|2794770_2797023_+	N-6 DNA methylase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	22.2	5.1e-10
WP_008322876.1|2797015_2797609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322877.1|2797674_2798127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322880.1|2798572_2799010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983827.1|2798978_2800160_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_008322888.1|2800690_2801077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322889.1|2801095_2801410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322891.1|2801463_2801889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001062150.1|2801985_2802372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016155585.1|2802386_2804261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008322896.1|2804257_2805562_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2813127:2813143	attR	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 14
NZ_CP038653	Citrobacter freundii strain 154 chromosome, complete genome	5143118	3880385	3957606	5143118	integrase,protease,capsid,tail,head,portal,terminase,tRNA	uncultured_Caudovirales_phage(71.43%)	74	3904182:3904200	3920424:3920442
WP_003031157.1|3880385_3881333_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.8	2.0e-08
WP_003031159.1|3881347_3881857_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_003031161.1|3881986_3883111_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003031162.1|3883082_3883556_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_008324985.1|3883582_3884125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003031166.1|3884129_3884702_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_003031168.1|3884703_3885525_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_003031169.1|3885521_3885779_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_003031171.1|3885754_3886309_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_003025300.1|3892302_3893061_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	3.1e-20
WP_003025299.1|3893068_3894172_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003025297.1|3894181_3895363_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003025295.1|3895432_3896458_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	9.0e-71
WP_003025292.1|3896917_3897139_-	membrane protein	NA	NA	NA	NA	NA
WP_003025288.1|3897409_3900523_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_003025285.1|3900534_3901695_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003025283.1|3902114_3902771_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
WP_003025279.1|3902816_3902981_-	DUF2556 family protein	NA	NA	NA	NA	NA
WP_008320694.1|3903063_3903948_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	3.6e-28
3904182:3904200	attL	GTGCAGTCAGTGGTGCAGT	NA	NA	NA	NA
WP_153983641.1|3904237_3905461_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	93.4	2.7e-231
WP_153983642.1|3905457_3906258_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	38.3	8.1e-35
WP_153983643.1|3906358_3906565_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	82.4	1.5e-25
WP_162009219.1|3907346_3907559_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	50.9	1.2e-09
WP_078309651.1|3907551_3907737_+	hypothetical protein	NA	A0A2H4JFH8	uncultured_Caudovirales_phage	85.2	8.3e-20
WP_001547834.1|3907729_3907957_+	hypothetical protein	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	100.0	1.6e-33
WP_153983645.1|3907953_3908322_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	99.2	6.1e-62
WP_153983646.1|3908318_3909683_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	97.1	3.4e-259
WP_045329600.1|3909905_3910160_+	hypothetical protein	NA	A0A2H4JEE4	uncultured_Caudovirales_phage	98.8	3.2e-38
WP_023332888.1|3910172_3910472_+	hypothetical protein	NA	A0A2H4JB54	uncultured_Caudovirales_phage	100.0	1.1e-48
WP_153983647.1|3910703_3911870_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	94.1	4.6e-204
WP_153983648.1|3911921_3912482_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	98.4	1.3e-100
WP_153983649.1|3912483_3913719_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	98.8	3.5e-239
WP_112018966.1|3913715_3914054_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	95.5	5.0e-55
WP_112018967.1|3914050_3914344_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	97.9	3.6e-49
WP_112018968.1|3914343_3914787_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	95.9	2.9e-82
WP_162009211.1|3914779_3914932_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	98.0	5.2e-20
WP_000113647.1|3915062_3915419_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_153983650.1|3915402_3917064_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.7	0.0e+00
WP_153983651.1|3917077_3920383_+|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	58.7	1.8e-285
WP_153983652.1|3920535_3920910_-	hypothetical protein	NA	NA	NA	NA	NA
3920424:3920442	attR	GTGCAGTCAGTGGTGCAGT	NA	NA	NA	NA
WP_000462905.1|3921419_3921716_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_003025224.1|3921741_3922707_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003025221.1|3923067_3923949_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_003025218.1|3923960_3925412_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_003025216.1|3925401_3925644_-	YhdT family protein	NA	NA	NA	NA	NA
WP_003025213.1|3925751_3927101_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_003025210.1|3927111_3927582_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_003025208.1|3927974_3928574_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_003025204.1|3929698_3930673_-	oxidoreductase	NA	NA	NA	NA	NA
WP_003025202.1|3930898_3932839_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_153752135.1|3932847_3933168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000913396.1|3933145_3934189_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_003025198.1|3934255_3935278_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003025196.1|3935278_3935767_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003025192.1|3935774_3936368_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003025190.1|3936357_3937827_+	ribonuclease G	NA	NA	NA	NA	NA
WP_003025186.1|3937938_3941754_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_003025183.1|3941915_3943361_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_003839896.1|3943447_3944377_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_003025177.1|3944561_3944765_+	AaeX family protein	NA	NA	NA	NA	NA
WP_003025174.1|3944772_3945705_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_003025171.1|3945710_3947678_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_003025168.1|3947797_3948076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003025165.1|3948133_3948400_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_003025162.1|3948776_3949247_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_003025158.1|3949683_3950619_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_003025154.1|3950675_3951743_-	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_003025151.1|3951832_3953200_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	2.5e-20
WP_003025147.1|3953368_3953767_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_003025144.1|3953959_3955087_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_003025141.1|3955305_3955734_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_003025138.1|3955749_3956142_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_003025132.1|3956458_3957097_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_003025130.1|3957102_3957606_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	7.3e-26
>prophage 15
NZ_CP038653	Citrobacter freundii strain 154 chromosome, complete genome	5143118	3980291	3987942	5143118		Thermobifida_phage(16.67%)	10	NA	NA
WP_003025085.1|3980291_3981146_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_003025083.1|3981191_3981683_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_003025078.1|3981766_3982054_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	4.2e-10
WP_003025074.1|3982076_3983510_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003025073.1|3983556_3984282_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_003025070.1|3984288_3984837_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_003025068.1|3984805_3985381_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_003025065.1|3985377_3985944_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.3	4.2e-54
WP_003025063.1|3985964_3986951_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_003025060.1|3986964_3987942_-	calcium/sodium antiporter	NA	A0A2D1GNI8	Pseudoalteromonas_phage	23.3	4.8e-05
>prophage 16
NZ_CP038653	Citrobacter freundii strain 154 chromosome, complete genome	5143118	4136273	4146278	5143118	portal,integrase	Moraxella_phage(16.67%)	12	4130584:4130596	4138466:4138478
4130584:4130596	attL	TAATGATCATTTA	NA	NA	NA	NA
WP_118929543.1|4136273_4137674_+|integrase	site-specific integrase	integrase	A0A0R6PGY7	Moraxella_phage	31.5	4.4e-44
WP_153983656.1|4137670_4138453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983657.1|4138599_4138791_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
4138466:4138478	attR	TAAATGATCATTA	NA	NA	NA	NA
WP_001118612.1|4139173_4139350_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	55.6	4.2e-05
WP_118929373.1|4139342_4139702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045330990.1|4139733_4140018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045330937.1|4140014_4140398_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_153983658.1|4140394_4143067_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.4	1.6e-58
WP_118929541.1|4143468_4144230_+	septation initiation protein	NA	NA	NA	NA	NA
WP_061357369.1|4144229_4144502_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	44.9	1.4e-07
WP_058712693.1|4144856_4145219_-	hypothetical protein	NA	B2ZY70	Ralstonia_phage	42.2	3.0e-13
WP_153983659.1|4145222_4146278_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.1	1.1e-169
>prophage 17
NZ_CP038653	Citrobacter freundii strain 154 chromosome, complete genome	5143118	4258038	4274625	5143118	transposase,integrase	Escherichia_phage(50.0%)	19	4252475:4252534	4279191:4279960
4252475:4252534	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_000935452.1|4258038_4259343_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|4259389_4260094_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|4260283_4261099_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|4261249_4261954_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|4262014_4262851_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|4262850_4263654_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001043265.1|4263714_4264530_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000240536.1|4264837_4265689_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|4266444_4267149_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|4267381_4268242_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|4268254_4268797_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|4269278_4269470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000248278.1|4269493_4269721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|4269771_4270908_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_014342212.1|4270874_4271024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000971921.1|4271022_4272393_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_014342213.1|4272534_4272660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|4273213_4274074_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001387387.1|4274223_4274625_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
4279191:4279960	attR	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACCGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACCGCCCGCATTATGGGCGTTGGCCTCAACACGATTTTCCGCCATTTAAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGGATACGTCGGGGCTAAATCGCGCCAGCGCTGGCTGTTTTACGCGTATGACAGGCTCCGGAAGACGGTTGTTGCGCACGTATTCGGTGAACGCACTATGGCGACGCTGGGGCGTCTTATGAGCCTGCTGTCACCCTTTGACGTGGTGATATGGATGACGGATGGCTGGCCGCTGTATGAATCCCGCCTGAAGGGAAAGCTGCACGTAATCAGCAAGCGATATACGCAGCGAATTGAGCGGCATAACCTGAATCTGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACCCC	NA	NA	NA	NA
>prophage 18
NZ_CP038653	Citrobacter freundii strain 154 chromosome, complete genome	5143118	4856901	4903457	5143118	holin,integrase,tail,transposase,terminase	Salmonella_phage(59.18%)	53	4841234:4841249	4871806:4871821
4841234:4841249	attL	AGCTGGAAGCCAAAGA	NA	NA	NA	NA
WP_153983680.1|4856901_4858368_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	4.4e-87
WP_003037760.1|4858431_4860009_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_108961756.1|4860201_4861455_+|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	88.7	6.8e-214
WP_045717171.1|4861451_4861631_-	hypothetical protein	NA	T1SA82	Salmonella_phage	96.6	3.5e-23
WP_108961755.1|4861627_4862221_-	adenine methylase	NA	T1SA14	Salmonella_phage	94.9	3.0e-111
WP_153983681.1|4862217_4863285_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	98.6	2.8e-200
WP_153983682.1|4863281_4863440_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	76.9	1.4e-15
WP_016046630.1|4863432_4863732_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	100.0	1.1e-48
WP_000816432.1|4863841_4864090_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	81.7	1.5e-32
WP_003037791.1|4864136_4865078_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	90.4	4.5e-162
WP_003037794.1|4865074_4865896_-	exonuclease VIII/RecE-like protein	NA	A0A193GYK2	Enterobacter_phage	98.5	9.8e-161
WP_003037797.1|4865892_4866195_-	hypothetical protein	NA	T1SA88	Salmonella_phage	96.0	5.5e-45
WP_153983683.1|4866202_4867162_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	64.3	2.7e-45
WP_153983684.1|4867532_4868129_-	helix-turn-helix domain-containing protein	NA	Q858D7	Salmonella_phage	98.5	2.2e-106
WP_001278768.1|4868284_4868518_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	100.0	1.2e-39
WP_052930708.1|4868665_4868866_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	74.2	4.3e-22
WP_153983685.1|4868881_4869676_+	primosomal protein	NA	Q286X4	Escherichia_phage	73.8	3.0e-90
WP_153983686.1|4869672_4870458_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	88.9	5.5e-137
WP_080313187.1|4870575_4870920_+	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	97.4	6.3e-61
WP_153983687.1|4871340_4871598_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	90.6	1.0e-36
WP_153983688.1|4871594_4872110_+	hypothetical protein	NA	A0A220NQV2	Salmonella_phage	33.5	4.9e-09
4871806:4871821	attR	AGCTGGAAGCCAAAGA	NA	NA	NA	NA
WP_127516700.1|4872111_4872480_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	96.7	4.1e-66
WP_153983689.1|4872476_4872908_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	68.3	2.0e-27
WP_153983690.1|4873022_4873361_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	89.3	1.3e-50
WP_153983867.1|4873464_4874061_+|terminase	terminase small subunit	terminase	Q858H4	Salmonella_phage	99.0	6.7e-103
WP_153983691.1|4874057_4875539_+|terminase	terminase	terminase	M1F3C4	Salmonella_phage	97.6	4.3e-292
WP_086550318.1|4875582_4876002_-	hypothetical protein	NA	A0A2H4ZJ80	Enterobacter_phage	87.8	8.8e-17
WP_000334867.1|4876837_4877044_+	hypothetical protein	NA	T1SA67	Salmonella_phage	100.0	5.7e-09
WP_153983692.1|4877058_4878729_+|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	96.9	3.1e-307
WP_053388643.1|4878725_4879022_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	81.6	7.6e-39
WP_153983693.1|4879024_4879720_+	peptidase	NA	Q858G9	Salmonella_phage	77.4	1.7e-65
WP_049014925.1|4879734_4880721_+	phage protein	NA	A0A193GZ49	Enterobacter_phage	86.3	3.9e-164
WP_153983694.1|4880772_4881213_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	90.4	4.1e-65
WP_049014922.1|4881223_4881604_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	51.2	5.2e-24
WP_153983695.1|4881655_4881979_+	hypothetical protein	NA	A0A193GYH8	Enterobacter_phage	72.8	1.7e-36
WP_108961738.1|4881978_4882584_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	98.5	2.6e-110
WP_153983696.1|4882583_4885061_+	hypothetical protein	NA	Q858G3	Salmonella_phage	97.6	0.0e+00
WP_153983697.1|4885060_4885525_+	hypothetical protein	NA	T1SA73	Salmonella_phage	94.8	3.2e-84
WP_153983698.1|4885524_4886067_+	hypothetical protein	NA	T1SA02	Salmonella_phage	93.3	5.4e-67
WP_153983699.1|4886079_4888608_+	hypothetical protein	NA	Q858G0	Salmonella_phage	97.7	0.0e+00
WP_153983700.1|4888607_4890173_+	hypothetical protein	NA	Q858F9	Salmonella_phage	73.8	3.0e-243
WP_153983701.1|4890172_4892929_+	hypothetical protein	NA	Q858F8	Salmonella_phage	94.7	0.0e+00
WP_003838319.1|4893956_4894109_-	hypothetical protein	NA	G9L6D9	Escherichia_phage	85.7	1.5e-14
WP_153983703.1|4894177_4894864_-	BRO-like protein	NA	G9L6E2	Escherichia_phage	65.5	9.8e-82
WP_001187608.1|4895177_4895438_-	hypothetical protein	NA	G9L6E3	Escherichia_phage	83.3	1.2e-35
WP_032933742.1|4896998_4897925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001275998.1|4898092_4898497_+	membrane protein	NA	T1SA79	Salmonella_phage	100.0	9.9e-66
WP_016046623.1|4898483_4898792_+|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	100.0	2.6e-50
WP_153983704.1|4898781_4899408_+	glycoside hydrolase family 19 protein	NA	T1SBJ3	Salmonella_phage	89.4	4.7e-107
WP_108961729.1|4899404_4899893_+	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	66.7	1.4e-50
WP_003037905.1|4900092_4900971_-	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_071524479.1|4901335_4901539_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	71.4	4.3e-17
WP_001567660.1|4902434_4903457_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP038654	Citrobacter freundii strain 154 plasmid p154_1, complete sequence	296117	199809	252390	296117	transposase,integrase	Escherichia_phage(39.13%)	52	237432:237491	254404:256424
WP_119505882.1|199809_200724_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.7	9.5e-173
WP_000900745.1|200889_201207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371904.1|201257_201665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000285959.1|202122_202794_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_001100610.1|202838_203144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785965.1|203166_203484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611902.1|203705_205052_+|transposase	ISNCY-like element ISLad2 family transposase	transposase	NA	NA	NA	NA
WP_000589340.1|205110_205914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000482601.1|205927_207289_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_016239970.1|207441_207882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016239971.1|207899_208706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044704760.1|209000_210404_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000130816.1|210436_211141_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
WP_000941305.1|211227_211548_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000922628.1|211593_212883_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000065802.1|212895_213321_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_001066652.1|213380_214208_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000927306.1|214226_215705_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
WP_000864986.1|216196_216472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371914.1|216612_216810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000637193.1|217796_218054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001005009.1|218127_218442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000975181.1|218489_219386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031942328.1|219388_219904_-	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000833382.1|220118_221546_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000078514.1|221796_223116_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_001572381.1|223395_224601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044704764.1|224597_225416_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000019951.1|225881_226154_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001572377.1|226276_227392_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000723070.1|227649_228084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004248839.1|228301_229648_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	8.8e-18
WP_016809156.1|229686_230655_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	3.9e-185
WP_044704969.1|230843_232466_+	MCR-9 family phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
WP_044704902.1|234556_234808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983901.1|234914_235085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024266332.1|235369_235999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032489926.1|236462_237338_-	class A extended-spectrum beta-lactamase CTX-M-9	NA	A0A1B0VBP7	Salmonella_phage	99.3	2.3e-152
237432:237491	attL	CGGGTATAGGAAGTATAAACCACCTTTTTGCTCCTCATCCGAAGTATCTTACCTGAAATT	NA	NA	NA	NA
WP_000050481.1|237664_239206_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|239610_240450_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|240443_240791_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|240954_241746_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_032490158.1|241850_242324_-	trimethoprim-resistant dihydrofolate reductase DfrA16	NA	G3MBI7	Bacillus_virus	30.8	1.4e-18
WP_015057121.1|242479_243439_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_001067855.1|243329_244034_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011152976.1|244210_244870_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	99.1	4.2e-130
WP_001067855.1|245091_245796_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|246404_247109_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002903955.1|248742_249645_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|249906_250668_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|250688_251549_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|251685_252390_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
254404:256424	attR	AATTTCAGGTAAGATACTTCGGATGAGGAGCAAAAAGGTGGTTTATACTTCCTATACCCGTTAGCACCCTCCCTGATTAAAGGAAGCCGTATGGATATTATTGATAAAGTTTTTCAGCAAGAGGATTTCTCACGCCAGGATTTGAGTGACAGCCGTTTTCGCCGCTGCCGCTTTTATCAGTGTGACTTCAGCCACTGTCAGCTGCAGGATGCCAGTTTCGAGGATTGCAGTTTCATTGAAAGCGGCGCCGTTGAAGGGTGTCACTTCAGCTATGCCGATCTGCGCGATGCCAGTTTCAAGGCCTGCCGTCTGTCTTTGGCCAACTTCAGCGGTGCCAACTGCTTTGGCATAGAGTTCAGGGAGTGCGATCTCAAGGGCGCCAACTTTTCCCGGGCCCGCTTCTACAATCAAGTCAGCCATAAGATGTACTTCTGCTCGGCTTATATCTCAGGTTGCAACCTGGCCTATACCAACTTGAGTGGCCAATGCCTGGAAAAATGCGAGCTGTTTGAAAACAACTGGAGCAATGCCAATCTCAGCGGCGCTTCCTTGATGGGCTCAGATCTCAGCCGCGGCACCTTCTCCCGCGACTGTTGGCAACAGGTCAATCTGCGGGGCTGTGACCTGACCTTTGCCGATCTGGATGGGCTCGACCCCAGACGGGTCAACCTCGAAGGAGTCAAGATCTGTGCCTGGCAACAGGAGCAACTGCTGGAACCCTTGGGAGTAATAGTGCTGCCGGATTAGCTCGAATGCAAACACAAGAGGCAAATATCACTTGAGTTCCGCGCTACAACAAGGCAGATTCTGCTATAGCAGAGTATTACCGCCGGAATGCCGTTTCTCTGCTGCCGCAGCCGACGTTATACCTTCCCTTCAAAGGAGGCATTATGAAGACTCAACTGCCCTAAAGAAAAACTTACAGGTGGATTATGGTCAGACGTTATCTCCCCCTTAACCCGCTGCGCGCCTTTGAGGCCGCCGCCCGTCATCTCAGTTTTACCCGCGCGGCGATTGAGCTGAATGTCACCCATGCCGCCGTCAGCCAGCAGGTCAGGGCGCTGGAAGAACAACTCGGCTGTGTGCTGTTTACCCGCGTCTCGCGCGGGCTGGTGCTGACCCATGAAGGTGAGGGATTACTGCCGGTGCTCAATGAGGCGTTTGACCGGATTGCGGATACTCTGGAGTGTTTTTCTCACGGGCAGTTCCGTGAGCGGGTGAAAGTCGGTGCGGTGGGAACATTTGCCGCAGGCTGGCTGCTGCCGCGTCTGGCCGGATTCTATGACAGCCATCCGCATATTGATCTGCATATCTCCACCCATAACAATCATGTGGACCCGGCGGCGGAAGGGCATGATTATACGATCCGTTTCGGTAACGGCGCGTGGCATGAGTCAGATGCGGAACTGATTTTCAGTGCACCACACGCTCCGCTGTGCTCACCGGCCATTGCAGAACAGTTACAGCAGCCGGATGATGTTCACCGCTTTACCCTGCTGCGCTCATTCCGCCGGGATGAATGGAGCCGCTGGCTGGATTGTGCGGGCGGCACACCGCCTTCCCCGTCACAGCCGGTAATGGTGTTCGATACCTCACTGGCCATGGCCGAGGCGGCACAACTGGGTGCCGGGGTAGCGATCGCACCGGTATGTATGTTCAGCCGCCTGTTACAGTCAGGCGCACTGGTACAGCCGTTTGCCGCAGAAATCACCCTCGGCGGCTACTGGCTGACGCGGTTACAGTCCCGTACGGAAACCCCGGCCATGCAGCAATTCGCCCGCTGGCTGCTGAATACGGCGGCGGCGTAAAACTCACTCACCTTCCAGGCTTTTTACCCGCAAATCATCACCTTCACTGATGCGCAGCCGTTCACTGCCGCAGTGCGGACAGCATCCGGCGTGCTGCATGATTTCGGCCTCACGGCTGCAATCCCAGCACCATGCCTGTGCCGGGATAACATCAATATGCAGTGTGCAGCCCTGCGCCACGGTATCACGGCAGGCGATATCAAAACAGAAATG	NA	NA	NA	NA
