The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043487	Escherichia coli strain AQ15 chromosome, complete genome	4753097	197062	270411	4753097	protease,transposase,plate,tRNA	uncultured_Caudovirales_phage(20.0%)	59	NA	NA
WP_001346129.1|197062_198415_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|198444_200877_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|200998_201484_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|201487_202513_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|202617_203073_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|203076_203865_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139667.1|203864_205013_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|205009_205606_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|205642_209125_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|209137_210097_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001021030.1|210195_212337_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|212393_212783_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176578.1|212847_214146_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|214194_214455_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|214441_214642_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|214807_215353_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|215349_215772_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|215785_216496_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001297208.1|216650_217475_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|217528_219247_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|219357_220065_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|220061_220466_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|220583_221399_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|221438_222092_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|222084_223116_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140175.1|223303_223879_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997038.1|229637_230441_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.2e-38
WP_000648576.1|230437_231352_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|231592_232393_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211687.1|232470_233241_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|233288_234647_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052707.1|234718_235474_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001298887.1|235507_236230_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|236226_236694_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|236758_237490_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|238029_238815_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|238951_239431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908052.1|239440_240355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|240398_240881_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087745.1|240904_242257_-	membrane protein	NA	NA	NA	NA	NA
WP_122986077.1|242267_245702_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240545.1|245810_247223_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088862.1|247227_247971_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614350.1|247967_250775_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	27.9	1.2e-80
WP_000343298.1|250783_251545_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246449.1|251549_252881_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|252883_253408_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|253404_254685_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|254709_255792_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|255755_257606_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|257609_258023_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056978.1|258029_259505_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|259555_259780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037395.1|259814_260315_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|261012_261531_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103316.1|261740_263882_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_001350059.1|263957_268007_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.9	4.4e-20
WP_001350058.1|267966_268404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420794.1|269274_270411_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP043487	Escherichia coli strain AQ15 chromosome, complete genome	4753097	292364	332044	4753097	head,transposase,tail,plate	Escherichia_phage(60.38%)	54	NA	NA
WP_000859525.1|292364_292760_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.7	6.6e-30
WP_000514023.1|292914_293610_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	99.1	9.5e-133
WP_001300256.1|293560_293749_-	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	100.0	1.3e-31
WP_000905064.1|293843_294425_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	99.5	1.6e-104
WP_001112250.1|294454_295450_+	hypothetical protein	NA	A0A077SK37	Escherichia_phage	94.7	6.4e-183
WP_000972171.1|295452_295986_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	98.9	1.2e-95
WP_000972119.1|296014_296542_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	98.3	1.2e-92
WP_000499360.1|296544_298059_-|tail	tail protein	tail	C9DGQ8	Escherichia_phage	90.2	1.7e-259
WP_000301695.1|298058_298601_-	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	99.4	4.8e-100
WP_000331815.1|298591_299674_-|plate	baseplate J/gp47 family protein	plate	C9DGQ6	Escherichia_phage	98.9	1.1e-204
WP_000130548.1|299674_300112_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	100.0	1.0e-79
WP_000442748.1|300108_300702_-|plate	phage baseplate assembly protein	plate	A0A0C4UQZ3	Shigella_phage	99.0	1.2e-107
WP_000072824.1|300689_301829_-|plate	baseplate protein	plate	C9DGQ3	Escherichia_phage	98.9	3.4e-212
WP_000461070.1|301821_303309_-	DMT family permease	NA	A0A0C4UR32	Shigella_phage	98.2	6.6e-240
WP_000147074.1|303313_305386_-	tape measure protein	NA	C9DGQ1	Escherichia_phage	96.4	3.8e-312
WP_000344073.1|305530_305965_-	hypothetical protein	NA	C9DGP9	Escherichia_phage	97.9	3.8e-71
WP_000918402.1|305974_306331_-|tail	tail protein	tail	C9DGP8	Escherichia_phage	94.9	4.2e-60
WP_001280310.1|306340_307828_-|tail	tail protein	tail	C9DGP7	Escherichia_phage	99.6	1.3e-280
WP_001438403.1|307824_308028_-	DUF2635 domain-containing protein	NA	A0A0C4UR31	Shigella_phage	98.5	1.1e-28
WP_000888926.1|308014_308563_-	DUF1834 family protein	NA	C9DGP5	Escherichia_phage	99.5	1.9e-104
WP_001104973.1|308562_308988_-	DUF1320 family protein	NA	C9DGP4	Escherichia_phage	97.2	8.8e-73
WP_000017158.1|308984_309395_-	hypothetical protein	NA	C9DGP3	Escherichia_phage	98.5	6.1e-63
WP_000637410.1|309461_310379_-|head	head protein	head	C9DGP2	Escherichia_phage	99.3	5.2e-179
WP_000716025.1|310375_311461_-	hypothetical protein	NA	C9DGP0	Escherichia_phage	98.3	5.2e-194
WP_001350023.1|311657_312128_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	99.4	3.8e-85
WP_001136431.1|312124_313444_-|head	phage head morphogenesis protein	head	C9DGN7	Escherichia_phage	98.2	1.5e-248
WP_000532638.1|313424_314963_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	99.0	1.5e-295
WP_001097325.1|314962_316618_-	hypothetical protein	NA	C9DGN5	Escherichia_phage	97.8	0.0e+00
WP_000375394.1|316625_317201_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	100.0	9.1e-97
WP_000606409.1|317212_317503_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	100.0	7.4e-47
WP_000364295.1|317499_317799_-	DUF2730 family protein	NA	C9DGN2	Escherichia_phage	100.0	5.8e-47
WP_001001316.1|317798_317993_-	hypothetical protein	NA	C9DGN1	Escherichia_phage	100.0	6.2e-34
WP_001350022.1|318151_318538_-	hypothetical protein	NA	C9DGN0	Escherichia_phage	97.7	2.2e-62
WP_000907405.1|318521_319037_-	lysozyme	NA	C9DGM9	Escherichia_phage	99.4	1.9e-93
WP_001163387.1|319131_319554_-	positive regulator of late transcription	NA	C9DGM8	Escherichia_phage	99.3	2.2e-76
WP_000004161.1|319695_320058_-	hypothetical protein	NA	C9DGM6	Escherichia_phage	99.2	4.1e-63
WP_000515807.1|320050_320269_-	hypothetical protein	NA	C9DGM5	Escherichia_phage	100.0	5.6e-39
WP_000133853.1|320346_320736_-	hypothetical protein	NA	A0A0C4UR27	Shigella_phage	98.4	2.3e-67
WP_000091782.1|320732_321284_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	96.7	1.2e-98
WP_000431116.1|321354_321621_+	hypothetical protein	NA	Q38493	Escherichia_phage	98.9	2.3e-39
WP_001058561.1|321559_321862_-	hypothetical protein	NA	A0A0C4UQY6	Shigella_phage	99.0	1.4e-48
WP_000429765.1|321863_322046_-	hypothetical protein	NA	A0A0C4UR26	Shigella_phage	83.3	1.4e-24
WP_000465551.1|322032_322563_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	97.2	6.4e-97
WP_000227260.1|322562_323093_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	95.5	4.2e-96
WP_001107930.1|323191_323716_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	100.0	1.5e-90
WP_000255655.1|323735_324035_-	hypothetical protein	NA	C9DGL7	Escherichia_phage	99.0	2.8e-49
WP_001101152.1|324035_324455_-	hypothetical protein	NA	C9DGL6	Escherichia_phage	95.7	8.7e-73
WP_001151288.1|324469_324733_-	hypothetical protein	NA	A0A0C4UQU1	Shigella_phage	96.6	2.5e-38
WP_000968312.1|324977_325205_-	hypothetical protein	NA	C9DGL3	Escherichia_phage	100.0	3.2e-37
WP_001026710.1|325220_326159_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	98.1	1.3e-169
WP_000424754.1|326197_328189_-|transposase	transposase	transposase	C9DGL1	Escherichia_phage	93.5	0.0e+00
WP_000337186.1|328190_328418_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	66.7	4.8e-17
WP_001474801.1|328653_329178_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001143092.1|329599_332044_-	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	42.6	1.6e-33
>prophage 3
NZ_CP043487	Escherichia coli strain AQ15 chromosome, complete genome	4753097	1444255	1500797	4753097	terminase,tRNA,holin,tail,plate,integrase	Escherichia_phage(75.86%)	64	1445080:1445095	1503072:1503087
WP_001307164.1|1444255_1445488_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
1445080:1445095	attL	TCAGAAAAAAGCGCGC	NA	NA	NA	NA
WP_000387388.1|1445742_1446726_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123740.1|1447203_1448577_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157422.1|1448705_1449641_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	4.5e-146
WP_000040852.1|1449692_1450928_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1450929_1451145_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1451223_1451433_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1451425_1451620_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1451676_1452486_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105152.1|1452478_1455079_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	1.8e-248
WP_001349884.1|1455180_1455456_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	92.3	6.3e-40
WP_000245530.1|1455530_1455707_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	91.4	6.3e-25
WP_000560220.1|1455700_1455922_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	100.0	6.2e-38
WP_001169153.1|1456342_1456495_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000233319.1|1456925_1457345_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|1457424_1457679_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693802.1|1457675_1458098_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
WP_000899746.1|1458110_1458968_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788973.1|1458974_1459721_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_000450660.1|1459743_1460505_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.0	1.7e-114
WP_001151237.1|1460520_1460943_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.9	7.4e-64
WP_000228824.1|1461126_1462254_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000569066.1|1462246_1463356_+	DUF3696 domain-containing protein	NA	NA	NA	NA	NA
WP_000064766.1|1463352_1464330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813259.1|1464960_1465116_+	type I toxin-antitoxin system Hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	96.1	5.5e-17
WP_000940320.1|1465584_1466184_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
WP_000228041.1|1466183_1466474_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	4.3e-47
WP_000640164.1|1466470_1467007_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	6.3e-68
WP_001349882.1|1468277_1468670_+|holin	holin	holin	Q8W636	Enterobacteria_phage	96.2	8.4e-54
WP_000950573.1|1468659_1468935_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	97.8	5.5e-44
WP_000014545.1|1468937_1469315_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	97.6	3.0e-64
WP_001291099.1|1469916_1470705_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	41.1	2.5e-49
WP_001204039.1|1470697_1471630_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	7.1e-83
WP_000126790.1|1471607_1471817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089432.1|1471820_1472912_+	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	92.1	1.0e-144
WP_000021163.1|1472901_1474230_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	98.9	8.4e-263
WP_021036437.1|1474248_1475685_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	95.6	2.6e-265
WP_024190735.1|1475743_1476463_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	97.9	6.2e-135
WP_000059667.1|1476443_1477766_+	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	95.2	6.8e-188
WP_001349881.1|1477758_1478376_+	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	100.0	5.9e-118
WP_001272365.1|1478390_1479419_+	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	99.4	3.3e-190
WP_000780861.1|1479476_1479947_+	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	100.0	2.5e-84
WP_000175376.1|1479946_1480387_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	99.3	1.2e-77
WP_000762302.1|1480383_1480824_+	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	98.6	2.2e-82
WP_001139506.1|1480810_1481755_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	99.4	2.2e-172
WP_000506600.1|1481754_1483092_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	96.2	1.0e-244
WP_000613371.1|1483115_1483547_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	99.3	2.8e-74
WP_000703979.1|1483543_1484161_+	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	98.0	4.2e-108
WP_000016439.1|1484224_1486213_+	transglycosylase SLT domain-containing protein	NA	A0A0U2QV45	Escherichia_phage	94.4	0.0e+00
WP_000056323.1|1486216_1486885_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	98.6	4.3e-122
WP_000209259.1|1486881_1487148_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	94.3	2.7e-43
WP_001271172.1|1487147_1488155_+	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	96.1	1.2e-189
WP_000063616.1|1488154_1488868_+|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	96.6	1.8e-126
WP_001261334.1|1489564_1489912_+	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	94.8	4.1e-60
WP_014640615.1|1489887_1490262_-	hypothetical protein	NA	A0A0U2QL80	Escherichia_phage	95.8	6.8e-61
WP_000733802.1|1490302_1490842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001349878.1|1490863_1492090_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	98.8	5.8e-226
WP_001199732.1|1492073_1492700_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	99.0	2.2e-120
WP_000600270.1|1492696_1494250_+	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	79.2	4.6e-228
WP_000902859.1|1494252_1494798_+|tail	tail assembly protein	tail	Q8W612	Enterobacteria_phage	76.4	3.8e-76
WP_000117760.1|1494821_1497962_+	shikimate transporter	NA	A0A0U2SH60	Escherichia_phage	71.2	0.0e+00
WP_000701877.1|1497976_1498549_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.3	1.8e-76
WP_001082294.1|1499088_1499523_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000837909.1|1499663_1500797_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
1503072:1503087	attR	GCGCGCTTTTTTCTGA	NA	NA	NA	NA
>prophage 4
NZ_CP043487	Escherichia coli strain AQ15 chromosome, complete genome	4753097	1665214	1741642	4753097	terminase,portal,capsid,lysis,head,tail,integrase,transposase	Enterobacteria_phage(41.38%)	96	1684885:1684944	1733849:1735177
WP_001339197.1|1665214_1666423_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_001022785.1|1666604_1668278_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_001296721.1|1668333_1668645_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001349922.1|1668672_1669995_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000722571.1|1670109_1670421_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000577184.1|1670619_1671318_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000087220.1|1671362_1672262_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054196.1|1672456_1673644_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|1673770_1673866_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592814.1|1674084_1674975_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
WP_000671744.1|1675229_1675622_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024810.1|1675897_1676416_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_001299399.1|1676460_1678506_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|1678642_1679389_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|1679477_1680164_+	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000214712.1|1680341_1680545_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527779.1|1680580_1682041_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.1e-42
WP_000347482.1|1682129_1683413_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1684017_1684131_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1684199_1684433_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_016230953.1|1684749_1684929_+	recombinase family protein	NA	NA	NA	NA	NA
1684885:1684944	attL	CTGAGAGATCCCCTCATAATTTCCCCAAAGCGTAACCATGTGTGAATAAATTTTGAGCTA	NA	NA	NA	NA
WP_001339197.1|1684897_1686106_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_077631333.1|1686204_1686678_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	39.6	9.6e-20
WP_000885611.1|1686775_1687351_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000279140.1|1687350_1690425_-	membrane protein	NA	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_001233072.1|1690489_1691089_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	9.7e-110
WP_000033679.1|1691159_1694573_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.4	0.0e+00
WP_000090891.1|1694633_1695266_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_001349921.1|1695202_1695946_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	6.8e-145
WP_001152622.1|1695951_1696650_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	1.6e-132
WP_000847360.1|1696649_1696979_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	9.6e-59
WP_000840335.1|1696975_1699537_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.3	0.0e+00
WP_000459457.1|1699529_1699964_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479150.1|1699945_1700368_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	98.6	1.3e-71
WP_001349920.1|1700383_1701124_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683105.1|1701131_1701527_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000985119.1|1701523_1702102_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000753007.1|1702113_1702467_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_000158921.1|1702478_1702877_-	hypothetical protein	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	4.5e-63
WP_000063280.1|1702918_1703944_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_001295978.1|1703999_1704332_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123305.1|1704341_1705661_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.3	2.5e-235
WP_001349919.1|1705641_1707243_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.6	5.9e-311
WP_000198149.1|1707239_1707446_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027259.1|1707442_1709368_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453611.1|1709342_1709888_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001368374.1|1710276_1710510_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1710567_1710978_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1711129_1711303_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1711474_1711630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1711709_1711775_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1711777_1711966_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1711976_1712189_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1712551_1713049_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1713045_1713579_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1713575_1713887_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1713891_1714107_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1714860_1715076_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1715376_1715589_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1715643_1715733_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1716010_1716763_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265199.1|1716776_1717826_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_012304870.1|1717827_1718106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1718172_1718424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1718640_1718796_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1718867_1719155_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1719154_1719394_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1719418_1719724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1719926_1720259_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589005.1|1720695_1722009_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000955178.1|1722186_1722369_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_072096395.1|1722343_1722562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310834.1|1723675_1724032_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_001151262.1|1724028_1724451_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_000054512.1|1724491_1725457_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_000705358.1|1725437_1725959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1725942_1726173_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1726256_1726664_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1726830_1726986_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|1727145_1727364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329848.1|1727367_1727532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1727931_1728120_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|1728116_1728308_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048348.1|1728400_1730878_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001296941.1|1730965_1731202_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876956.1|1731236_1732517_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	5.6e-155
WP_001339197.1|1732686_1733895_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_023352561.1|1733904_1733985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836076.1|1734042_1735062_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	1.3e-16
WP_001295394.1|1735073_1736288_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
1733849:1735177	attR	TAGCTCAAAATTTATTCACACATGGTTACGCTTTGGGGAAATTATGAGGGGATCTCTCAGAGCGCAGTGCCCAGCCATCCCGATACTGCTGCTTTCACCAAATCCTTAGTGCTTCTTTCATGTTTTTCTATTGTCATAATGGTTATCTCTAAAAAAGAGGTAAGATGCGTACTACTTACTCGCCGTTATTGGTATTATTCAGAAAAAGTGAGTAAGACTTTGCAGCAATGTTTTTGATCCTGTTCAAATAAACTAATGGCATCAGCAACATGCTGGAAATCAAACGTATGGGTAATTAATTTTTCTGGTTTAATTAACCCTTTACTTAACCAGTCGATAACAACCGGAAATTTATTTGCATTTAAGCGTGAAGAGAAAATAGAGAGTTCTTTTCCGGTAATTCCTTGCTGAATCACTTCAGACGGTTCACTGGAGAAGCCCATCAATACAATACGTGCCGCTGGAGAAGCCAGCGTTACGGCCTCTTTCAGGATAGAAGGATGACAAGCCGCATCGATAATTAATGTCGGCTTGATGCCTTTTTCAGCGAAAATCTCGCCAAGCGGTGTCTGGCTGTTATTAATCGCCCAGTCTGCCCCGCTCTCTTTCGCTTTTTCCAGTCGTTCATCAATGCGATCGGCAACAATCACATTTTTAACGTTATAGACGCCTTTTAATACCTGAACGATCGTCAGGCCGATTGGACCGGCACCATAAACCAGAACGGTATCATTTTCAGTCGGTTGACCATGACCGGTAACGTTAGCCGCAATGGTAAAAGGTTCGATCATCATCGCATATTGATCGGCCACTGCTTCAGGAATTTTCCACGCATTTTTTGCCGGAACCACGGCATATTCACTGAAACCACCGTCAGCGTGCACACCTAATACAGCAAGTGTCGTACAAACGTTCGGCTTACCTATAGAGCACGGATAGCAATGCCCACAGCTGACCACCGGATCGACAGCAACGCGTTCACCGACTCTGGCGCTTTCCACACCTTCACCCACCGCATCAATGACGCCAAAGAATTCATGACCAATGACGCGCGGATATTTCGCAAAAGGATTATGCCCACGGTAAATATGGCTATCTGAACCACAAATTCCGGCAAGTTTCACTTTTACTCGTACTTCACCCGCTGACGGGGTGGGTATTTCACGTTCGATAATCGACAGTTGATTCGGTTTTTCAATTAAAATGCTTTTCATTACCTTACTCCTTACCAGTTCCACAGCGTGCCATCTTCCAGACGTGCGACTGGCAGATAAGCAGGTTCATAGGGATATTTCGCCGCCAGCTTTTCATCGAATTCGATGCCAAGAC	NA	NA	NA	NA
WP_000598292.1|1736493_1736820_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|1736954_1737296_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1737330_1737891_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1737893_1738604_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|1738711_1739017_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041685.1|1739215_1741642_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	2.7e-214
>prophage 5
NZ_CP043487	Escherichia coli strain AQ15 chromosome, complete genome	4753097	2241249	2304526	4753097	terminase,lysis,capsid,portal,tRNA,holin,head,tail,plate,integrase	Escherichia_phage(43.48%)	73	2246307:2246334	2277257:2277284
WP_000675150.1|2241249_2242653_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137869.1|2242649_2243372_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
WP_000929408.1|2243562_2243895_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|2244103_2244400_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|2244401_2244698_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|2244800_2246162_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
2246307:2246334	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2246434_2246653_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882938.1|2246733_2247897_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000978889.1|2247896_2248376_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069967.1|2248390_2250838_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	98.8	0.0e+00
WP_000785970.1|2250830_2250950_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|2250982_2251258_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2251314_2251833_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286686.1|2251845_2253036_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.1e-224
WP_000905100.1|2253095_2253689_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	98.0	1.2e-104
WP_000049773.1|2254134_2254575_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	61.9	2.7e-48
WP_000805553.1|2254546_2255140_-|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	63.0	1.3e-58
WP_000216987.1|2255139_2256423_-|tail	tail protein	tail	M1TAS6	Escherichia_phage	64.6	6.6e-156
WP_001285343.1|2256419_2257031_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_001121496.1|2257023_2257932_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	2.8e-161
WP_000127163.1|2257936_2258284_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001093712.1|2258280_2258916_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	6.5e-112
WP_001001780.1|2258982_2259435_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_000917179.1|2259427_2259895_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	100.0	3.0e-82
WP_000040682.1|2260002_2260428_-|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	100.0	7.7e-69
WP_000736570.1|2260415_2260841_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	98.6	2.9e-60
WP_001144178.1|2260855_2261353_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	3.4e-92
WP_000123123.1|2261352_2261634_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|2261637_2261841_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_001350080.1|2261840_2262350_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	98.8	2.1e-89
WP_000203430.1|2262449_2263193_-|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	96.0	2.3e-121
WP_001248584.1|2263196_2264270_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.7	7.4e-201
WP_001085948.1|2264328_2265183_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_000156872.1|2265356_2267129_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_000038162.1|2267128_2268157_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.1	6.2e-197
WP_001350078.1|2268215_2268788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000744812.1|2268780_2270214_-	AAA family ATPase	NA	A0A2I7RNF1	Vibrio_phage	30.1	3.9e-40
WP_000268602.1|2271378_2273655_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.9	0.0e+00
WP_000027664.1|2273644_2273920_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113270.1|2273916_2274141_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277968.1|2274143_2274443_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	4.2e-45
WP_071842580.1|2274442_2274625_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.3	7.2e-24
WP_000217680.1|2274673_2275174_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	99.4	1.7e-91
WP_001081582.1|2275351_2275627_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|2275748_2276048_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985260.1|2276163_2277177_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001352710.1|2277441_2277759_-	hypothetical protein	NA	NA	NA	NA	NA
2277257:2277284	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2278164_2279064_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178552.1|2279145_2279925_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|2280024_2281065_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490714.1|2281112_2282468_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823288.1|2282471_2282756_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|2282786_2283239_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853892.1|2283248_2284511_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000289788.1|2284539_2285394_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129568.1|2285703_2286756_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858498.1|2287012_2288290_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846224.1|2288286_2289291_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011957.1|2289287_2290253_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|2290226_2290973_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297420.1|2291024_2291843_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000822274.1|2291907_2292708_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195605.1|2292704_2293493_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|2293715_2293988_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134569.1|2294108_2294933_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|2295151_2295490_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000405707.1|2295571_2296606_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945468.1|2296621_2299102_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677395.1|2299117_2299792_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|2299872_2300415_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001324851.1|2300707_2300989_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|2301251_2302361_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001295427.1|2302492_2304526_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 6
NZ_CP043487	Escherichia coli strain AQ15 chromosome, complete genome	4753097	2317037	2326478	4753097		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001349937.1|2317037_2318174_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001349936.1|2318170_2320171_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001295429.1|2320295_2320757_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2320796_2321267_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2321313_2322033_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2322029_2323715_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2323936_2324668_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2324727_2324835_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2324815_2325547_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569367.1|2325551_2326478_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	9.7e-24
>prophage 7
NZ_CP043487	Escherichia coli strain AQ15 chromosome, complete genome	4753097	2829804	2837272	4753097	integrase,transposase	Escherichia_phage(66.67%)	6	2827592:2827605	2834705:2834718
2827592:2827605	attL	CGACTATTTGAACT	NA	NA	NA	NA
WP_000162574.1|2829804_2830287_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001341819.1|2831029_2832259_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|2832297_2832714_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214990.1|2832785_2834534_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000577254.1|2834535_2836254_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
2834705:2834718	attR	AGTTCAAATAGTCG	NA	NA	NA	NA
WP_000878218.1|2836405_2837272_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
>prophage 8
NZ_CP043487	Escherichia coli strain AQ15 chromosome, complete genome	4753097	2912236	2919376	4753097		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|2912236_2914798_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141330.1|2914903_2915560_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272549.1|2915610_2916408_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_000847985.1|2916573_2917482_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|2917478_2918741_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2918737_2919376_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 9
NZ_CP043487	Escherichia coli strain AQ15 chromosome, complete genome	4753097	4189542	4281152	4753097	terminase,portal,capsid,lysis,tRNA,protease,head,holin,tail,plate,integrase,transposase	Escherichia_virus(40.43%)	95	4220204:4220250	4252883:4252929
WP_000560983.1|4189542_4189980_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|4190024_4190966_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001162704.1|4191029_4191938_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897305.1|4192166_4192478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|4192478_4192769_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001295676.1|4193373_4193592_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086388.1|4193810_4194053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027702.1|4194382_4195312_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|4195308_4195944_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|4195940_4196843_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_011310337.1|4196855_4199906_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753583.1|4200099_4200933_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001317404.1|4201085_4202126_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931314.1|4202175_4203924_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001019466.1|4203923_4204994_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446010.1|4204983_4206435_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729595.1|4206445_4206892_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619503.1|4207192_4207507_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179764.1|4207516_4208341_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211486.1|4208582_4209842_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144046.1|4209838_4211308_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217162.1|4211595_4212432_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001350036.1|4212415_4213354_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063504.1|4213350_4214385_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|4214669_4215290_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166050.1|4215549_4216533_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|4216681_4217356_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4217461_4218835_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|4218831_4219530_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4219679_4220180_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4220204:4220250	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000023383.1|4220365_4221346_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4C5	Escherichia_virus	100.0	1.0e-185
WP_001192857.1|4221415_4221709_-	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000453534.1|4221861_4222134_+	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_000217679.1|4222303_4222804_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_000557702.1|4222867_4223092_+	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	100.0	6.1e-33
WP_001277905.1|4223091_4223394_+	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	100.0	3.5e-47
WP_001113263.1|4223393_4223618_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	100.0	2.2e-35
WP_000027664.1|4223614_4223890_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268589.1|4223879_4226165_+	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	99.9	0.0e+00
WP_014640573.1|4226164_4226617_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.7	6.1e-80
WP_001143634.1|4227065_4228004_+	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	100.0	3.1e-187
WP_000570053.1|4228000_4229038_-	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	100.0	4.6e-200
WP_000368931.1|4229030_4230104_-	ParB N-terminal domain-containing protein	NA	Q7Y4B3	Escherichia_virus	100.0	1.2e-203
WP_000038147.1|4230519_4231554_-|portal	phage portal protein	portal	Q7Y4E8	Escherichia_virus	100.0	2.4e-201
WP_000156872.1|4231553_4233326_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085948.1|4233499_4234354_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_000203430.1|4235490_4236234_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	96.0	2.3e-121
WP_001350080.1|4236333_4236843_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	98.8	2.1e-89
WP_000846399.1|4236842_4237046_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|4237049_4237331_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144178.1|4237330_4237828_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	3.4e-92
WP_000736570.1|4237842_4238268_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	98.6	2.9e-60
WP_000040682.1|4238255_4238681_+|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	100.0	7.7e-69
WP_000917179.1|4238788_4239256_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	100.0	3.0e-82
WP_001001780.1|4239248_4239701_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_001093706.1|4239767_4240403_+|plate	phage baseplate assembly protein V	plate	Q7Y4D8	Escherichia_virus	100.0	2.4e-106
WP_000127163.1|4240399_4240747_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121482.1|4240751_4241660_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.0e-162
WP_001285313.1|4241652_4242183_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	99.4	1.3e-102
WP_000104720.1|4242193_4244203_+|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	99.6	0.0e+00
WP_001164149.1|4244206_4244734_+|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	98.3	5.6e-93
WP_000014362.1|4244949_4245849_+	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	100.0	6.2e-169
WP_001286683.1|4246168_4247359_+|tail	phage tail sheath protein	tail	Q7Y4D1	Escherichia_virus	99.7	8.1e-225
WP_001251408.1|4247371_4247890_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|4247946_4248222_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|4248254_4248374_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001283070.1|4248366_4250814_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	100.0	0.0e+00
WP_000978900.1|4250828_4251308_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	100.0	5.1e-85
WP_000882968.1|4251307_4252471_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	98.4	1.3e-206
WP_000468308.1|4252552_4252771_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076742.1|4253007_4253910_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4252883:4252929	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|4254090_4255053_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045689.1|4255372_4256362_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000708994.1|4256468_4257224_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|4257278_4258046_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802226.1|4258153_4258753_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155254.1|4258853_4259294_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|4259505_4259805_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323556.1|4259831_4260260_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796320.1|4260264_4261011_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|4261107_4262118_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|4262253_4263762_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|4263784_4264630_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4265054_4265300_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4265384_4265870_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|4265962_4266889_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293343.1|4266955_4268287_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|4268296_4268827_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_000068834.1|4268919_4269879_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000644904.1|4269970_4270996_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_001350069.1|4271151_4273350_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_000710769.1|4273552_4273765_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000015021.1|4273924_4278097_+	rhs element protein RhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	3.6e-25
WP_000797341.1|4279328_4279937_-	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000399648.1|4280171_4281152_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
