The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP035545	Escherichia coli strain FSIS11705876 chromosome, complete genome	5483434	215654	279953	5483434	transposase,plate,tRNA	uncultured_Caudovirales_phage(33.33%)	54	NA	NA
WP_000176537.1|215654_216950_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|217002_217263_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|217249_217450_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185286.1|217615_218161_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635546.1|218157_218568_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|218581_219292_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|219491_220316_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|220368_222087_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|222197_222905_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|222901_223306_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|223423_224239_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|224278_224932_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|224924_225956_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|226143_226719_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|232477_233281_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|233277_234192_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234432_235233_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|235310_236081_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|236128_237487_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|237558_238314_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|238347_239070_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|239066_239534_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|239598_240330_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001086136.1|240867_241668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|242145_242595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000964776.1|242597_243194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001452678.1|243303_243495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|243515_243995_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|243960_245370_-	membrane protein	NA	NA	NA	NA	NA
WP_001303798.1|245380_248815_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240517.1|248951_250364_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088854.1|250368_251112_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614375.1|251108_253886_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.7	4.7e-82
WP_000343292.1|253894_254656_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246434.1|254660_255992_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|255994_256519_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|256515_257796_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|257820_258903_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|258866_260717_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|260720_261134_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|261224_262616_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|262666_262891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|262925_263426_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|264122_264641_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_021498998.1|264850_266992_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.8e-25
WP_000509129.1|267067_271300_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000995683.1|271439_272156_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000339419.1|272337_273846_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_001478139.1|273914_274490_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000420853.1|275235_276372_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001145876.1|276374_278135_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000247943.1|278336_278600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|278514_278700_-	protein YncO	NA	NA	NA	NA	NA
WP_000027427.1|278780_279953_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP035545	Escherichia coli strain FSIS11705876 chromosome, complete genome	5483434	298739	351666	5483434	tail,integrase,transposase	Enterobacteria_phage(34.78%)	55	301278:301294	358494:358510
WP_000749881.1|298739_299795_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|300082_301186_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|301197_302451_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
301278:301294	attL	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
WP_001303805.1|303520_303766_-	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_085948178.1|304092_305306_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000708831.1|305331_305715_-	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.2	4.4e-07
WP_001274756.1|305842_306556_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000437875.1|306656_306857_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|306975_307269_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000788819.1|308220_308532_+	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_001096963.1|308531_309326_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000805544.1|309325_309919_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_001115553.1|310357_310768_-|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000904979.1|310797_311352_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_000355475.1|311409_312183_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000246059.1|313006_313750_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001130487.1|314712_315894_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000082144.1|315897_316314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|316286_316904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251694.1|316903_317362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000647286.1|318016_318406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350115.1|318605_319172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001185340.1|319581_319854_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000968317.1|319859_320411_-	Polarity suppression protein	NA	NA	NA	NA	NA
WP_000154958.1|320407_321160_-	septation initiation protein	NA	NA	NA	NA	NA
WP_001244581.1|322093_322354_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000973389.1|322350_322908_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001071227.1|322904_323126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000562750.1|323125_323449_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_000016225.1|323462_325796_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000205213.1|325928_326885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000687183.1|327560_328460_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000361969.1|328558_329281_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001301751.1|329447_329726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917758.1|330428_331331_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303808.1|331576_332635_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000171065.1|332776_333904_+	MFS transporter	NA	NA	NA	NA	NA
WP_000121344.1|334082_335039_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667043.1|335048_337247_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000643340.1|337243_338200_-	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000070685.1|338196_338886_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|339303_339918_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|340165_340495_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001301550.1|340807_341518_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001265657.1|341486_343130_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131063.1|343119_345645_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000716386.1|345670_346339_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|346396_346984_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000389022.1|347058_347601_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147284.1|348425_348617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|348686_348827_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|348826_349090_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001171540.1|349353_349734_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|349730_350078_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|350127_351666_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
358494:358510	attR	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
>prophage 3
NZ_CP035545	Escherichia coli strain FSIS11705876 chromosome, complete genome	5483434	894862	932964	5483434	holin,lysis,protease,tail,portal,terminase,integrase	Enterobacteria_phage(47.62%)	49	884304:884318	916599:916613
884304:884318	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_000533643.1|894862_895933_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|895910_896129_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|896168_896336_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|896578_897181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|897391_897613_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_023436627.1|897711_897993_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000548536.1|898003_898195_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|898167_898350_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|898346_899027_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|899724_899907_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|899903_900074_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|900066_900687_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000750155.1|901561_902521_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|902858_902981_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|902995_903685_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|903868_904612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|904697_904856_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|904936_905335_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_001303850.1|905477_905693_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000075107.1|905692_906190_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|906186_906654_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|906641_906794_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000349509.1|907468_907960_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934137.1|907959_910062_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|910058_910271_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|910198_911323_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|911444_911780_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136597.1|911724_913752_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_001097050.1|913838_914162_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|914154_914430_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|914441_915020_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|915016_915418_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|915428_916172_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|916232_916619_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
916599:916613	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|916627_916957_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|916928_919994_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|919993_920323_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|920332_921031_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|921036_921780_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|921716_922325_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000515426.1|922385_925799_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_001233141.1|925869_926469_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741889.1|926528_927845_+|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	95.6	1.2e-70
WP_001024022.1|927846_928116_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|928292_929273_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|929306_930326_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|930822_930984_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951025.1|931153_932035_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.8	1.1e-146
WP_001247925.1|932265_932964_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 4
NZ_CP035545	Escherichia coli strain FSIS11705876 chromosome, complete genome	5483434	1149672	1220815	5483434	holin,protease,tail,head,portal,terminase,transposase	Enterobacteria_phage(25.58%)	77	NA	NA
WP_000156526.1|1149672_1151433_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1151618_1152071_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1152145_1153186_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1153542_1154052_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1154270_1154900_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1154862_1157025_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1157034_1157481_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1157603_1159658_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
WP_000424181.1|1159689_1160148_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1160243_1160906_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1161078_1161492_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1161536_1161854_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1161911_1163102_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1163196_1163475_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1163471_1163801_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1163891_1164551_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_000273151.1|1165942_1166185_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1166252_1168724_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1168817_1169009_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1169005_1169194_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1169767_1169953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1170139_1170529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1170670_1170826_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1171103_1171391_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1171390_1171582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1171609_1172011_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1172119_1172392_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1172375_1172801_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1173007_1173463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|1173541_1174633_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788745.1|1174639_1175386_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	3.1e-113
WP_153983941.1|1175407_1176094_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	61.4	4.4e-66
WP_001151233.1|1177505_1177919_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1178270_1179044_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|1179409_1179547_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|1179591_1179804_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_001341388.1|1179971_1180250_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1180251_1181301_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001217436.1|1181313_1181685_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1181674_1182046_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|1182197_1183016_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001303877.1|1183302_1183542_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000261909.1|1183636_1184350_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|1185117_1186968_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_085948178.1|1187143_1188356_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303878.1|1188561_1188876_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1189403_1189589_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1189810_1189924_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1190144_1190678_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1190837_1191110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|1191365_1191572_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|1192322_1192598_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|1192673_1193054_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1193050_1193398_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1193447_1194986_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001301919.1|1195035_1195278_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_153983942.1|1195249_1197178_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	62.3	9.7e-244
WP_000259002.1|1197161_1197368_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1197364_1198957_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|1198946_1200452_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1200488_1200836_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1200893_1201160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|1201141_1201882_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000533402.1|1202354_1202768_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000847274.1|1205323_1205653_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001151105.1|1205652_1206351_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|1206361_1207105_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_050546863.1|1207050_1207683_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649829.1|1207873_1208401_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515111.1|1208534_1212008_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.5	0.0e+00
WP_001230444.1|1212075_1212675_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268962.1|1212738_1214052_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001023352.1|1214053_1214323_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001301613.1|1216596_1217715_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1217711_1219505_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1219523_1220231_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|1220227_1220815_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP035545	Escherichia coli strain FSIS11705876 chromosome, complete genome	5483434	1483858	1600421	5483434	holin,lysis,protease,tail,integrase,tRNA,head,portal,terminase,capsid,transposase	Enterobacteria_phage(37.0%)	145	1545784:1545799	1574035:1574050
WP_000952736.1|1483858_1484680_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|1484835_1485882_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|1485878_1486673_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|1486839_1487958_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|1487926_1488196_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|1488257_1488647_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|1488779_1489295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|1489409_1489562_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|1489877_1490354_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1490478_1490802_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693915.1|1490785_1491211_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|1491279_1492317_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_072143019.1|1492228_1492771_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000451012.1|1492804_1493521_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_000017339.1|1493517_1493835_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_001310212.1|1493831_1494134_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|1494123_1494441_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|1494394_1494712_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|1494698_1495136_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|1495137_1495329_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|1495331_1495919_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|1496034_1496139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|1496327_1496540_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|1496707_1496986_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265168.1|1496987_1498037_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001217415.1|1498049_1498307_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.3	3.1e-20
WP_001213059.1|1499727_1499910_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|1499947_1500217_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|1500292_1500508_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|1500512_1500857_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|1500907_1501441_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|1501711_1502281_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1502280_1502427_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|1502654_1502861_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1502925_1503150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1503506_1503647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302295.1|1503776_1503962_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000279786.1|1504003_1504369_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|1504658_1505222_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000173030.1|1506943_1508881_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_000126019.1|1511669_1511996_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1512005_1512356_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1512352_1512799_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1512795_1513140_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|1513205_1513922_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|1513936_1514311_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453698.1|1514406_1514616_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_153983945.1|1514668_1517911_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.6	0.0e+00
WP_000807954.1|1517903_1518245_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179478.1|1518244_1518943_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000170104.1|1518959_1519214_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|1519323_1519434_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|1519736_1520615_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|1520668_1521406_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|1521351_1521588_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|1521600_1521690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1521709_1524058_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301834.1|1530153_1530279_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|1530358_1530634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|1530694_1532056_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|1532419_1533283_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1533266_1534403_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1534652_1535879_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|1535927_1537049_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085256.1|1537297_1538527_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|1538891_1539080_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_125090562.1|1539129_1539456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106745.1|1539580_1539754_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	51.2	8.4e-06
WP_000226782.1|1539884_1540082_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|1540074_1540287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|1540276_1540741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|1540733_1540967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|1540972_1541272_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833628.1|1541268_1542669_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	5.6e-116
WP_000192401.1|1542869_1543121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|1543117_1543528_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|1543538_1543811_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1543937_1544162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|1544413_1544620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|1544619_1545675_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|1545687_1546023_+|head	head decoration protein	head	NA	NA	NA	NA
1545784:1545799	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224603.1|1546035_1546449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|1546654_1547197_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|1547452_1547734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|1548334_1549795_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|1549794_1550466_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1550634_1552005_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|1552008_1552650_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|1552685_1553792_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1553845_1554307_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|1554316_1554970_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|1555141_1556392_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|1556505_1557648_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|1557637_1557874_-	excisionase	NA	NA	NA	NA	NA
WP_000945520.1|1557977_1558802_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000788869.1|1558798_1559500_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|1559496_1559799_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|1559866_1560199_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|1560263_1560386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053040.1|1562467_1562923_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|1562922_1563093_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1563085_1563376_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|1563372_1563735_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|1563731_1563872_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|1563868_1564558_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|1564879_1565185_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|1565171_1565648_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|1565864_1566047_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|1566137_1566431_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|1566722_1567133_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|1567418_1567625_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|1567789_1567984_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|1568372_1568918_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|1568892_1570818_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|1570814_1571021_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1571017_1572619_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_001295978.1|1573929_1574262_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
1574035:1574050	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063265.1|1574317_1575343_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|1575384_1575783_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|1575794_1576148_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|1576159_1576738_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|1576734_1577130_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|1577137_1577878_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|1577893_1578316_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|1578297_1578732_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|1578724_1581274_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|1581270_1581600_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|1581599_1582298_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|1582303_1583047_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|1582983_1583616_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|1583676_1587075_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|1587141_1587741_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|1587805_1590721_+	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|1590720_1591302_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|1591421_1592312_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|1592330_1592837_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|1592873_1593374_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|1593452_1593635_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|1594132_1594801_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|1594857_1595106_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|1595181_1595562_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1595558_1595906_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998042.1|1595955_1597494_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_001226373.1|1597796_1599281_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|1599467_1600421_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 6
NZ_CP035545	Escherichia coli strain FSIS11705876 chromosome, complete genome	5483434	1680663	1754304	5483434	capsid,holin,lysis,protease,tail,head,terminase,integrase,transposase	Escherichia_phage(31.37%)	81	1680500:1680527	1738776:1738803
1680500:1680527	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|1680663_1681794_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1681771_1682020_-	excisionase	NA	NA	NA	NA	NA
WP_000048551.1|1682084_1684556_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090196.1|1684648_1684840_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1684836_1685025_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|1685422_1685590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|1685583_1685817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1685794_1686202_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|1686224_1686443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1686515_1686815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1687078_1687486_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|1687562_1687790_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|1687773_1688325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983946.1|1688296_1689337_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	2.5e-89
WP_157825328.1|1689248_1689791_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000774808.1|1689977_1690559_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|1690555_1690720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1691418_1692177_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|1692455_1692668_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|1692888_1693146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1693215_1693494_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|1693495_1694542_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|1694554_1694914_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|1694922_1695453_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|1695694_1695892_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|1696042_1697101_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_001415558.1|1697840_1697999_+	DUF1737 domain-containing protein	NA	Q5MBW4	Stx1-converting_phage	100.0	3.5e-11
WP_000284517.1|1698867_1699083_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|1699087_1699432_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000539792.1|1700858_1701005_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001082601.1|1701012_1701480_+|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	92.2	1.1e-71
WP_001302717.1|1701943_1702258_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|1702339_1702564_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|1702950_1703496_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027185.1|1703470_1705396_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.0	0.0e+00
WP_000198153.1|1705392_1705599_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_000123254.1|1707176_1708496_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1708505_1708838_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|1708894_1709920_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|1709961_1710360_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|1710371_1710725_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|1710739_1711273_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|1711269_1711665_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|1711672_1712425_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1712438_1712861_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000438877.1|1712887_1713196_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000918257.1|1713239_1715885_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	98.6	0.0e+00
WP_000847298.1|1715881_1716211_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1716210_1716909_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_122989782.1|1717608_1718238_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.6	2.7e-102
WP_001228334.1|1721402_1722002_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.0	1.0e-106
WP_000216534.1|1722153_1723458_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	3.9e-79
WP_001023474.1|1723459_1723729_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|1724755_1726081_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_106409364.1|1727678_1727801_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|1727907_1728819_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|1728884_1729454_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|1730419_1731958_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1732007_1732355_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|1732351_1732732_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001303943.1|1733071_1733350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1733777_1733924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|1734060_1734708_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|1734891_1735482_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_000147167.1|1738233_1738452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079499.1|1738953_1739460_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1738776:1738803	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|1739505_1740006_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1740091_1740271_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|1740651_1741458_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|1741457_1742651_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001302292.1|1742662_1744021_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
WP_000763520.1|1744024_1745620_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|1745619_1747182_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1747273_1747318_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|1747455_1748337_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1748333_1748954_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|1748981_1750565_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|1750777_1751650_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|1751689_1752280_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|1752276_1753035_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|1753254_1754304_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
NZ_CP035545	Escherichia coli strain FSIS11705876 chromosome, complete genome	5483434	2025910	2040140	5483434	tail	Enterobacteria_phage(35.71%)	15	NA	NA
WP_000214712.1|2025910_2026114_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2026149_2027610_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|2027698_2028982_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_016241229.1|2029041_2029356_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2029517_2030159_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001303500.1|2030240_2030870_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2030942_2031518_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2031631_2031901_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_153983947.1|2031902_2033216_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.2	1.4e-81
WP_001230508.1|2033280_2033880_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_153983948.1|2033947_2037427_-	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	99.2	0.0e+00
WP_050439450.1|2037768_2038401_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|2038346_2039090_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001179510.1|2039100_2039799_-|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.8	7.6e-130
WP_000807954.1|2039798_2040140_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
>prophage 8
NZ_CP035545	Escherichia coli strain FSIS11705876 chromosome, complete genome	5483434	2043425	2108130	5483434	holin,tail,head,portal,terminase,capsid	Stx2-converting_phage(44.0%)	82	NA	NA
WP_001453698.1|2043425_2043635_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2043730_2044105_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2044110_2044827_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2044885_2045230_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2045226_2045673_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2045669_2046020_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126026.1|2046029_2046356_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	4.5e-53
WP_001063023.1|2048396_2048618_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000731239.1|2049161_2049569_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.2	1.3e-52
WP_000411805.1|2049573_2049780_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000023184.1|2050227_2052078_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|2052555_2052987_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2053437_2054151_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2054286_2054484_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2054708_2055263_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2055325_2055631_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2055643_2056693_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2056694_2056967_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2057088_2057433_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2057552_2057765_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2057998_2058556_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2058557_2058776_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2058903_2059215_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2059207_2059435_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2059431_2059713_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2059745_2060462_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|2060495_2060957_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|2060949_2061993_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|2062061_2062487_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2062470_2062713_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2063104_2063443_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2063735_2063888_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2063899_2064538_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2064538_2064748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2065312_2065501_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2065497_2065686_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|2065778_2067023_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_016241229.1|2067661_2067976_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|2068938_2069319_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2069315_2069663_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001121225.1|2071834_2072485_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001023362.1|2073016_2073286_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268960.1|2073287_2074511_-|tail	tail fiber protein	tail	A0A0P0ZDE7	Stx2-converting_phage	98.5	4.3e-80
WP_001230508.1|2074575_2075175_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001304111.1|2075242_2075458_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_012779365.1|2075460_2078721_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.3	0.0e+00
WP_024748472.1|2078908_2079346_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	100.0	5.0e-63
WP_000807950.1|2079345_2079687_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_153983949.1|2079679_2082922_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_001453698.1|2082973_2083183_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_075841806.1|2083278_2083674_-|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	9.1e-64
WP_001275508.1|2083657_2084374_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2084432_2084777_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2084773_2085220_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007901.1|2085216_2085567_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_001301679.1|2085983_2088485_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.2	0.0e+00
WP_001063099.1|2088430_2088652_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|2088696_2090634_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_153983965.1|2090630_2092349_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.6	0.0e+00
WP_000958416.1|2092354_2092918_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279796.1|2093209_2093575_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|2093616_2093844_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2094268_2094454_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2094681_2094828_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2094827_2095397_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2095667_2096201_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731241.1|2096251_2096596_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000411805.1|2096600_2096807_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000023202.1|2097255_2099106_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_001303509.1|2099584_2100013_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|2100650_2101340_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|2101336_2101696_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|2101708_2102758_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|2102759_2103038_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|2103205_2103418_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|2103606_2103711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|2103826_2104411_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|2104467_2104863_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788938.1|2105673_2106414_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095669.1|2106420_2107383_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000693943.1|2107405_2107831_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|2107827_2108130_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 9
NZ_CP035545	Escherichia coli strain FSIS11705876 chromosome, complete genome	5483434	2423008	2475231	5483434	tail,transposase,integrase,tRNA	Enterobacteria_phage(60.0%)	59	2416232:2416247	2475521:2475536
2416232:2416247	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|2423008_2424742_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|2424918_2425407_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|2425526_2425919_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|2425918_2427997_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|2427989_2429138_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|2429339_2429984_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2429994_2430384_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|2430398_2431448_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|2431450_2432311_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|2432329_2433931_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|2433976_2435638_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|2435780_2436284_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|2436304_2438269_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|2438273_2439200_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|2439196_2440084_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2440210_2440789_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|2440791_2441142_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|2441921_2442350_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_000089029.1|2442356_2443781_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|2443755_2444556_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000987892.1|2444722_2445712_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|2445723_2447238_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|2447307_2448297_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179461.1|2449093_2449597_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|2449676_2449928_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2450041_2450128_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|2450389_2450713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|2450883_2451381_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2451417_2451657_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|2451848_2453060_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2453121_2453787_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001300279.1|2454143_2455145_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|2455150_2455498_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|2455527_2456178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2456193_2456598_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|2456687_2456825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|2456896_2457100_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|2457121_2457472_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|2457482_2457761_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|2457772_2458015_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|2458011_2458125_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|2458217_2458634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2458657_2458861_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|2458857_2459124_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|2459120_2459420_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001310314.1|2459431_2460049_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000599379.1|2460045_2460411_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|2460417_2463240_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|2463316_2464276_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|2464280_2464595_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000257965.1|2465800_2466217_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000954203.1|2466260_2466833_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|2466989_2467478_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000763327.1|2470280_2470409_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665314.1|2470444_2470810_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|2470864_2471377_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|2471376_2472561_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|2472718_2473042_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_085952195.1|2474018_2475231_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
2475521:2475536	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 10
NZ_CP035545	Escherichia coli strain FSIS11705876 chromosome, complete genome	5483434	2533022	2603598	5483434	holin,tail,head,terminase,integrase,transposase	Escherichia_phage(38.1%)	66	2555814:2555873	2603593:2604902
WP_001023407.1|2533022_2533292_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268981.1|2533293_2534607_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
WP_000514965.1|2535337_2538817_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.8	0.0e+00
WP_072147834.1|2539057_2539687_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000194798.1|2539632_2540376_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001301816.1|2540386_2541085_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000847298.1|2541084_2541414_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032339796.1|2541410_2543990_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000533402.1|2543970_2544384_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|2544410_2544842_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_001301534.1|2545577_2545844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|2545901_2546249_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000259002.1|2549371_2549578_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|2551462_2551972_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|2552366_2552591_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|2552672_2552987_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2553513_2553699_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|2553926_2554058_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|2554070_2554253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|2554408_2554942_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|2554992_2555337_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000411809.1|2555341_2555548_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
2555814:2555873	attL	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_085948178.1|2555867_2557080_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000023257.1|2557162_2559013_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001303558.1|2559490_2559919_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_001059369.1|2560552_2561242_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|2561238_2561598_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|2561610_2562660_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|2562661_2562940_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|2563107_2563320_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|2563506_2563611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|2563720_2564284_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|2564410_2564722_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|2564718_2564871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|2564903_2565260_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|2565256_2565481_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|2565502_2566201_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_072143023.1|2566235_2566778_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_001262409.1|2566689_2567727_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|2567795_2568221_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|2568217_2568445_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|2568542_2569187_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|2569461_2569614_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|2570094_2570283_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|2570279_2570468_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_153983953.1|2571580_2571925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000603400.1|2574115_2574346_+	endodeoxyribonuclease	NA	K7PLW7	Enterobacteria_phage	65.3	8.5e-22
WP_000094838.1|2574404_2574608_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533601.1|2574607_2575687_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.2e-99
WP_001302302.1|2575878_2576676_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_134793145.1|2577165_2585148_+	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_000480501.1|2585409_2586462_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|2586775_2588092_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|2588193_2589648_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|2589990_2590707_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|2591332_2592976_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|2593093_2594044_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|2594145_2595063_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986334.1|2595519_2596455_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|2596516_2597596_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2597607_2598351_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|2598347_2598893_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171540.1|2599254_2599635_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2599631_2599979_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2600028_2601567_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_085948178.1|2602384_2603598_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
2603593:2604902	attR	AGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCAGATATATTCTGATATACTCCTTTTGCTAGACATAACCTTTCACCTGCTTGCAAAGCTTCTGTGTTCTGACATTGCCAAATTGTTGCAATTCTGTATCCAGCCTTCTTTCAGTCATAGCTTCGGGCCGCGATAAGACTCACTGATCTGACCCTGATTCCTCTTGCAGACTTTATAGACCAATTAAAATGCAGTTTCTGCAGGTCAACGTCTGACCATCATTGTCATCACTCTGGCCATTAGAGTAACCTTCTGCATTCATCCTTTTGTAAAAAGTTTATATTAGTATCAGCAATTAACCGGACCTGATACTGATATGAGTCTTACCGCATATACGGTCAATTTCAGCAATTAATTACATTATCCACGCCAAAGTATTTGTCATCACAATGATGGTACCTTCTTTCAGACACCATTTTTTCAACTCCGTTTTCCACGGACCGCACTCTTATGTCAAGAGTGCGGTCCGTGGATACAACCAGAGACCGACTGACACGAGTCAGAGGAAACGACGGATATGTTCAGTCGTAAAATATCTATCAAAAAACATGATTAAGGTCAAAAATGTTTGATATTTACAATTTATGAAGATGACAATAATTATAGATATATGAGAACATAAATGAAAATAATTATCATTACAGCAATCATTTGTACTTTGTATTAATGAGGGATGAAATGTTATATAATATACCTTGTCGAATTTATATCCTTTCCACTCTGTCATTATGCATTTCTGGGATAGTTTCTACTGCAACCGCAACTTCTTCAGAAACAAAAATCAGCAACGAAGAGACGCTCGTCGTGACCACGAATCGTTCGGCAAGCAACCTTTGGGAAAGCCCGGCGACTATACAGGTTATTGACCAACAAACATTGCAGAACTCCACCAATGCCTCCATAGCCGATAATTTGCAGGACATCCCCGGAGTAGAGATAACAGACAACTCCTTGGCAGGCCGTAAACAAATCCGCATTCGTGGCGAAGCATCCTCCCGTGTTTTAATTCTCATTGATGGTCAGGAGGTAACTTATCAGCGCGCCGGAGATAATTATGGTGTGGGACTGTTGATAGATGAGTCTGCGCTGGAGCGTGTTGAGGTAGTGAAAGGTCCATATTCCGTACTGTACGGTTCACAGGCAATTGGCGGTATTGTTAACTTCATCACCAAAAAGGGAGGTGACAAACTTGCATCTGGAGTTGTGAAAGCTGTTTATAATTCCGCAACAGCAGGCTGGGAAGAATCAATCGC	NA	NA	NA	NA
>prophage 11
NZ_CP035545	Escherichia coli strain FSIS11705876 chromosome, complete genome	5483434	2617545	2675952	5483434	holin,lysis,protease,tail,integrase,head,terminase,capsid,transposase	Stx2-converting_phage(50.67%)	75	2631264:2631279	2679015:2679030
WP_001303036.1|2617545_2618712_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001121226.1|2620035_2620686_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_000458686.1|2620909_2621785_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	3.2e-162
WP_001023455.1|2621925_2622195_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000268851.1|2622196_2623510_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	99.1	2.0e-83
WP_001230514.1|2623574_2624174_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_153983954.1|2624241_2627721_-	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	96.6	0.0e+00
WP_122994717.1|2627959_2628592_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	99.0	3.1e-106
WP_000967278.1|2628537_2629275_-|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	3.8e-148
WP_001414206.1|2629329_2630253_-	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	99.3	3.2e-176
WP_001154345.1|2630323_2630497_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|2630604_2630925_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
2631264:2631279	attL	TTTTTTTATTCTTTTT	NA	NA	NA	NA
WP_000807954.1|2631667_2632009_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212922.1|2632001_2635244_-|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.7	0.0e+00
WP_001453698.1|2635295_2635505_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2635600_2635975_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2635980_2636697_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2636755_2637100_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2637096_2637543_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007901.1|2637539_2637890_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2637899_2638226_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001063099.1|2640751_2640973_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|2641017_2642955_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301438.1|2643018_2644680_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|2644676_2645240_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279796.1|2645531_2645897_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001283921.1|2646627_2646885_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|2646881_2647379_-	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092318.1|2647581_2648019_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000075132.1|2648015_2648513_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000284515.1|2648512_2648728_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001290231.1|2648804_2649077_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|2649117_2649297_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000143110.1|2649433_2651371_-	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.4	0.0e+00
WP_001303568.1|2651614_2651938_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000738080.1|2652234_2652504_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_000649751.1|2652515_2653475_-	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000512807.1|2654124_2654613_-	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_001028858.1|2654603_2655275_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_001108004.1|2655271_2655877_-	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001004016.1|2655876_2656599_-	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_000849633.1|2656673_2657354_-	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	1.1e-128
WP_000208502.1|2657609_2658368_-	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	100.0	2.0e-115
WP_001254256.1|2658642_2658825_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|2658821_2659349_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001303571.1|2659345_2659792_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|2659748_2659985_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|2659995_2660211_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|2660343_2660622_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_001248388.1|2660692_2662069_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_000539354.1|2662065_2662887_-	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_000442612.1|2663067_2663364_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000067727.1|2663505_2663721_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2663796_2664492_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|2664993_2665515_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|2666083_2666266_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|2666243_2666516_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394299.1|2666574_2666826_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000065362.1|2667008_2667377_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|2667449_2667614_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|2667582_2667726_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|2667800_2668097_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001301718.1|2668102_2668888_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	99.6	2.4e-148
WP_085948178.1|2669182_2670396_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000682306.1|2670874_2671057_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548544.1|2671029_2671221_+	DUF1382 family protein	NA	B6ETA2	Enterobacteria_phage	100.0	3.3e-27
WP_001444000.1|2671231_2671513_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|2671611_2671833_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289930.1|2671829_2672777_+	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_001356547.1|2672778_2672955_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|2673288_2673645_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610373.1|2673641_2673992_+	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001281188.1|2674179_2674524_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000132739.1|2674601_2674793_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001007946.1|2674773_2675952_-|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
2679015:2679030	attR	AAAAAGAATAAAAAAA	NA	NA	NA	NA
>prophage 12
NZ_CP035545	Escherichia coli strain FSIS11705876 chromosome, complete genome	5483434	2759176	2797240	5483434	holin,lysis,tail,integrase,tRNA,head,portal,terminase,capsid,plate	Escherichia_phage(62.79%)	48	2763476:2763503	2795433:2795460
WP_000675144.1|2759176_2760580_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137884.1|2760576_2761299_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_001301848.1|2761489_2761822_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|2761969_2763331_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
2763476:2763503	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2763604_2763823_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882933.1|2763904_2765068_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000978913.1|2765067_2765547_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000069957.1|2765561_2768009_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_001496926.1|2768001_2768121_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_001031303.1|2768153_2768429_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2768485_2769004_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286706.1|2769016_2770207_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	6.9e-224
WP_000905094.1|2770266_2770860_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001008233.1|2771318_2771762_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_001057694.1|2771733_2772336_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_000217052.1|2772335_2773655_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.5	1.2e-179
WP_001285352.1|2773651_2774263_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_001121479.1|2774255_2775164_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_000127154.1|2775168_2775516_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001093728.1|2775512_2776148_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_001001810.1|2776214_2776667_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	97.3	2.2e-74
WP_000917144.1|2776659_2777127_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001300730.1|2777089_2777263_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000040644.1|2777234_2777660_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_000736555.1|2777647_2778073_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_001144101.1|2778087_2778585_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|2778584_2778866_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846406.1|2778869_2779073_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000988633.1|2779072_2779582_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203418.1|2779681_2780425_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_001248594.1|2780428_2781502_-|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_001085952.1|2781560_2782415_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_000156848.1|2782588_2784361_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_000038161.1|2784360_2785395_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000844437.1|2785712_2787680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302413.1|2787679_2788132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000063136.1|2788178_2789402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268574.1|2789491_2791774_-	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
WP_000027664.1|2791763_2792039_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113265.1|2792035_2792260_-	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_001277898.1|2792262_2792562_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557698.1|2792561_2792786_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_000217670.1|2792849_2793350_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001081582.1|2793527_2793803_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|2793924_2794224_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985260.1|2794339_2795353_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001303579.1|2795617_2795935_-	hypothetical protein	NA	NA	NA	NA	NA
2795433:2795460	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2796340_2797240_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 13
NZ_CP035545	Escherichia coli strain FSIS11705876 chromosome, complete genome	5483434	2822877	2898254	5483434	holin,protease,tail,tRNA,portal,terminase,transposase	Enterobacteria_phage(52.24%)	82	NA	NA
WP_001301615.1|2822877_2824911_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001411921.1|2828873_2830154_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_122989774.1|2830317_2831859_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000356841.1|2831868_2835498_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|2835559_2835877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|2837117_2838206_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|2838216_2839746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528952.1|2839764_2840496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301655.1|2840488_2841625_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|2841621_2843625_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|2843749_2844211_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2844252_2844723_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2844769_2845489_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|2845485_2847171_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_001261937.1|2847685_2847934_+	DinI family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001023381.1|2848301_2848571_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_000268872.1|2848572_2849886_-|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.5	2.2e-77
WP_001228302.1|2849950_2850550_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	99.5	1.3e-109
WP_072147834.1|2854330_2854960_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_001301816.1|2855658_2856357_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000847298.1|2856356_2856686_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000438877.1|2859370_2859679_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000479043.1|2859705_2860128_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|2860141_2860894_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2860901_2861300_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|2861312_2861936_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2861938_2862220_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2862212_2862539_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|2862626_2864651_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|2864595_2866098_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102414.1|2866097_2866310_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_001077625.1|2866306_2868430_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|2868426_2868903_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_012816791.1|2869420_2869606_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2869833_2869980_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2869979_2870549_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|2870819_2871353_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|2871357_2871573_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|2871650_2871896_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2871936_2872116_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142932.1|2872252_2874199_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_001356551.1|2875002_2875155_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204769.1|2875406_2875841_-	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000971055.1|2875926_2876067_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|2876063_2876426_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774488.1|2876422_2876713_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000224916.1|2876705_2876876_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_001054341.1|2876875_2877331_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
WP_001303586.1|2877327_2877429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|2877545_2878343_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001302427.1|2878352_2878904_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_153983955.1|2879368_2880895_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	1.0e-30
WP_032102575.1|2880952_2881060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070451.1|2881151_2881484_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|2881551_2881854_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_085948178.1|2882342_2883555_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001415640.1|2883861_2884791_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	3.6e-111
WP_001182899.1|2884877_2885417_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067457.1|2885486_2885717_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	69.3	3.8e-22
WP_000858974.1|2885821_2886511_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000380252.1|2886591_2887653_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000866321.1|2887630_2888008_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000233576.1|2888488_2888695_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|2888770_2889067_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|2889072_2889858_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|2889854_2890532_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|2890531_2890714_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|2890686_2890878_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|2890888_2891170_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|2891268_2891490_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|2891486_2892434_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001356547.1|2892435_2892612_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|2892945_2893302_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|2893298_2893661_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|2893748_2893991_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556581.1|2893994_2894129_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	1.4e-21
WP_001193437.1|2894147_2894402_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_153983956.1|2894435_2895722_+	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	99.8	3.8e-252
WP_027868261.1|2895742_2896444_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_001216963.1|2896503_2896611_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2896591_2897323_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|2897327_2898254_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 14
NZ_CP035545	Escherichia coli strain FSIS11705876 chromosome, complete genome	5483434	3113241	3211606	5483434	holin,lysis,protease,tail,integrase,tRNA,portal,terminase,capsid,transposase	Escherichia_phage(43.48%)	118	3134415:3134431	3208634:3208650
WP_001283590.1|3113241_3114054_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289184.1|3114053_3115067_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699109.1|3115132_3116269_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	3.1e-24
WP_000615802.1|3116367_3117363_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127753.1|3117359_3118538_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817183.1|3118812_3120033_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683769.1|3120191_3122198_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|3122318_3122597_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089225.1|3122630_3123179_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|3123178_3123988_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043834.1|3123987_3124812_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001297933.1|3124815_3125901_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001302029.1|3125935_3126868_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730817.1|3127033_3127585_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001301548.1|3127755_3128598_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000794741.1|3128599_3129121_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000822672.1|3129117_3129588_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000675435.1|3129584_3130085_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000182852.1|3130095_3130854_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112844.1|3130876_3133516_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000033336.1|3133597_3134161_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
3134415:3134431	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_001195817.1|3134806_3135292_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426146.1|3135494_3137639_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531969.1|3137638_3138949_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|3139128_3139413_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001301981.1|3139784_3141125_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000952959.1|3141489_3142521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|3142915_3143671_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|3143964_3144897_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000331680.1|3145118_3153494_-	hypothetical protein	NA	A0A0P0ZCC7	Stx2-converting_phage	100.0	0.0e+00
WP_000012445.1|3153562_3154828_-	hypothetical protein	NA	A0A0P0ZD72	Stx2-converting_phage	100.0	4.4e-229
WP_000540400.1|3154838_3155132_-	hypothetical protein	NA	A0A0P0ZDW9	Stx2-converting_phage	100.0	4.1e-13
WP_000455652.1|3155141_3155588_-	hypothetical protein	NA	V5UT82	Shigella_phage	100.0	1.1e-76
WP_000509483.1|3155590_3156247_-	hypothetical protein	NA	A0A0P0ZCM5	Stx2-converting_phage	100.0	5.1e-104
WP_000035557.1|3156341_3156743_-	hypothetical protein	NA	A0A088CC37	Shigella_phage	100.0	1.2e-71
WP_000078907.1|3156799_3156940_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835361.1|3157170_3157905_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZH34	Escherichia_phage	100.0	9.7e-136
WP_001301884.1|3157995_3158613_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455635.1|3158618_3158897_-	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_000197192.1|3158911_3160180_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146323.1|3160176_3161802_-	hypothetical protein	NA	A0A0P0ZDC2	Stx2-converting_phage	100.0	0.0e+00
WP_001303606.1|3162096_3162285_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001023381.1|3162423_3162693_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_153983957.1|3162694_3164632_-|tail	phage tail protein	tail	A0A0P0ZCY7	Stx2-converting_phage	100.0	1.1e-64
WP_000207923.1|3164628_3165279_-	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
WP_000829200.1|3165278_3165842_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|3165825_3166287_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|3166336_3166726_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|3166781_3167996_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000994870.1|3168019_3168436_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.6e-69
WP_085948178.1|3168566_3169779_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000787025.1|3170497_3172642_-|portal	portal protein	portal	A0A0P0ZBZ2	Stx2-converting_phage	100.0	0.0e+00
WP_000143988.1|3172641_3174348_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|3174328_3175135_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_000738505.1|3175543_3175837_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001082654.1|3175868_3176333_-|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000455406.1|3176340_3176490_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_021498968.1|3176489_3177059_-	antirepressor protein	NA	A0A1I9LJR6	Stx_converting_phage	98.4	1.5e-104
WP_021498969.1|3177329_3177863_-	lysozyme	NA	A0A088CC28	Shigella_phage	98.3	1.9e-101
WP_000284506.1|3177867_3178083_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290212.1|3178159_3178432_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143458.1|3178472_3178652_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874499.1|3178786_3180724_-	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	100.0	0.0e+00
WP_000738068.1|3181210_3181480_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3181491_3182451_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001204880.1|3183232_3183667_-	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000144764.1|3183659_3183854_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107963.1|3183850_3184456_-	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_001292288.1|3184455_3185178_-	DNA-binding protein	NA	A0A0P0ZCJ8	Stx2-converting_phage	100.0	5.4e-131
WP_001563210.1|3185170_3185380_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	1.4e-31
WP_000924600.1|3185339_3185741_-	hypothetical protein	NA	G9L690	Escherichia_phage	100.0	1.4e-72
WP_000201603.1|3185815_3186490_-	phage antirepressor Ant	NA	G9L689	Escherichia_phage	100.0	1.6e-129
WP_001254258.1|3186746_3186941_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	2.9e-31
WP_000153301.1|3186937_3187465_-	phage N-6-adenine-methyltransferase	NA	A0A0N7KZD1	Stx2-converting_phage	100.0	7.3e-101
WP_000573864.1|3187461_3188064_-	endonuclease	NA	G9L687	Escherichia_phage	100.0	1.7e-114
WP_001229012.1|3188056_3188473_-	NinB protein	NA	G9L686	Escherichia_phage	100.0	3.9e-73
WP_000103680.1|3188646_3188862_-	hypothetical protein	NA	G9L684	Escherichia_phage	100.0	2.2e-32
WP_001000130.1|3188994_3189273_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000145935.1|3189343_3189634_-	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_000788871.1|3189630_3190332_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	100.0	3.4e-130
WP_000185456.1|3190328_3191267_-	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000438489.1|3191299_3191596_-	hypothetical protein	NA	A0A0N7KZD0	Stx2-converting_phage	100.0	5.2e-48
WP_001180318.1|3191734_3191962_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|3192040_3192748_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885202.1|3192808_3193150_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	100.0	5.1e-63
WP_001221210.1|3193217_3193679_+	hypothetical protein	NA	A0A0P0ZD85	Stx2-converting_phage	100.0	1.7e-77
WP_000957426.1|3193672_3194719_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_000198444.1|3195374_3195758_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000167595.1|3195816_3196287_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065487.1|3196437_3196806_+	DUF2528 family protein	NA	A0A0P0ZCC3	Stx2-converting_phage	100.0	4.5e-65
WP_001198861.1|3196878_3197043_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372940.1|3197011_3197176_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	100.0	1.9e-23
WP_000995464.1|3197230_3197527_+	host-nuclease inhibitor protein Gam	NA	A0A0P0ZCL3	Stx2-converting_phage	100.0	2.1e-49
WP_000100845.1|3197532_3198318_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000186866.1|3198314_3198995_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	100.0	2.1e-132
WP_000682315.1|3198991_3199174_+	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	100.0	9.7e-29
WP_000548531.1|3199146_3199338_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001447493.1|3199348_3199630_+	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	100.0	3.2e-47
WP_000774248.1|3199728_3199950_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001289942.1|3199946_3200894_+	ead/Ea22-like family protein	NA	A0A0P0ZDS3	Stx2-converting_phage	100.0	2.1e-183
WP_001301469.1|3200895_3201402_+	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	100.0	4.2e-90
WP_001301947.1|3201361_3201577_+	hypothetical protein	NA	A0A0N7C076	Escherichia_phage	100.0	7.9e-38
WP_001142590.1|3201578_3201797_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000212746.1|3201798_3202086_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_000206751.1|3202089_3202707_+	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	7.7e-118
WP_000376712.1|3202706_3202991_+	DUF4752 family protein	NA	A0A0N7KZC7	Stx2-converting_phage	100.0	4.5e-49
WP_000203836.1|3203346_3203970_+	phage antirepressor Ant	NA	A0A0P0ZAZ7	Stx2-converting_phage	100.0	1.7e-112
WP_000669287.1|3204012_3204180_+	hypothetical protein	NA	A0A0P0ZCR2	Stx2-converting_phage	100.0	2.9e-27
WP_000163444.1|3204406_3205033_+	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
WP_001291844.1|3204992_3205205_+	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_000994803.1|3205240_3205618_+	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	100.0	2.0e-52
WP_000453637.1|3205696_3205879_+	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_001218308.1|3205862_3207032_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_000958700.1|3207463_3208621_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3208795_3209932_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3208634:3208650	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|3209941_3210622_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3210608_3211076_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_001005794.1|3211075_3211606_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
>prophage 15
NZ_CP035545	Escherichia coli strain FSIS11705876 chromosome, complete genome	5483434	3446720	3505629	5483434	tail,transposase,tRNA,holin	Enterobacteria_phage(29.17%)	60	NA	NA
WP_000083666.1|3446720_3447458_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|3447589_3448924_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001383425.1|3448956_3449838_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189215.1|3449940_3450528_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3450583_3450967_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262720.1|3451271_3451961_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	3.5e-55
WP_000997403.1|3452008_3453046_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3453252_3453672_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|3453740_3454439_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082974.1|3454470_3457131_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949250.1|3457244_3458600_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000464871.1|3458624_3458969_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852126.1|3458965_3460264_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001235102.1|3466043_3468617_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040152.1|3468746_3469478_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079092.1|3469474_3470455_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3470589_3471327_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3471597_3471939_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3472042_3472090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200120.1|3472188_3473349_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|3473391_3474513_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168032.1|3474523_3475594_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001301878.1|3475803_3476169_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3476318_3476837_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969012.1|3476826_3478053_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589827.1|3478068_3478551_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3478627_3478975_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3479016_3479784_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3479814_3480363_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3480381_3480630_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3480766_3482128_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001189257.1|3482219_3483086_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_001301442.1|3484447_3485041_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059175.1|3485163_3486042_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880923.1|3486127_3487789_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3487937_3488279_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117844.1|3488340_3488631_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3488620_3489097_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3489228_3489711_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|3490556_3490805_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|3491306_3491897_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|3492079_3492730_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|3492808_3493867_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|3493996_3494419_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|3494579_3494849_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000165061.1|3495066_3495393_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
WP_001299612.1|3495389_3496280_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
WP_000998000.1|3496086_3496731_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.8e-69
WP_000612591.1|3496780_3497128_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3497124_3497505_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|3497861_3498206_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|3498210_3498426_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143065.1|3498575_3500429_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000499458.1|3500836_3501004_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3501089_3501833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3502085_3502709_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|3502705_3503371_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|3503367_3503979_-	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001108081.1|3503953_3504520_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001254939.1|3504873_3505629_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP035545	Escherichia coli strain FSIS11705876 chromosome, complete genome	5483434	5090778	5105443	5483434	tail,integrase,tRNA	Enterobacteria_phage(40.0%)	18	5092059:5092074	5109588:5109603
WP_000956557.1|5090778_5091312_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_001093918.1|5091729_5092011_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5092059:5092074	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|5092355_5092553_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|5092888_5093173_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|5093169_5093520_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|5093510_5094047_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230514.1|5095368_5095968_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000268945.1|5096032_5097346_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001023355.1|5097347_5097617_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|5097728_5098301_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|5098373_5099003_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|5099084_5099726_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|5099886_5100135_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|5100196_5101294_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543818.1|5101382_5102420_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|5102553_5102796_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|5102961_5103945_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918366.1|5104027_5105443_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
5109588:5109603	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 17
NZ_CP035545	Escherichia coli strain FSIS11705876 chromosome, complete genome	5483434	5242322	5301333	5483434	transposase,protease	Pectobacterium_phage(12.5%)	60	NA	NA
WP_000312488.1|5242322_5243582_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|5243584_5244589_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|5244670_5244868_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|5244971_5246270_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177633.1|5246474_5246900_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076303.1|5246938_5249380_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001293282.1|5249560_5250292_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|5250418_5250820_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511966.1|5250838_5251537_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012572.1|5251587_5252247_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|5252264_5252663_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|5252672_5253311_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943960.1|5253313_5254477_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_001301849.1|5254560_5256186_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|5256302_5256578_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254630.1|5256726_5257056_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569696.1|5257237_5257987_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|5257983_5258739_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|5258846_5259911_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001301921.1|5260265_5261663_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|5261678_5261984_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776517.1|5261993_5262458_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|5262471_5263122_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949515.1|5263131_5263986_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|5263985_5264672_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|5264800_5265076_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|5265402_5265798_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|5265804_5266119_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|5266123_5266351_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|5266392_5266842_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001301745.1|5266912_5267707_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604943.1|5268329_5268761_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_000826431.1|5268768_5269977_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_001119481.1|5270111_5270750_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|5270967_5271588_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|5271896_5273309_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331454.1|5273353_5274016_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001301505.1|5274123_5275089_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560631.1|5275196_5276057_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|5276145_5276526_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589487.1|5276643_5278587_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886884.1|5278776_5279517_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000937659.1|5279728_5280667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175287.1|5280729_5281284_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|5281608_5281815_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|5281893_5283237_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301936.1|5283559_5284198_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|5284403_5286137_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060930.1|5286133_5289913_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|5289915_5290257_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223210.1|5290468_5290720_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|5290713_5291064_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|5291143_5291674_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265942.1|5291983_5292940_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_001301928.1|5294595_5295618_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|5295604_5296600_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853749.1|5296632_5297631_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_001219792.1|5297806_5299180_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|5299335_5299887_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|5299980_5301333_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
