The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041945	Pseudomonas aeruginosa strain ST773 chromosome, complete genome	6835731	60705	121614	6835731	plate,transposase	Dishui_lake_phycodnavirus(20.0%)	56	NA	NA
WP_023094285.1|60705_61398_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078452217.1|61388_61817_+	EndoU domain-containing protein	NA	NA	NA	NA	NA
WP_071534147.1|61968_62184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019485604.1|65737_66055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003114586.1|66285_66987_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071534148.1|67236_67749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124080958.1|69168_69426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023115685.1|69537_69816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003083536.1|69914_70310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019484681.1|70574_71984_-	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_003114583.1|72147_73521_+	T3SS effector bifunctional cytotoxin exoenzyme T	NA	NA	NA	NA	NA
WP_003111706.1|74016_74703_+	CsgG/HfaB family protein	NA	NA	NA	NA	NA
WP_033938683.1|74733_75087_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_157832017.1|75128_75749_+	DUF799 family lipoprotein	NA	NA	NA	NA	NA
WP_003128160.1|75763_76147_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033938681.1|76428_78090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003083582.1|78683_78824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016263993.1|79645_81478_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A2K9R7N5	Dishui_lake_phycodnavirus	28.3	2.7e-17
WP_033938680.1|81530_81959_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003111524.1|82398_82869_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_033938679.1|82885_83434_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	42.8	1.9e-35
WP_003083593.1|83472_83979_-	DUF1993 family protein	NA	NA	NA	NA	NA
WP_003083596.1|84044_84965_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003083599.1|85072_85960_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003136951.1|86022_86727_+	DsbA family protein	NA	NA	NA	NA	NA
WP_003118563.1|86810_87266_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003083610.1|87376_87610_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_003083612.1|87621_88059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003083614.1|88115_88532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049311144.1|88623_89751_+	aminopeptidase	NA	NA	NA	NA	NA
WP_003114660.1|89758_90742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003111507.1|90774_91440_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003083618.1|91432_91975_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_003083621.1|92052_94098_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	21.3	4.6e-34
WP_003083624.1|94094_94370_+	YheV family putative metal-binding protein	NA	NA	NA	NA	NA
WP_003083628.1|94458_95517_+	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_003083630.1|95747_96662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003106615.1|96723_98436_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_003083634.1|98428_99628_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003111510.1|99627_100347_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	3.3e-19
WP_033938676.1|100343_103451_-	protein kinase	NA	M1PCM5	Moumouvirus	27.8	2.5e-23
WP_003083639.1|103458_104187_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_003083642.1|104196_104877_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_023518244.1|104873_108407_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_033938675.1|108403_109753_-	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_003115052.1|109759_111094_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_003083660.1|111109_111574_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_014603462.1|111618_113142_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_003083664.1|113509_114544_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_003083666.1|114632_115151_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_003111626.1|115163_116660_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003083670.1|116735_117224_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003119488.1|117391_118237_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003111625.1|118238_118748_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003083676.1|118744_120604_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_033938673.1|120567_121614_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
NZ_CP041945	Pseudomonas aeruginosa strain ST773 chromosome, complete genome	6835731	642884	738350	6835731	tail,tRNA,plate,integrase,holin	Pseudomonas_phage(35.56%)	93	634398:634414	647939:647955
634398:634414	attL	GGCGGTGAAGCCCTGGG	NA	NA	NA	NA
WP_079381487.1|642884_643046_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_003099598.1|643348_645034_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	100.0	0.0e+00
WP_033938487.1|646114_649852_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	35.4	4.8e-13
647939:647955	attR	GGCGGTGAAGCCCTGGG	NA	NA	NA	NA
WP_003085035.1|649958_651812_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.8	1.2e-36
WP_023091418.1|651891_653886_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	40.7	3.8e-73
WP_003085042.1|653968_654418_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.8	5.0e-18
WP_003085057.1|654487_654703_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003109020.1|654903_655929_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	3.7e-109
WP_003085061.1|656007_656577_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|656660_657014_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003085067.1|657004_657547_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003099584.1|657519_658752_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_033938488.1|658795_659302_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003085073.1|659396_660950_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|660946_662218_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|662318_664241_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|664519_664852_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|664895_665747_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|665746_666127_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003085087.1|666163_666970_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003129197.1|667085_668072_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003129198.1|668068_669361_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003085092.1|669341_672143_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_033961955.1|672275_673988_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	81.4	4.4e-280
WP_003129200.1|675259_676276_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003085095.1|676272_676947_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003085097.1|676948_677707_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_033938489.1|677707_678769_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_023098434.1|678920_681314_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003099542.1|681362_681992_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023095151.1|682120_683155_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|683388_684498_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003109043.1|684553_685600_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014604087.1|685714_686962_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085119.1|687067_687898_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|688021_688696_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003085124.1|688695_689514_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003085126.1|689586_691065_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003085128.1|691250_691565_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_003085129.1|691664_692435_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.0	6.1e-72
WP_003085132.1|692892_693093_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003085135.1|693140_693500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003137382.1|693862_694312_+|holin	holin	holin	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003101620.1|694333_694849_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	1.8e-32
WP_003085141.1|694845_695403_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	71.1	4.6e-45
WP_003113199.1|695555_695882_+	bacteriophage protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	2.4e-30
WP_003085151.1|695878_696766_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
WP_033938491.1|696758_697292_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	1.5e-61
WP_003129211.1|697293_699402_+	hypothetical protein	NA	Q9ZXK6	Pseudomonas_virus	52.3	6.5e-225
WP_003085172.1|699410_699851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003109051.1|699893_701054_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	2.7e-188
WP_003085175.1|701066_701570_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|701584_701929_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_033938492.1|702098_704336_+|tail	phage tail length tape measure protein	tail	NA	NA	NA	NA
WP_003085182.1|704345_705218_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
WP_003101635.1|705192_705399_+	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003129214.1|705456_706446_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.5	6.3e-106
WP_003129215.1|706478_707108_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	7.1e-87
WP_003129216.1|707104_707467_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.1	5.5e-15
WP_003118919.1|707463_707721_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003113190.1|708036_708531_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
WP_003113189.1|708542_708890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003113188.1|708919_709174_+	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
WP_003129218.1|709220_711059_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	35.8	3.4e-28
WP_003113186.1|711051_711393_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
WP_003118922.1|711400_712096_+|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	50.2	1.5e-69
WP_003129219.1|712098_712869_+	peptidase P60	NA	A0A2D1GNP8	Pseudomonas_phage	55.6	5.5e-81
WP_003118924.1|712923_713526_+|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	57.3	4.9e-53
WP_003129220.1|713584_717238_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	57.3	0.0e+00
WP_023094500.1|717506_718211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003129221.1|718223_719324_+	hypothetical protein	NA	A0A1W6JTA8	Pseudomonas_phage	77.6	2.6e-116
WP_023094501.1|719323_719635_+	hypothetical protein	NA	A0A1W6JTB1	Pseudomonas_phage	84.5	4.8e-44
WP_003129222.1|719631_719859_+	hypothetical protein	NA	A0A0A0YQ17	Pseudomonas_phage	89.0	5.4e-29
WP_003129224.1|720264_720870_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.8	6.0e-75
WP_003085203.1|720871_721921_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003129225.1|721917_722754_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	3.6e-70
WP_003085214.1|722815_723460_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_003085219.1|723731_724154_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003085223.1|724473_725268_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_003085224.1|725322_725970_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_003129226.1|726069_726408_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_003129227.1|726486_727968_+	AAA family ATPase	NA	U5XJW0	Phormidium_phage	33.8	5.1e-67
WP_003129228.1|728007_728808_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023094502.1|728868_729951_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003085244.1|730072_731041_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003085245.1|731057_731480_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_003101649.1|731770_732805_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_003085249.1|732804_733524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003120826.1|733524_733947_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_003085254.1|734024_734375_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	3.0e-26
WP_033938495.1|734428_735520_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_073665956.1|735522_736866_-	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	44.1	3.0e-18
WP_003129242.1|737150_738350_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP041945	Pseudomonas aeruginosa strain ST773 chromosome, complete genome	6835731	1458540	1467569	6835731		Bacillus_phage(33.33%)	8	NA	NA
WP_003098558.1|1458540_1459176_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_023436003.1|1459221_1460115_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1460219_1461224_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|1461650_1461974_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003113873.1|1462040_1464608_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_003098486.1|1464733_1465741_-	TolB family protein	NA	NA	NA	NA	NA
WP_003129950.1|1465888_1466395_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	1.8e-56
WP_003092260.1|1466528_1467569_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 4
NZ_CP041945	Pseudomonas aeruginosa strain ST773 chromosome, complete genome	6835731	2339746	2386941	6835731	protease,transposase,integrase	uncultured_Caudovirales_phage(54.55%)	50	2384529:2384544	2389938:2389953
WP_003090915.1|2339746_2340622_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_003115276.1|2340755_2341208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003090913.1|2341258_2342470_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003090911.1|2342654_2343053_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_003090910.1|2343164_2343650_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	40.0	8.1e-22
WP_003090908.1|2343646_2344138_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003130830.1|2344156_2346517_-	response regulator	NA	A0A1V0SGX0	Hokovirus	28.3	1.3e-45
WP_003090906.1|2346599_2347490_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_003090905.1|2347486_2347969_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_033937968.1|2347978_2348338_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003090903.1|2348399_2349173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124121010.1|2350533_2351142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031640271.1|2352375_2353827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071543423.1|2354254_2354689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023123144.1|2354705_2354963_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015502723.1|2355160_2356117_-|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	25.5	7.4e-11
WP_022580566.1|2356465_2358409_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U1UNT3	Pseudomonas_phage	50.0	1.7e-99
WP_024008255.1|2358459_2359101_-	LysR family substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_023912020.1|2359205_2359496_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_022580563.1|2359516_2360407_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022580562.1|2360695_2361562_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	44.3	7.3e-58
WP_022580561.1|2361576_2363055_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	77.0	1.6e-206
WP_022580560.1|2363368_2364700_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	41.2	2.5e-65
WP_022580559.1|2365396_2365783_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_023912021.1|2365782_2366511_+	cytochrome c biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_022580369.1|2366671_2367322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022580370.1|2367434_2367890_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_022580371.1|2368553_2369009_-	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_022580372.1|2369022_2369532_-	DoxX family protein	NA	NA	NA	NA	NA
WP_023912023.1|2369524_2370313_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_022580375.1|2370296_2371190_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_024008258.1|2371259_2371595_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_022580377.1|2371951_2372509_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_022580379.1|2372814_2373282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024008259.1|2373971_2374208_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_071557724.1|2374267_2374657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024007913.1|2374615_2375587_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	57.1	3.9e-92
WP_023912026.1|2375722_2376583_-	permease	NA	NA	NA	NA	NA
WP_023912027.1|2376666_2377248_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_031275831.1|2377358_2378081_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.1	3.0e-89
WP_022580387.1|2378073_2378496_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	4.5e-53
WP_023912029.1|2378510_2379623_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_023912030.1|2379619_2381386_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_050597112.1|2381399_2381717_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_022580390.1|2381830_2382928_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_125093648.1|2382959_2383058_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_022580391.1|2383085_2383580_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	44.2	2.9e-27
WP_031275834.1|2383584_2383926_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023912032.1|2384139_2385999_-	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
2384529:2384544	attL	CGCCGGATGGCTGCGC	NA	NA	NA	NA
WP_022581026.1|2386314_2386941_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_022581026.1|2386314_2386941_+|integrase	integrase	integrase	NA	NA	NA	NA
2389938:2389953	attR	GCGCAGCCATCCGGCG	NA	NA	NA	NA
>prophage 5
NZ_CP041945	Pseudomonas aeruginosa strain ST773 chromosome, complete genome	6835731	2735059	2741953	6835731	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_003097631.1|2735059_2736340_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_003108773.1|2736341_2737739_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003138951.1|2737743_2738718_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003090395.1|2738805_2739789_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	73.7	2.1e-141
WP_003090393.1|2739785_2740121_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
WP_003090391.1|2740117_2740423_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2740422_2740782_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090387.1|2740778_2741174_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090386.1|2741284_2741953_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
>prophage 6
NZ_CP041945	Pseudomonas aeruginosa strain ST773 chromosome, complete genome	6835731	3559647	3610226	6835731	integrase,head,terminase	Pseudomonas_phage(80.95%)	69	3575684:3575699	3609664:3609679
WP_088169674.1|3559647_3559911_-	hypothetical protein	NA	J7I447	Pseudomonas_phage	96.6	9.0e-44
WP_024008344.1|3559946_3560207_-	hypothetical protein	NA	A0A0U4B0B7	Pseudomonas_phage	90.7	2.6e-35
WP_024008345.1|3560203_3560572_-	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	82.0	1.8e-45
WP_031685813.1|3560568_3561198_-	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	95.7	3.5e-110
WP_123186597.1|3561263_3563321_-	structural protein	NA	J7HXC9	Pseudomonas_phage	96.4	0.0e+00
WP_123186598.1|3563381_3566105_-	hypothetical protein	NA	A0A127KNI3	Pseudomonas_phage	84.5	0.0e+00
WP_033979161.1|3566076_3566484_-	hypothetical protein	NA	J7HX80	Pseudomonas_phage	99.3	1.5e-74
WP_023098722.1|3566488_3566980_-	DUF1833 family protein	NA	J7I404	Pseudomonas_phage	96.9	1.6e-89
WP_034005429.1|3566963_3567431_-	hypothetical protein	NA	H2BD92	Pseudomonas_phage	98.7	4.2e-92
WP_126107569.1|3567427_3569920_-	tape measure protein	NA	J7HXG0	Pseudomonas_phage	88.9	0.0e+00
WP_123186600.1|3569919_3570537_-	glycoprotein	NA	A0A125RNN1	Pseudomonas_phage	99.0	5.7e-113
WP_023114281.1|3570533_3571529_-	hypothetical protein	NA	J7HX84	Pseudomonas_phage	98.2	3.2e-166
WP_003127992.1|3571543_3571918_-	hypothetical protein	NA	J7I407	Pseudomonas_phage	100.0	5.7e-68
WP_034005432.1|3571914_3572319_-	hypothetical protein	NA	H2BD87	Pseudomonas_phage	98.5	1.1e-67
WP_162011010.1|3572376_3572862_+	HNH endonuclease	NA	J7HXG5	Pseudomonas_phage	99.4	6.5e-88
WP_034041609.1|3572858_3573179_-	hypothetical protein	NA	J7I4I8	Pseudomonas_phage	93.4	1.4e-54
WP_071537270.1|3573178_3573802_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_123186602.1|3573805_3574207_-	hypothetical protein	NA	J7HX89	Pseudomonas_phage	96.9	1.2e-68
WP_123186603.1|3574280_3574745_-	hypothetical protein	NA	A0A125RNM4	Pseudomonas_phage	78.9	2.0e-54
WP_123186604.1|3574755_3575850_-	hypothetical protein	NA	J7I0Q9	Pseudomonas_phage	99.2	2.2e-208
3575684:3575699	attL	AGGCCGGCGAGCGCGT	NA	NA	NA	NA
WP_043088310.1|3575865_3576315_-	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	99.3	1.3e-77
WP_033986534.1|3576318_3577596_-	hypothetical protein	NA	H2BD80	Pseudomonas_phage	99.1	1.4e-214
WP_058145430.1|3577599_3578529_-|head	phage head morphogenesis protein	head	H2BD79	Pseudomonas_phage	98.4	2.9e-169
WP_123186605.1|3578485_3579856_-	DUF1073 domain-containing protein	NA	H2BD78	Pseudomonas_phage	98.0	1.6e-264
WP_014603761.1|3579858_3580056_-	hypothetical protein	NA	H2BD77	Pseudomonas_phage	100.0	2.3e-28
WP_088171401.1|3580055_3581519_-	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	83.5	9.0e-242
WP_044719990.1|3581508_3582093_-|terminase	terminase small subunit	terminase	A0A2P9HY59	Yersinia_phage	67.0	1.8e-60
WP_014603758.1|3582083_3582356_-	hypothetical protein	NA	A0A125RNL4	Pseudomonas_phage	97.8	3.1e-39
WP_123186606.1|3582358_3582691_-	peptidase M48, Ste24p	NA	A0A125RNL3	Pseudomonas_phage	99.1	1.0e-55
WP_123186607.1|3583082_3583769_-	hypothetical protein	NA	A0A0S2SYA9	Pseudomonas_phage	92.5	6.7e-123
WP_033993421.1|3583839_3584157_-	hypothetical protein	NA	Q9MC45	Pseudomonas_phage	93.3	6.8e-46
WP_123186608.1|3584153_3584801_-	hypothetical protein	NA	A0A0S2SY91	Pseudomonas_phage	96.7	4.1e-114
WP_123186609.1|3584797_3585031_-	hypothetical protein	NA	A0A0S2SYK5	Pseudomonas_phage	96.1	3.7e-33
WP_153562489.1|3585027_3585186_-	hypothetical protein	NA	A0A0S2SYG6	Pseudomonas_phage	63.5	1.6e-11
WP_033991098.1|3585182_3585443_-	hypothetical protein	NA	A0A125RNK6	Pseudomonas_phage	95.2	1.6e-40
WP_023465449.1|3585439_3585856_-	hypothetical protein	NA	B5WZY4	Pseudomonas_phage	99.3	2.2e-76
WP_123186610.1|3585848_3586064_-	hypothetical protein	NA	W6MW49	Pseudomonas_phage	91.5	5.9e-33
WP_123186611.1|3586626_3587442_-	ATP-binding protein	NA	A0A059VK34	Pseudomonas_phage	53.8	2.4e-74
WP_034026878.1|3587431_3588238_-	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	91.0	1.8e-143
WP_034026816.1|3588237_3588990_-	antirepressor	NA	A0A059VF66	Pseudomonas_phage	56.0	2.0e-67
WP_023099006.1|3589065_3589377_-	hypothetical protein	NA	H6WRX6	Salmonella_phage	50.6	1.8e-14
WP_033949562.1|3589666_3590332_+	helix-turn-helix domain-containing protein	NA	H2BDH4	Pseudomonas_virus	39.7	3.0e-43
WP_049821776.1|3590379_3590868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033991093.1|3590962_3591436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123186612.1|3591513_3592428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033991091.1|3592831_3593374_+	hypothetical protein	NA	A0A0S2SYL8	Pseudomonas_phage	97.8	6.6e-89
WP_033991089.1|3593382_3593823_+	mRNA interferase YafO	NA	A0A0S2SYH1	Pseudomonas_phage	97.9	7.7e-80
WP_003101101.1|3594200_3594590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153574973.1|3595170_3595335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123186614.1|3595578_3596067_+	DUF1566 domain-containing protein	NA	H2BDH2	Pseudomonas_virus	88.3	3.7e-75
WP_123186624.1|3596262_3596775_+	DUF1566 domain-containing protein	NA	A0A0A0YR68	Pseudomonas_phage	46.7	3.8e-30
WP_033867558.1|3596921_3597209_+	hypothetical protein	NA	A0A2H4JGG9	uncultured_Caudovirales_phage	58.2	7.1e-18
WP_088376692.1|3597244_3597622_+	hypothetical protein	NA	W6MWX7	Pseudomonas_phage	93.6	1.9e-63
WP_123186615.1|3597887_3598328_+	hypothetical protein	NA	W6MVG2	Pseudomonas_phage	89.7	4.7e-77
WP_043087894.1|3598336_3598702_+	hypothetical protein	NA	A0A125RNR9	Pseudomonas_phage	98.3	2.4e-66
WP_123186616.1|3599249_3599636_+	hypothetical protein	NA	A0A125RNR7	Pseudomonas_phage	72.5	2.3e-43
WP_161565214.1|3599742_3599913_+	DUF1382 family protein	NA	W6MW43	Pseudomonas_phage	96.4	5.3e-21
WP_123186617.1|3599909_3600485_+	hypothetical protein	NA	H2BDG4	Pseudomonas_virus	45.7	8.3e-42
WP_123186618.1|3600775_3601051_+	hypothetical protein	NA	U6C867	Ralstonia_phage	46.6	3.3e-12
WP_123186619.1|3601108_3601858_+	single-stranded DNA-binding protein	NA	A0A125RNR3	Pseudomonas_phage	50.8	8.9e-52
WP_023108955.1|3601854_3602499_+	hypothetical protein	NA	F8TUK8	EBPR_podovirus	36.0	1.4e-24
WP_023085146.1|3602495_3602858_+	hypothetical protein	NA	A0A125RNR1	Pseudomonas_phage	90.8	4.9e-48
WP_003140732.1|3603068_3603275_+	hypothetical protein	NA	H2BDF2	Pseudomonas_virus	84.1	1.3e-26
WP_123186620.1|3605173_3605719_+	hypothetical protein	NA	A0A0S2SYB5	Pseudomonas_phage	76.9	4.8e-31
WP_043087887.1|3605938_3606253_+	hypothetical protein	NA	A0A0A1IVN6	Pseudomonas_phage	66.0	1.5e-24
WP_123186621.1|3606245_3606632_+	ead/Ea22-like family protein	NA	W6MVL6	Pseudomonas_phage	55.3	3.4e-15
WP_033980927.1|3606628_3606952_+	hypothetical protein	NA	A0A125RNP7	Pseudomonas_phage	87.9	4.4e-48
WP_123186622.1|3607388_3608606_+|integrase	site-specific integrase	integrase	A0A125RNP5	Pseudomonas_phage	98.8	1.5e-229
WP_003111315.1|3608636_3610226_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.3	5.9e-61
3609664:3609679	attR	AGGCCGGCGAGCGCGT	NA	NA	NA	NA
>prophage 7
NZ_CP041945	Pseudomonas aeruginosa strain ST773 chromosome, complete genome	6835731	3678870	3714709	6835731	transposase,head,terminase,capsid,protease,integrase	Pseudomonas_phage(68.0%)	50	3671229:3671245	3716075:3716091
3671229:3671245	attL	GCATGCTGCAGGCCACC	NA	NA	NA	NA
WP_033972357.1|3678870_3679500_-	helix-turn-helix transcriptional regulator	NA	A0SML1	Pseudomonas_virus	98.1	3.2e-111
WP_003094467.1|3679764_3680121_+	nucleotide excision repair protein	NA	A0A0U5KN61	unidentified_phage	100.0	4.5e-62
WP_023105791.1|3680123_3680558_+	hypothetical protein	NA	A0A0U5KMV2	unidentified_phage	100.0	1.3e-76
WP_034004371.1|3680557_3680755_+	hypothetical protein	NA	A0A076FRH8	Pseudomonas_phage	93.8	7.5e-27
WP_153986191.1|3680747_3682820_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A125RN39	Pseudomonas_phage	99.3	0.0e+00
WP_079452759.1|3682816_3683587_+	ATP-binding protein	NA	A0A125RN40	Pseudomonas_phage	99.6	1.4e-137
WP_143479769.1|3683583_3684249_+	hypothetical protein	NA	I6P8D6	Pseudomonas_phage	99.5	2.0e-124
WP_153986192.1|3684320_3684962_+	hypothetical protein	NA	A0SML7	Pseudomonas_virus	86.4	7.8e-97
WP_012613773.1|3685062_3685476_+	hypothetical protein	NA	A0A0U5KQ28	unidentified_phage	100.0	7.3e-72
WP_143479768.1|3685438_3685750_+	hypothetical protein	NA	H6V800	Pseudomonas_virus	99.0	3.4e-50
WP_003094486.1|3685766_3686285_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	100.0	1.1e-90
WP_012613775.1|3686286_3686664_+	hypothetical protein	NA	A0A0U5G7F5	unidentified_phage	95.2	3.1e-61
WP_033997611.1|3686665_3686947_+	hypothetical protein	NA	A0A125RNF9	Pseudomonas_phage	98.9	7.9e-46
WP_003094506.1|3686948_3687155_+	hypothetical protein	NA	A0A0A1IWY9	Pseudomonas_phage	100.0	2.2e-29
WP_034030248.1|3687157_3687427_+	hypothetical protein	NA	A0A076FSV2	Pseudomonas_phage	97.8	4.2e-44
WP_003099427.1|3687497_3687794_+	hypothetical protein	NA	L7P7Y1	Pseudomonas_phage	100.0	1.2e-44
WP_033973178.1|3687790_3688192_+	regulatory protein GemA	NA	A0A0A1IUY7	Pseudomonas_phage	100.0	1.5e-69
WP_031806171.1|3688184_3688634_+	membrane protein	NA	A0A076FR28	Pseudomonas_phage	100.0	4.6e-80
WP_016068581.1|3688736_3689084_+	hypothetical protein	NA	A0A0A1IVZ8	Pseudomonas_phage	100.0	1.1e-57
WP_003137288.1|3689076_3689499_+	hypothetical protein	NA	A0A0A1IVG1	Pseudomonas_phage	100.0	1.5e-72
WP_153986193.1|3689498_3689915_+	structural protein	NA	I6P8D9	Pseudomonas_phage	99.3	6.0e-74
WP_012613781.1|3689914_3690157_+	hypothetical protein	NA	A0A0U5KPK1	unidentified_phage	100.0	1.5e-37
WP_121379790.1|3690153_3690555_+	hypothetical protein	NA	X4Y6P1	Pseudomonas_phage	100.0	2.0e-66
WP_003094538.1|3690665_3690854_+	hypothetical protein	NA	A0A0A1IVG3	Pseudomonas_phage	100.0	1.0e-25
WP_012613783.1|3690862_3691363_+	DUF1804 family protein	NA	A0A1C6ZDN3	Pseudomonas_phage	100.0	2.9e-83
WP_023465135.1|3691364_3691901_-	hypothetical protein	NA	Q6TM77	Pseudomonas_phage	93.8	1.3e-92
WP_143479748.1|3691899_3693552_+|terminase	phage terminase large subunit	terminase	B7SDZ1	Pseudomonas_virus	99.8	0.0e+00
WP_143479749.1|3693561_3695142_+	DUF935 family protein	NA	A0A0A1IVG5	Pseudomonas_phage	99.8	3.8e-302
WP_003099448.1|3695141_3696428_+|capsid	minor capsid protein	capsid	B7SDZ3	Pseudomonas_virus	99.5	5.9e-245
WP_044719582.1|3696427_3696895_+	phage virion morphogenesis protein	NA	B7SDZ4	Pseudomonas_virus	97.4	1.1e-79
WP_031630145.1|3697097_3698195_+|protease	protease	protease	A0A125RNI0	Pseudomonas_phage	99.7	6.4e-200
WP_003099452.1|3698198_3699113_+|head	head protein	head	I6PBD3	Pseudomonas_phage	100.0	9.2e-176
WP_031670573.1|3699179_3699620_+	hypothetical protein	NA	A0A125RNI2	Pseudomonas_phage	99.3	9.5e-46
WP_003094564.1|3699783_3700200_+	DUF1320 domain-containing protein	NA	L7P7K2	Pseudomonas_phage	100.0	3.9e-73
WP_003137263.1|3700196_3700670_+	hypothetical protein	NA	I6PBW6	Pseudomonas_phage	100.0	5.0e-85
WP_003099460.1|3700657_3700837_+	hypothetical protein	NA	A0A0U5G7J8	unidentified_phage	100.0	2.9e-25
WP_015972877.1|3700869_3701640_+	hypothetical protein	NA	Q6TM61	Pseudomonas_phage	100.0	1.2e-141
WP_031670574.1|3701643_3702138_+	hypothetical protein	NA	I6PCB2	Pseudomonas_phage	99.4	3.0e-88
WP_143479741.1|3702288_3705993_+	tape measure protein	NA	B7SE05	Pseudomonas_virus	99.1	0.0e+00
WP_061363237.1|3705999_3706956_+	hypothetical protein	NA	A0SMQ2	Pseudomonas_virus	95.9	1.6e-183
WP_061363238.1|3706957_3707881_+	hypothetical protein	NA	B7SE07	Pseudomonas_virus	90.6	1.2e-170
WP_061363239.1|3707880_3709584_+	hypothetical protein	NA	L7P802	Pseudomonas_phage	95.6	0.0e+00
WP_061363240.1|3709573_3710395_+	DUF2163 domain-containing protein	NA	I6PBD5	Pseudomonas_phage	98.4	5.2e-154
WP_003126844.1|3710403_3710643_+	hypothetical protein	NA	I6P9F0	Pseudomonas_phage	98.7	4.4e-37
WP_004367213.1|3710639_3710858_+	hypothetical protein	NA	I6P9E8	Pseudomonas_phage	100.0	3.4e-36
WP_061363242.1|3710847_3713055_+	hypothetical protein	NA	I6PCB1	Pseudomonas_phage	97.1	0.0e+00
WP_143479740.1|3713051_3713897_+	hypothetical protein	NA	A0SMQ9	Pseudomonas_virus	95.4	3.5e-153
WP_143479739.1|3713896_3714199_+	hypothetical protein	NA	I6PBW9	Pseudomonas_phage	99.0	6.7e-51
WP_143479738.1|3714195_3714411_+	hypothetical protein	NA	I6PBD6	Pseudomonas_phage	95.8	1.6e-30
WP_003121473.1|3714484_3714709_+	hypothetical protein	NA	A0A125RNE4	Pseudomonas_phage	100.0	5.5e-34
3716075:3716091	attR	GCATGCTGCAGGCCACC	NA	NA	NA	NA
>prophage 8
NZ_CP041945	Pseudomonas aeruginosa strain ST773 chromosome, complete genome	6835731	3744587	3786468	6835731	transposase,integrase,head	Pseudomonas_phage(95.83%)	52	3763861:3763879	3790525:3790543
WP_033989048.1|3744587_3746759_-	type I secretion system permease/ATPase	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.6	9.3e-17
WP_033938087.1|3746748_3747798_-	TolC family protein	NA	NA	NA	NA	NA
WP_010791890.1|3747856_3748081_-	hypothetical protein	NA	A0A0A1IX79	Pseudomonas_phage	100.0	2.5e-34
WP_033938088.1|3748159_3748960_-	hypothetical protein	NA	Q5ZQV8	Pseudomonas_phage	95.9	2.3e-146
WP_033938089.1|3748956_3751167_-	bacteriophage protein	NA	Q5ZQV9	Pseudomonas_phage	97.4	0.0e+00
WP_023102449.1|3751153_3751384_-	hypothetical protein	NA	J9RWP7	Pseudomonas_phage	96.1	7.2e-37
WP_003094285.1|3751380_3751611_-	hypothetical protein	NA	Q5ZQW1	Pseudomonas_phage	100.0	1.2e-36
WP_003156591.1|3751620_3752439_-	DUF2163 domain-containing protein	NA	Q5ZQW2	Pseudomonas_phage	100.0	2.0e-166
WP_033938091.1|3752425_3754132_-	hypothetical protein	NA	Q5ZQW3	Pseudomonas_phage	99.8	0.0e+00
WP_033938092.1|3754134_3755058_-	hypothetical protein	NA	J9SWM3	Pseudomonas_phage	95.8	3.6e-180
WP_033938093.1|3755060_3756020_-	hypothetical protein	NA	J9RWP3	Pseudomonas_phage	97.5	1.1e-187
WP_033938094.1|3756019_3759652_-	tape measure protein	NA	J9SH65	Pseudomonas_phage	95.4	0.0e+00
WP_049967619.1|3759768_3759951_+	hypothetical protein	NA	J9SNJ6	Pseudomonas_phage	100.0	1.2e-26
WP_023086241.1|3759905_3760388_-	hypothetical protein	NA	J9STT8	Pseudomonas_phage	100.0	1.3e-83
WP_010791812.1|3760390_3761131_-	hypothetical protein	NA	J9SVZ4	Pseudomonas_phage	100.0	1.2e-136
WP_003127509.1|3761137_3761341_-	hypothetical protein	NA	J9RWG5	Pseudomonas_phage	100.0	1.7e-29
WP_003127511.1|3761337_3761790_-	hypothetical protein	NA	J9SH57	Pseudomonas_phage	100.0	5.5e-81
WP_003121492.1|3761786_3762302_-	DUF1320 domain-containing protein	NA	J9SNI4	Pseudomonas_phage	100.0	3.5e-92
WP_003121493.1|3762304_3762520_-	hypothetical protein	NA	J9STT1	Pseudomonas_phage	100.0	1.5e-33
WP_003127513.1|3762751_3763648_-|head	head protein	head	J9SVY7	Pseudomonas_phage	100.0	1.3e-171
WP_003121593.1|3763662_3764067_-	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	100.0	1.8e-67
3763861:3763879	attL	GGCGCCGGCGGCGCCACCG	NA	NA	NA	NA
WP_033938096.1|3764072_3765182_-	bacteriophage protein	NA	J9SH47	Pseudomonas_phage	99.2	2.9e-200
WP_023081739.1|3765392_3765968_-	phage virion morphogenesis protein	NA	J9SNH3	Pseudomonas_phage	100.0	1.2e-104
WP_023081740.1|3765969_3767208_-	hypothetical protein	NA	J9STS2	Pseudomonas_phage	100.0	3.1e-243
WP_078458630.1|3767197_3768763_-	DUF935 domain-containing protein	NA	J9SVY0	Pseudomonas_phage	96.0	4.9e-286
WP_014603997.1|3768765_3770439_-	hypothetical protein	NA	J9RWF2	Pseudomonas_phage	99.3	0.0e+00
WP_003117313.1|3770440_3770989_-	DUF3486 family protein	NA	J9SH37	Pseudomonas_phage	99.5	7.6e-77
WP_003117314.1|3770991_3771294_-	hypothetical protein	NA	J9SNG3	Pseudomonas_phage	100.0	1.1e-48
WP_003117315.1|3771290_3771611_-	DUF2730 family protein	NA	J9STR5	Pseudomonas_phage	100.0	5.1e-49
WP_033938099.1|3771610_3772234_-	hypothetical protein	NA	J9SVX5	Pseudomonas_phage	97.6	8.6e-109
WP_033938100.1|3772435_3773065_-	transglycosylase SLT domain-containing protein	NA	J9SH25	Pseudomonas_phage	98.6	2.1e-118
WP_003138152.1|3773222_3773480_-	membrane protein	NA	J9STQ9	Pseudomonas_phage	100.0	5.6e-38
WP_124123336.1|3774185_3775259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033938102.1|3775215_3775716_-	hypothetical protein	NA	J9RWD8	Pseudomonas_phage	91.0	2.4e-77
WP_033938103.1|3775732_3776092_-	helix-turn-helix domain-containing protein	NA	E5E3P4	Burkholderia_phage	49.5	7.6e-17
WP_033938104.1|3776204_3776435_+	DNA-binding protein	NA	J9RWM8	Pseudomonas_phage	92.1	1.3e-33
WP_015649410.1|3776719_3776944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033938111.1|3777067_3777556_+	hypothetical protein	NA	Q5ZR01	Pseudomonas_phage	98.1	9.1e-90
WP_033938112.1|3777772_3778081_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	96.1	1.7e-46
WP_033938114.1|3778091_3779018_+	DUF3102 domain-containing protein	NA	Q5ZR03	Pseudomonas_phage	91.2	1.1e-149
WP_043502560.1|3779020_3780802_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q5ZR04	Pseudomonas_phage	99.8	0.0e+00
WP_015649406.1|3780801_3781974_+	AAA family ATPase	NA	Q5ZR05	Pseudomonas_phage	85.4	1.5e-183
WP_033938125.1|3781975_3782317_+	hypothetical protein	NA	J9RWC3	Pseudomonas_phage	97.3	1.1e-54
WP_033938127.1|3782313_3782598_+	hypothetical protein	NA	J9SGZ7	Pseudomonas_phage	86.2	4.7e-38
WP_033938129.1|3782597_3782852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015649401.1|3782998_3783622_+	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	99.5	1.0e-109
WP_003094188.1|3783623_3784313_+	DUF2786 domain-containing protein	NA	Q5ZR11	Pseudomonas_phage	100.0	1.3e-126
WP_003148480.1|3784314_3784533_+	hypothetical protein	NA	J9STW0	Pseudomonas_phage	97.2	2.8e-30
WP_023089284.1|3784534_3785002_+	hypothetical protein	NA	J9STM8	Pseudomonas_phage	81.9	1.4e-58
WP_015649391.1|3784988_3785555_+	regulatory protein GemA	NA	J9SVT5	Pseudomonas_phage	99.5	2.1e-101
WP_003117363.1|3785554_3786103_+	hypothetical protein	NA	J9RWB3	Pseudomonas_phage	100.0	2.1e-98
WP_003127781.1|3786099_3786468_+	hypothetical protein	NA	J9SGX4	Pseudomonas_phage	100.0	1.1e-63
3790525:3790543	attR	GGCGCCGGCGGCGCCACCG	NA	NA	NA	NA
>prophage 9
NZ_CP041945	Pseudomonas aeruginosa strain ST773 chromosome, complete genome	6835731	5111945	5134290	6835731	head,terminase,portal,capsid,protease,integrase	uncultured_Caudovirales_phage(35.71%)	29	5116388:5116403	5138165:5138180
WP_031672566.1|5111945_5112944_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	64.7	1.4e-121
WP_031671095.1|5113010_5113646_-|head	head decoration protein	head	NA	NA	NA	NA
WP_023118635.1|5113642_5114815_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	49.6	1.3e-86
WP_033989131.1|5114798_5116265_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	66.0	8.6e-176
WP_004353026.1|5116264_5116489_-	hypothetical protein	NA	NA	NA	NA	NA
5116388:5116403	attL	GCGGTCGACCTGGCGG	NA	NA	NA	NA
WP_023103642.1|5116500_5118516_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4J898	uncultured_Caudovirales_phage	64.0	5.0e-259
WP_033989129.1|5118519_5119110_-	hypothetical protein	NA	A0A2H4JG15	uncultured_Caudovirales_phage	53.4	1.3e-45
WP_023125693.1|5119366_5120104_-	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	47.1	1.1e-43
WP_019726481.1|5120100_5120451_-	hypothetical protein	NA	B5TK61	Pseudomonas_phage	48.6	2.8e-16
WP_033989126.1|5121022_5121394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033989124.1|5121390_5123604_-	toprim domain-containing protein	NA	A0A2D1GN57	Marinobacter_phage	47.0	1.0e-188
WP_079385892.1|5123600_5123810_-	conjugal transfer protein TraR	NA	A0A0M3LQ09	Mannheimia_phage	49.3	4.9e-08
WP_033989122.1|5123802_5124357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071537749.1|5124658_5124895_-	helix-turn-helix domain-containing protein	NA	J7I423	Pseudomonas_phage	65.1	6.7e-14
WP_079385891.1|5124977_5125718_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	56.2	2.6e-72
WP_033989120.1|5125990_5126302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023115509.1|5126311_5126605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033989119.1|5126755_5126989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033989118.1|5126985_5127786_+	hypothetical protein	NA	A0A0E3M3Z6	Verrucomicrobia_phage	46.2	2.0e-46
WP_019726489.1|5127782_5128100_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_033989116.1|5128150_5128777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033989114.1|5128773_5129013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_119522043.1|5129022_5129502_+	glycoside hydrolase	NA	NA	NA	NA	NA
WP_096867971.1|5129498_5131379_+	cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	43.0	4.4e-132
WP_033989510.1|5131375_5131759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033989511.1|5131755_5132160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033989513.1|5132149_5132356_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_124123600.1|5132352_5132973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079385903.1|5132988_5134290_-|integrase	integrase family protein	integrase	A0A248SL35	Klebsiella_phage	32.4	3.7e-37
5138165:5138180	attR	CCGCCAGGTCGACCGC	NA	NA	NA	NA
>prophage 10
NZ_CP041945	Pseudomonas aeruginosa strain ST773 chromosome, complete genome	6835731	5636144	5671228	6835731	tRNA,coat,integrase,capsid	Pseudomonas_phage(64.29%)	37	5641437:5641457	5666452:5666472
WP_023100253.1|5636144_5636693_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003135089.1|5636723_5637257_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_023098841.1|5637256_5637799_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003094976.1|5637817_5638606_+	molecular chaperone	NA	NA	NA	NA	NA
WP_033938426.1|5638622_5640998_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_031638443.1|5640994_5641942_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
5641437:5641457	attL	TGACCCTGCCGGCCGGCACCT	NA	NA	NA	NA
WP_003099328.1|5641943_5643317_-	MFS transporter	NA	NA	NA	NA	NA
WP_003094982.1|5643596_5644619_-	ferrochelatase	NA	NA	NA	NA	NA
WP_003094984.1|5644615_5645533_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_003094987.1|5645928_5646912_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023876000.1|5647064_5648021_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_003141623.1|5648030_5648930_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	39.1	8.5e-17
WP_004355239.1|5648926_5650372_+	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	28.0	1.4e-45
WP_003094992.1|5650497_5651019_-	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	70.4	1.0e-59
WP_003099300.1|5651152_5651950_-	glutamate racemase	NA	NA	NA	NA	NA
WP_033938464.1|5651939_5652698_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_015503679.1|5652691_5653522_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003099290.1|5653523_5654606_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	48.3	5.6e-07
WP_003095001.1|5654623_5655892_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003135130.1|5656035_5657808_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003095005.1|5657812_5658430_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_009878189.1|5658431_5659280_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003099281.1|5659446_5660388_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	4.1e-46
WP_003095013.1|5660504_5661119_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_003099278.1|5661160_5661745_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_003099270.1|5661785_5662886_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_124123515.1|5663280_5663691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033938422.1|5663671_5664673_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	46.8	1.0e-74
WP_004352686.1|5664669_5665962_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	92.3	1.8e-241
WP_003140504.1|5666192_5667476_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	99.8	1.1e-235
5666452:5666472	attR	AGGTGCCGGCCGGCAGGGTCA	NA	NA	NA	NA
WP_003114150.1|5667479_5667836_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
WP_052155827.1|5667840_5669178_-	hypothetical protein	NA	Q56VP1	Pseudomonas_phage	98.0	2.4e-156
WP_003140506.1|5669331_5669580_-|capsid	phage capsid protein	capsid	Q56VP2	Pseudomonas_phage	100.0	2.1e-34
WP_003115979.1|5669592_5669844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115130.1|5669856_5669949_-	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_031635504.1|5669965_5670400_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	97.9	7.9e-61
WP_033938419.1|5670937_5671228_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	96.9	9.6e-55
>prophage 11
NZ_CP041945	Pseudomonas aeruginosa strain ST773 chromosome, complete genome	6835731	6456180	6496848	6835731	tail,head,terminase,portal,capsid,protease,lysis,integrase,holin	Pseudomonas_phage(62.79%)	57	6455604:6455623	6496475:6496494
6455604:6455623	attL	AGCCCGGAGCCGCTCTGACT	NA	NA	NA	NA
WP_050159556.1|6456180_6456921_-	hypothetical protein	NA	A0A2H4J1J6	uncultured_Caudovirales_phage	58.1	1.5e-56
WP_050159523.1|6458264_6461828_-|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	75.7	0.0e+00
WP_153575558.1|6462153_6462303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034014143.1|6462340_6462943_-|tail	tail assembly protein	tail	A0A2H4J1H0	uncultured_Caudovirales_phage	61.1	4.6e-59
WP_034014145.1|6462939_6463695_-	C40 family peptidase	NA	A0A0S2SY75	Pseudomonas_phage	92.3	1.1e-139
WP_034014146.1|6463697_6464441_-|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	73.9	5.4e-110
WP_031691339.1|6464437_6464776_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	51.8	8.4e-26
WP_050159525.1|6464775_6468042_-|tail	phage tail tape measure protein	tail	A0A0A1IX77	Pseudomonas_phage	52.7	1.6e-65
WP_050159527.1|6468083_6468356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050159532.1|6468622_6468967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034014150.1|6469037_6469544_-	hypothetical protein	NA	A0A2D1GNF2	Pseudomonas_phage	74.1	8.6e-59
WP_015649327.1|6469575_6469962_-	DUF3168 domain-containing protein	NA	A0A2D1GNT4	Pseudomonas_phage	64.6	5.8e-39
WP_031276786.1|6469954_6470527_-	hypothetical protein	NA	A0A2D1GNN2	Pseudomonas_phage	49.5	5.9e-40
WP_003085763.1|6470530_6470725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022580265.1|6470730_6471057_-|head,tail	head-tail adaptor protein	head,tail	A0A2D1GNG1	Pseudomonas_phage	57.3	2.8e-18
WP_003085762.1|6471056_6471380_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	65.6	9.1e-30
WP_003085760.1|6471379_6471583_-	hypothetical protein	NA	A0A2H4JG33	uncultured_Caudovirales_phage	50.0	1.8e-07
WP_003085757.1|6471634_6472849_-|capsid	phage major capsid protein	capsid	A0A2H4J8D1	uncultured_Caudovirales_phage	67.3	4.1e-155
WP_003085756.1|6472845_6473490_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JA51	uncultured_Caudovirales_phage	75.7	3.5e-89
WP_023103987.1|6473473_6474691_-|portal	phage portal protein	portal	A0A2H4JFN7	uncultured_Caudovirales_phage	73.2	1.5e-170
WP_022580266.1|6474693_6476373_-|terminase	terminase large subunit	terminase	A0A2H4JDK9	uncultured_Caudovirales_phage	65.8	2.8e-194
WP_003085748.1|6476376_6476868_-	hypothetical protein	NA	S4TNN3	Salmonella_phage	37.0	3.2e-10
WP_023103989.1|6477282_6477612_-	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	53.7	5.1e-28
WP_003085741.1|6477611_6478085_-|lysis	lysis protein Rz	lysis	A0A1B0Z001	Pseudomonas_phage	89.1	3.3e-68
WP_003085739.1|6478091_6478322_-	hypothetical protein	NA	A0A2C9CY14	Yersinia_phage	60.6	4.1e-16
WP_003085737.1|6478335_6478947_-	glycoside hydrolase family 19 protein	NA	A0A1B0Z086	Pseudomonas_phage	91.1	4.0e-103
WP_004353177.1|6478943_6479276_-|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	96.4	1.9e-54
WP_003085732.1|6479361_6479892_-	hypothetical protein	NA	A0A2D1GLJ3	Escherichia_phage	37.3	1.2e-26
WP_003085729.1|6480420_6480978_-	hypothetical protein	NA	A0A0A0YRV6	Pseudomonas_phage	97.1	1.2e-74
WP_003085726.1|6480974_6481259_-	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	96.6	4.5e-41
WP_003085724.1|6481255_6482653_-	AAA family ATPase	NA	A0A1W6JTB3	Pseudomonas_phage	99.8	1.5e-265
WP_003085722.1|6482649_6483270_-	ATP-binding protein	NA	A0A1W6JTD8	Pseudomonas_phage	99.5	2.9e-109
WP_015648201.1|6483445_6484285_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	94.3	1.1e-146
WP_015648200.1|6484281_6484512_-	hypothetical protein	NA	A0A1W6JTF8	Pseudomonas_phage	77.6	2.3e-27
WP_034056013.1|6484508_6485270_-	phage-like protein	NA	A0A1W6JTB2	Pseudomonas_phage	97.6	2.9e-135
WP_022580273.1|6485266_6485602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022580274.1|6485594_6485924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022580275.1|6485920_6486217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031294199.1|6486209_6486518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022580277.1|6486820_6487099_-	hypothetical protein	NA	A0A1W6JTC3	Pseudomonas_phage	83.7	4.5e-33
WP_019396628.1|6487095_6487446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085704.1|6487751_6488144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022580278.1|6488140_6488461_-	hypothetical protein	NA	A0A1W6JTD1	Pseudomonas_phage	52.4	7.0e-06
WP_031294207.1|6488563_6489352_+	helix-turn-helix domain-containing protein	NA	A0A2K8HKD5	Pseudomonas_phage	60.9	4.6e-83
WP_022580279.1|6489703_6490087_+	LuxR family transcriptional regulator	NA	A0A0A0YWH0	Pseudomonas_phage	99.2	1.1e-61
WP_023124256.1|6490089_6490323_+	hypothetical protein	NA	A0A0A0YQ28	Pseudomonas_phage	96.1	2.8e-36
WP_021205287.1|6490842_6491109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049250083.1|6491138_6491873_+	Rha family transcriptional regulator	NA	A0A1W6DWH5	Salmonella_phage	45.6	2.4e-17
WP_031637080.1|6491952_6492183_+	Arc family DNA-binding protein	NA	A0A1W6JTB4	Pseudomonas_phage	85.1	1.4e-27
WP_050157706.1|6492185_6493232_+	hypothetical protein	NA	A0A0A0YUE9	Pseudomonas_phage	89.4	8.1e-35
WP_050159539.1|6493350_6493542_+	hypothetical protein	NA	A0A0A0YQ21	Pseudomonas_phage	96.8	1.0e-28
WP_034014242.1|6493538_6493718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034014243.1|6493714_6493960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160317107.1|6494792_6495122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034014245.1|6495105_6495348_+	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	63.0	7.8e-18
WP_033982455.1|6495347_6496397_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	55.1	2.2e-101
WP_157832015.1|6496509_6496848_-	integration host factor	NA	B5TA87	Burkholderia_phage	51.1	5.1e-15
6496475:6496494	attR	AGCCCGGAGCCGCTCTGACT	NA	NA	NA	NA
