The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045945	Salmonella enterica subsp. enterica serovar Virchow strain AUSMDU00010533 chromosome, complete genome	4705038	1138451	1210738	4705038	plate,tail,head,capsid,portal,tRNA,integrase,lysis	Salmonella_phage(80.39%)	74	1147567:1147614	1181745:1181792
WP_021000674.1|1138451_1140785_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	84.5	0.0e+00
WP_000743150.1|1140799_1141120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001604623.1|1141116_1141344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023196289.1|1141340_1141892_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	8.6e-36
WP_021000671.1|1142692_1143430_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.4	4.4e-80
WP_000984211.1|1143426_1143672_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_023196288.1|1143688_1144255_+	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	62.7	4.5e-56
WP_023196287.1|1144662_1145556_+	DUF4747 family protein	NA	NA	NA	NA	NA
WP_021000667.1|1145723_1146161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023196286.1|1146191_1147385_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.4	8.2e-108
1147567:1147614	attL	ATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_001585446.1|1147731_1148757_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.9	4.0e-196
WP_001749755.1|1148760_1149393_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	56.7	1.5e-63
WP_023225961.1|1149512_1149761_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	70.7	8.9e-25
WP_115409013.1|1149793_1150303_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.3	1.0e-83
WP_000957775.1|1150310_1150544_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
WP_000166366.1|1150491_1150950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000963195.1|1151169_1151511_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
WP_001244234.1|1151578_1151812_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
WP_000785509.1|1151811_1152039_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
WP_001749757.1|1152035_1152893_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	80.4	2.7e-129
WP_154079387.1|1152883_1155295_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	96.0	0.0e+00
WP_001154443.1|1155451_1155640_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	6.1e-26
WP_001217581.1|1155651_1155885_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	94.8	4.4e-34
WP_023214651.1|1156264_1157185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023214652.1|1157177_1157918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080198083.1|1157947_1158994_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	95.9	8.5e-194
WP_154079388.1|1158993_1160760_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	97.8	0.0e+00
WP_154079389.1|1160902_1161736_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	94.9	5.0e-128
WP_154079390.1|1161752_1162817_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.6	6.0e-195
WP_154079391.1|1162820_1163471_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	99.1	2.4e-114
WP_154079392.1|1163564_1164029_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	7.1e-84
WP_000868184.1|1164028_1164232_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1164235_1164451_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_140043619.1|1164431_1164941_+	glycoside hydrolase family protein	NA	A0A1S6KZY9	Salmonella_phage	98.2	6.4e-94
WP_000731036.1|1164945_1165323_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	100.0	8.1e-62
WP_001655639.1|1165322_1165748_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	99.3	3.8e-68
WP_001039961.1|1165843_1166275_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_023232918.1|1166267_1166714_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	91.1	7.6e-67
WP_000993749.1|1166782_1167361_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
WP_154079393.1|1167357_1167717_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	95.0	1.5e-57
WP_058215526.1|1167703_1168612_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	99.7	5.9e-159
WP_021293749.1|1168604_1169210_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	100.0	2.6e-118
WP_154079394.1|1169206_1171135_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	64.6	5.8e-212
WP_000972188.1|1171137_1171677_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	99.4	8.5e-97
WP_077947440.1|1171680_1172298_-|tail	phage tail protein	tail	A0A1S6KZY8	Salmonella_phage	99.5	2.2e-112
WP_154079395.1|1172267_1173257_-|tail	phage tail protein	tail	A0A1S6KZZ0	Salmonella_phage	99.4	1.5e-192
WP_058215523.1|1173286_1173844_+	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	98.4	6.1e-98
WP_154079396.1|1173946_1175119_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	2.2e-222
WP_154079397.1|1175128_1175644_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	98.8	1.8e-91
WP_001280962.1|1175698_1176001_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_000763316.1|1176015_1176135_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_154079398.1|1176127_1178938_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	96.6	0.0e+00
WP_154079399.1|1178934_1179420_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	96.9	9.1e-66
WP_154079400.1|1179416_1180517_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	92.9	7.1e-191
WP_000972388.1|1180583_1180802_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	76.4	8.3e-27
WP_063917151.1|1181086_1181677_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	76.7	2.3e-47
WP_072104906.1|1182181_1183345_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1181745:1181792	attR	ATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000196142.1|1183352_1185533_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533864.1|1185529_1186939_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001237687.1|1187003_1198478_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1199092_1199575_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1199724_1200201_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1200190_1200481_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1200646_1200985_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1201133_1202795_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059160.1|1202880_1203759_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1203882_1204473_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001294016.1|1204507_1205113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1205233_1206520_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1206539_1207331_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1207496_1208858_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1209110_1209359_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1209377_1209926_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469807.1|1209970_1210738_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP045945	Salmonella enterica subsp. enterica serovar Virchow strain AUSMDU00010533 chromosome, complete genome	4705038	1701351	1710522	4705038	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1701351_1702299_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1702282_1703014_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001216964.1|1702994_1703102_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1703161_1703893_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1704115_1705801_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1705797_1706517_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950421.1|1706563_1707031_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_001265356.1|1707087_1707618_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1707789_1708248_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195334.1|1708488_1710522_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 3
NZ_CP045945	Salmonella enterica subsp. enterica serovar Virchow strain AUSMDU00010533 chromosome, complete genome	4705038	1871625	1882209	4705038		Morganella_phage(25.0%)	12	NA	NA
WP_001219015.1|1871625_1872099_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_021000459.1|1872745_1873036_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	3.0e-08
WP_000598920.1|1873407_1874205_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001537372.1|1874685_1874847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1874973_1875393_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|1875395_1876664_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|1877118_1877331_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1877341_1877530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080668.1|1877790_1878969_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	6.6e-110
WP_000107435.1|1879618_1879930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377039.1|1880009_1880705_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.2	2.8e-07
WP_001157307.1|1880778_1882209_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 4
NZ_CP045945	Salmonella enterica subsp. enterica serovar Virchow strain AUSMDU00010533 chromosome, complete genome	4705038	2787333	2887739	4705038	protease,transposase,capsid,head,tail,portal,terminase,tRNA,holin,integrase,lysis	Salmonella_phage(33.96%)	97	2811426:2811445	2884812:2884831
WP_023196027.1|2787333_2788014_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	66.8	1.5e-74
WP_000374046.1|2788633_2789293_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|2789379_2789709_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2789705_2789987_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|2790035_2790815_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2790840_2791389_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2791603_2792815_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2792872_2793190_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|2793234_2793651_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2793821_2794484_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2794578_2795037_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420519.1|2795072_2797127_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2797250_2797697_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950861.1|2797715_2799869_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2799855_2800461_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2800677_2801187_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001670727.1|2801543_2802596_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2802667_2803120_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156457.1|2803305_2805066_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2805134_2805653_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2805752_2805920_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2806175_2806739_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|2806735_2808376_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2808380_2809634_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053051.1|2809648_2811556_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	5.4e-53
2811426:2811445	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086482.1|2811568_2813677_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224077.1|2813775_2814885_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2814881_2815424_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2815589_2816600_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193779.1|2816807_2819420_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	3.7e-20
WP_024133401.1|2819927_2820353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343758.1|2820349_2821570_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_000388788.1|2821789_2822008_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	89.7	1.7e-24
WP_000161705.1|2822220_2822943_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000143158.1|2823139_2823721_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.4	1.8e-92
WP_031618324.1|2823710_2824031_-	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	79.2	4.9e-44
WP_001537328.1|2824531_2826970_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.0	6.0e-89
WP_000178851.1|2827023_2827266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001537444.1|2827304_2830667_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	80.4	0.0e+00
WP_023196420.1|2830729_2831377_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	1.2e-89
WP_000662740.1|2831274_2832012_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	1.2e-128
WP_001152690.1|2832018_2832717_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	9.3e-104
WP_000447369.1|2832726_2833056_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372071.1|2833058_2836100_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	64.6	2.3e-292
WP_010989052.1|2836071_2836410_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_023260076.1|2836406_2836802_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	55.7	1.5e-29
WP_000971954.1|2836852_2837599_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033882.1|2837606_2838008_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	99.0	1.4e-51
WP_000817263.1|2838116_2839247_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2839295_2839874_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2839901_2840285_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2840295_2840655_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2840712_2841741_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2841795_2842143_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189496.1|2842155_2843652_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.9	7.4e-98
WP_000831820.1|2843641_2845222_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	1.2e-188
WP_000201415.1|2845218_2845422_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623092.1|2845405_2847337_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
WP_001102153.1|2847308_2847854_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669693.1|2848139_2848541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024133404.1|2848776_2849226_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	85.7	1.9e-57
WP_001005894.1|2849258_2849885_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	80.7	7.1e-95
WP_000781780.1|2849887_2850235_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	9.8e-46
WP_000993184.1|2850429_2851119_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	51.9	2.4e-59
WP_000801757.1|2851115_2851256_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096499.1|2851252_2851864_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	99.0	1.6e-91
WP_000929790.1|2852072_2852675_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_014343878.1|2852709_2852958_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2853074_2853308_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_001537422.1|2854668_2855364_-	replication protein 14	NA	G8C7U6	Escherichia_phage	47.4	5.3e-59
WP_000431315.1|2855360_2856278_-	replication protein	NA	A5VW95	Enterobacteria_phage	81.3	5.2e-54
WP_072208512.1|2856470_2856845_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	96.8	1.2e-62
WP_000992433.1|2856810_2857047_-	hypothetical protein	NA	A0A0M4QX15	Salmonella_phage	71.8	1.5e-26
WP_001230958.1|2857151_2857547_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	2.7e-47
WP_000097141.1|2857718_2858567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846936.1|2858563_2859370_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000373339.1|2859409_2859616_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	2.1e-16
WP_022742800.1|2860204_2860555_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	98.3	6.4e-61
WP_000014350.1|2860681_2863882_+	DNA breaking-rejoining protein	NA	S4TNL0	Salmonella_phage	78.7	0.0e+00
WP_077907589.1|2863844_2865002_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	2.1e-217
WP_001237031.1|2865044_2865284_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2865324_2865573_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262307.1|2865617_2866910_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000191406.1|2867104_2868307_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_020839440.1|2868387_2869821_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544848.1|2870066_2871281_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762343.1|2871597_2872059_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2872259_2873660_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977709.1|2874266_2875358_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000462652.1|2875542_2876733_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109471.1|2876794_2877442_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|2877469_2878018_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925896.1|2878277_2880125_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572749.1|2880469_2884936_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
2884812:2884831	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_000060025.1|2884935_2885640_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288829.1|2885620_2886943_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|2886935_2887739_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP045945	Salmonella enterica subsp. enterica serovar Virchow strain AUSMDU00010533 chromosome, complete genome	4705038	2937860	2946741	4705038	protease,transposase	Enterobacteria_phage(14.29%)	8	NA	NA
WP_086016038.1|2937860_2939115_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	4.8e-18
WP_001537332.1|2939428_2939806_+	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	41.0	5.3e-21
WP_001117984.1|2939967_2940165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2940377_2942654_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520787.1|2942684_2943005_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_000447499.1|2943328_2943550_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125873.1|2943679_2945626_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|2945622_2946741_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 6
NZ_CP045945	Salmonella enterica subsp. enterica serovar Virchow strain AUSMDU00010533 chromosome, complete genome	4705038	4300027	4347720	4705038	tail,plate,tRNA	Burkholderia_phage(36.36%)	50	NA	NA
WP_001182223.1|4300027_4301026_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039330.1|4301113_4302424_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4302670_4303186_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4303285_4303495_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001575282.1|4303516_4303630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128103.1|4303626_4304952_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4305130_4305739_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4305847_4306216_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4306386_4308807_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4308905_4309778_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4309791_4310289_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4310469_4311387_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973642.1|4311550_4312909_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4312997_4314107_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4314468_4315659_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382565.1|4315790_4317335_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4317349_4318240_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982750.1|4318405_4318816_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4318958_4321055_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977970.1|4321054_4321792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122017358.1|4321788_4322457_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4322490_4322733_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790029.1|4323176_4324826_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4325170_4326520_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4326650_4326998_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4327573_4327861_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270434.1|4327863_4328469_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	1.9e-60
WP_000777268.1|4328481_4328796_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	4.9e-20
WP_000449436.1|4328955_4329411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4329407_4329605_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729850.1|4329594_4331022_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.2e-193
WP_000907494.1|4331021_4331546_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003639.1|4331597_4331915_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4331874_4332003_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262486.1|4332099_4334454_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.9	4.0e-66
WP_000271425.1|4334453_4335407_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4335406_4335616_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818147.1|4335603_4336647_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.6	1.9e-76
WP_000679393.1|4336656_4337379_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|4337706_4338069_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703638.1|4338065_4338995_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.1	9.7e-149
WP_001095012.1|4338994_4340542_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	30.1	4.2e-48
WP_001093502.1|4340705_4341065_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	63.3	8.0e-35
WP_023196029.1|4341055_4342171_+	hypothetical protein	NA	Q6QI99	Burkholderia_phage	52.0	4.5e-100
WP_000359500.1|4342163_4342796_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368194.1|4342798_4344565_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	5.5e-52
WP_000170635.1|4344569_4345175_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084335.1|4345171_4345615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103111051.1|4345983_4346418_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000587738.1|4346991_4347720_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
