The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045947	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010530 chromosome, complete genome	4964749	1127483	1153273	4964749	transposase,integrase	Escherichia_phage(37.5%)	29	1127419:1127478	1152831:1153652
1127419:1127478	attL	ATGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
WP_001067855.1|1127483_1128188_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000173534.1|1129164_1129680_+	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	28.3	7.1e-08
WP_072104082.1|1129676_1130609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051119994.1|1130664_1131444_+	DNA repair protein	NA	NA	NA	NA	NA
WP_000429174.1|1131791_1132091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011011079.1|1132340_1132949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001352368.1|1133081_1134290_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000599533.1|1134655_1135861_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|1136304_1136625_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|1136617_1137004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001447544.1|1137011_1137698_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001322387.1|1137675_1138302_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001089068.1|1138380_1139586_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000429836.1|1140869_1141304_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|1141375_1141726_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732293.1|1141739_1142015_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|1142050_1142473_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|1142524_1144219_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|1144236_1144599_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|1144595_1144832_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|1144828_1145536_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935452.1|1145574_1146879_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|1146925_1147630_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|1148385_1149237_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|1149544_1150360_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|1150420_1151224_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|1151223_1152060_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|1152120_1152825_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001387387.1|1152871_1153273_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
1152831:1153652	attR	GCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCATATCAAGCGACTTCTCCTATCCCCTGGGAACACATCAATCTCACCGGAGAATATCGCTGGCCAAAGCCTTAGCGTAGGATTCCGCCCCTTCCCGCAAACGACCCCAAACAGGAAACGCAGCTGAAACGGGAAGCTCAACACCCACTGACGCATGGGTTGTTCAGGCAGTACTTCATCAACCAGCAAGGCGGCACTTTCGGCCATCCGCCGCGCCCCACAGCTCGGGCAGAAACCGCGACGCTTACAGCTGAAAGCGACCAGGTGCTCGGCGTGGCAAGACTCGCAGCGAACCCGTAGAAAGCCATGCTCCAGCCGCCCGCATTGGAGAAATTCTTCAAATTCCCGTTGCACATAGCCCGGCAATTCCTTTCCCTGCTCTGCCATAAGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCG	NA	NA	NA	NA
>prophage 2
NZ_CP045947	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010530 chromosome, complete genome	4964749	1233718	1309116	4964749	tail,tRNA,portal,protease,lysis,holin,transposase,head,capsid,integrase,terminase	Salmonella_phage(43.1%)	88	1225799:1225815	1314963:1314979
1225799:1225815	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997368.1|1233718_1234756_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1234871_1235561_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1235879_1236263_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1236324_1236912_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1237014_1237914_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1237931_1239266_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1239396_1240134_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|1240118_1241741_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1242004_1242169_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1242165_1242741_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1242772_1243423_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1243422_1244379_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1244375_1244855_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1245352_1246582_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|1246559_1246844_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1246884_1247124_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|1247166_1248324_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017125.1|1248286_1251214_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_001539619.1|1251340_1251691_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1251712_1251871_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001009037.1|1252269_1252674_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000869364.1|1252803_1253040_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001574095.1|1253005_1253380_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1253464_1254448_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1254450_1255200_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|1255210_1255558_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|1255554_1256079_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445792.1|1256078_1256552_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_001217666.1|1257416_1257656_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_001574100.1|1257645_1257951_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
WP_000929803.1|1257990_1258593_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001096550.1|1258801_1259413_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1259409_1259550_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1259546_1260224_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|1260496_1261060_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1261566_1261755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1261969_1262656_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1262931_1263261_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_015701345.1|1263244_1263697_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001533543.1|1263714_1264167_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1264402_1264804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1265090_1265636_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1265607_1267539_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1267522_1267726_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1267722_1269303_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1269292_1270789_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1270801_1271149_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1271203_1272232_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1272289_1272649_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|1272659_1273043_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1273070_1273649_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1273697_1274828_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1274936_1275338_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_077248250.1|1275345_1276092_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	1.9e-99
WP_000479607.1|1276142_1276538_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1276534_1276873_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372065.1|1276844_1279940_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_000447369.1|1279942_1280272_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1280281_1280980_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1280986_1281724_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1281621_1282269_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|1282330_1285693_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1285731_1285974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1286027_1288400_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1288396_1289221_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1289210_1289789_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1289885_1290113_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1290219_1290432_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_015701342.1|1290494_1290560_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_015589559.1|1291139_1291304_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1292016_1292154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1292638_1294132_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1294536_1296336_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1296352_1297327_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1297600_1298281_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1298277_1299183_+	GTPase Era	NA	NA	NA	NA	NA
WP_033567169.1|1299194_1299923_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1299934_1300666_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1300665_1301046_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1301157_1301418_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1301455_1302382_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276365.1|1302497_1303694_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684027.1|1303715_1304633_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1304671_1305520_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1305635_1306529_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1306539_1307901_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000253558.1|1307904_1308540_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1308564_1309116_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1314963:1314979	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 3
NZ_CP045947	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010530 chromosome, complete genome	4964749	1662700	1692173	4964749	tail,holin,protease	Salmonella_phage(38.46%)	32	NA	NA
WP_000781589.1|1662700_1663195_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1663608_1664100_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1664089_1664353_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1664349_1666836_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1666842_1667538_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1667524_1668394_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1668509_1668959_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1668968_1669571_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1669591_1670209_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-10
WP_000990028.1|1670205_1670865_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1670916_1671654_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1671650_1671863_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1671859_1672339_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1672335_1674267_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1674263_1674821_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_033572444.1|1674817_1675861_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1675904_1676552_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1677281_1677845_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1678036_1678240_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1678542_1679334_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1679630_1679834_+|tail	tail protein	tail	NA	NA	NA	NA
WP_088631497.1|1680002_1682249_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.7e-72
WP_001202279.1|1682577_1683567_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1683581_1683950_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1683978_1685310_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1685606_1685936_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1686528_1687770_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1687772_1688300_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1688677_1689121_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1689174_1691004_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1691351_1691642_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1691669_1692173_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 4
NZ_CP045947	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010530 chromosome, complete genome	4964749	1764225	1773396	4964749	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1764225_1765173_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|1765156_1765888_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1765868_1765976_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1766035_1766767_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1766989_1768675_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1768671_1769391_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1769437_1769905_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1769961_1770492_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1770663_1771122_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1771362_1773396_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 5
NZ_CP045947	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010530 chromosome, complete genome	4964749	1841704	1852210	4964749		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1841704_1843108_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1843285_1844179_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1844555_1845641_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1845640_1846540_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1846587_1847466_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1847466_1848018_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1848023_1849016_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1849012_1849786_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1849790_1850870_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1850896_1852210_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_CP045947	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010530 chromosome, complete genome	4964749	1938204	1988891	4964749	tail,portal,plate,protease,holin,head,capsid,integrase,terminase	Salmonella_phage(80.3%)	71	1932782:1932796	1948912:1948926
1932782:1932796	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|1938204_1938678_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001738920.1|1939325_1939616_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_000598920.1|1939987_1940785_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|1941076_1942066_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000414876.1|1942067_1942310_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_001061334.1|1942334_1942904_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_020899398.1|1942907_1943489_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_000224241.1|1943499_1943757_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_000215886.1|1943758_1944292_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000008351.1|1944362_1944902_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080416.1|1945038_1945866_-	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000997191.1|1945923_1946295_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_023891434.1|1946834_1947059_+	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_001067432.1|1947021_1947360_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_001020636.1|1947565_1948261_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001191666.1|1948358_1948583_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|1948611_1949166_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
1948912:1948926	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087404.1|1949162_1950305_+	hypothetical protein	NA	A0A1C9IHV9	Salmonella_phage	100.0	1.5e-212
WP_000620702.1|1950301_1950526_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_033567233.1|1950522_1951497_+	protein phage	NA	A0A1C9IHW0	Salmonella_phage	100.0	2.3e-169
WP_000054228.1|1951493_1951967_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	100.0	4.9e-56
WP_033567232.1|1951963_1952839_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	2.7e-169
WP_000779148.1|1952847_1953237_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
WP_001061452.1|1953253_1954114_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	100.0	1.1e-162
WP_070793644.1|1954121_1955111_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	100.0	2.1e-194
WP_020899401.1|1955124_1955877_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_001624505.1|1956027_1956285_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|1956430_1956817_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|1956803_1957085_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|1957084_1957699_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_001530346.1|1957695_1958088_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001379492.1|1958550_1958883_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001135098.1|1958933_1959284_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_000929191.1|1959409_1959904_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_033567282.1|1959900_1961634_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.5	0.0e+00
WP_000605609.1|1961645_1961828_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466255.1|1961827_1963069_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_033567207.1|1963046_1963697_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	97.7	3.1e-117
WP_033572441.1|1963711_1964917_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	98.0	9.4e-221
WP_033572442.1|1964966_1965167_+	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	5.8e-27
WP_000927721.1|1965169_1965493_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.4e-54
WP_033567256.1|1965489_1965894_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.6	3.7e-52
WP_033567257.1|1965865_1966378_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.6	1.6e-81
WP_000779213.1|1966374_1966932_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	93.4	1.1e-96
WP_065305283.1|1966953_1967118_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	94.4	7.1e-23
WP_033567258.1|1967107_1968604_+|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000515953.1|1968603_1968960_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	99.2	1.3e-61
WP_000588852.1|1968956_1969283_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785381.1|1969367_1971293_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.3	0.0e+00
WP_001033736.1|1971309_1971759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033567259.1|1971818_1973159_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.3	9.7e-251
WP_001066632.1|1973155_1974214_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_001273649.1|1974213_1974747_+|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605055.1|1974751_1975165_+	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	99.3	1.2e-74
WP_000785581.1|1975157_1976237_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	7.2e-204
WP_001207832.1|1976239_1976827_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554735.1|1976813_1978376_+	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	98.5	1.7e-283
WP_022742744.1|1978345_1978951_+|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000836773.1|1979064_1979298_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_122815478.1|1979372_1979486_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000842532.1|1979533_1979947_-	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_001093793.1|1979943_1980156_-	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000500831.1|1981349_1981511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|1981637_1982057_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|1982059_1983328_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|1983782_1983995_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1984005_1984194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|1984454_1985651_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|1986300_1986600_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|1986691_1987387_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|1987460_1988891_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP045947	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010530 chromosome, complete genome	4964749	2092935	2099744	4964749	tail,integrase	Salmonella_phage(33.33%)	11	2095145:2095167	2104860:2104882
WP_000856224.1|2092935_2093166_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2093303_2093678_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2093678_2094554_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2094570_2094924_+	YebY family protein	NA	NA	NA	NA	NA
2095145:2095167	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|2095297_2096152_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|2096211_2096706_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2096895_2097126_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2097179_2097713_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2097969_2098137_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2098201_2098390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2098862_2099744_+|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
2104860:2104882	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 8
NZ_CP045947	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010530 chromosome, complete genome	4964749	2886278	2977195	4964749	tail,tRNA,protease,lysis,holin,integrase,terminase	Salmonella_phage(58.7%)	91	2910372:2910391	2974268:2974287
WP_000938191.1|2886278_2886959_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2887579_2888239_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2888325_2888655_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2888651_2888933_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2888981_2889761_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|2889786_2890335_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2890549_2891761_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2891818_2892136_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|2892180_2892597_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2892767_2893430_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2893524_2893983_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2894018_2896073_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2896196_2896643_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2896661_2898815_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2898801_2899407_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2899623_2900133_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2900489_2901542_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2901613_2902066_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2902251_2904012_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2904080_2904599_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2904698_2904866_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_033567177.1|2905121_2905685_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2905681_2907322_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2907326_2908580_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2908594_2910502_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2910372:2910391	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2910514_2912623_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2912721_2913831_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2913827_2914370_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2914535_2915546_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2915753_2918366_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2918792_2918984_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2919254_2919941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603423.1|2919925_2920225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2920293_2920920_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2921567_2922536_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000143167.1|2923011_2923593_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_031247858.1|2923592_2926031_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	7.5e-92
WP_000178849.1|2926084_2926327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000033415.1|2926365_2929716_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_001576012.1|2929787_2930492_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000606351.1|2930389_2931127_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2931136_2931832_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2931921_2932455_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2932571_2933069_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_020899435.1|2933168_2933501_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000867564.1|2934621_2935167_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_024143045.1|2935635_2936082_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_000984584.1|2936099_2936552_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_077248428.1|2936535_2936865_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
WP_001141973.1|2937140_2937827_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2938187_2938637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2938772_2938898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097242.1|2939092_2939782_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.6	1.1e-59
WP_000801757.1|2939778_2939919_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096542.1|2939915_2940527_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000929788.1|2940735_2941338_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_000763780.1|2941422_2941644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|2941753_2941987_-	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_022630855.1|2942578_2943175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|2943186_2944164_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001536080.1|2944218_2944476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208142.1|2944475_2945120_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_000850457.1|2945123_2945432_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000065109.1|2945435_2945894_-	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_020899441.1|2945890_2946238_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.8e-52
WP_000800012.1|2946248_2946998_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_000062943.1|2947000_2947984_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000426364.1|2948068_2948389_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_001555460.1|2948423_2948651_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000981510.1|2948756_2949191_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_000917559.1|2949487_2949619_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_023139985.1|2949667_2950018_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_136614733.1|2950144_2953345_+	DNA breaking-rejoining protein	NA	S4TNL0	Salmonella_phage	78.6	0.0e+00
WP_014344386.1|2953307_2954465_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|2954507_2954747_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2954787_2955036_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_020899445.1|2955080_2956373_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	4.5e-253
WP_000191399.1|2956567_2957770_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|2957847_2959284_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|2959528_2960743_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|2961059_2961521_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2961721_2963122_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977713.1|2963728_2964820_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000462653.1|2965004_2966195_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109471.1|2966256_2966904_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|2966931_2967480_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925872.1|2967739_2969581_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572724.1|2969925_2974392_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
2974268:2974287	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_000060025.1|2974391_2975096_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_051120049.1|2975076_2976399_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|2976391_2977195_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP045947	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010530 chromosome, complete genome	4964749	3027258	3035990	4964749	transposase,protease	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|3027258_3028513_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|3028976_3029435_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|3029626_3031903_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3031933_3032254_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3032577_3032799_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3032928_3034875_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3034871_3035990_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 10
NZ_CP045947	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010530 chromosome, complete genome	4964749	3654560	3666562	4964749	integrase	Enterobacteria_phage(33.33%)	14	3645128:3645141	3663788:3663801
3645128:3645141	attL	TCTGGAGCGCCGCC	NA	NA	NA	NA
WP_001529722.1|3654560_3656912_-	hypothetical protein	NA	A0A1W6JPG0	Morganella_phage	48.5	6.8e-74
WP_001529721.1|3656924_3657527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|3657519_3657741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|3657737_3658001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|3657997_3658192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032150717.1|3658184_3659213_-	ash family protein	NA	Q8W643	Enterobacteria_phage	53.3	1.0e-13
WP_000476150.1|3659206_3659389_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_033567214.1|3659381_3660215_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	9.0e-21
WP_001529719.1|3660227_3660659_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	3.9e-28
WP_000035054.1|3660658_3660862_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_001529718.1|3661290_3662505_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
WP_000893231.1|3662861_3664112_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
3663788:3663801	attR	GGCGGCGCTCCAGA	NA	NA	NA	NA
WP_001285275.1|3664123_3665227_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|3665509_3666562_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
>prophage 11
NZ_CP045947	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010530 chromosome, complete genome	4964749	4501323	4545187	4964749	tail,tRNA,portal,plate,protease,holin,head,capsid,integrase,terminase	Shigella_phage(44.07%)	63	4503457:4503471	4506863:4506877
WP_000918353.1|4501323_4502739_-	replicative DNA helicase DnaB	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
WP_000235551.1|4502803_4503787_+	quinone oxidoreductase	NA	NA	NA	NA	NA
4503457:4503471	attL	GAAAGATACCTGGGA	NA	NA	NA	NA
WP_000891414.1|4503961_4504204_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_022630972.1|4504371_4505409_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332264.1|4505497_4506595_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	4.3e-212
WP_033567204.1|4506656_4506905_+	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	98.8	2.0e-37
4506863:4506877	attR	GAAAGATACCTGGGA	NA	NA	NA	NA
WP_000639149.1|4507048_4507612_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	79.1	3.4e-80
WP_006678262.1|4507937_4508666_+	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	100.0	2.8e-143
WP_001747940.1|4508667_4509075_+|tail	tail assembly chaperone	tail	A0A1B0V844	Salmonella_phage	100.0	4.9e-73
WP_006678265.1|4509078_4509696_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	100.0	5.7e-113
WP_023200332.1|4509665_4511198_-	hypothetical protein	NA	A0A1B0VFW4	Salmonella_phage	97.9	1.6e-241
WP_000383548.1|4511201_4511786_-	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_022630974.1|4511776_4512835_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.6	5.2e-199
WP_000424732.1|4512821_4513247_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_022630975.1|4513246_4513795_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	97.8	1.9e-96
WP_000999499.1|4513794_4514874_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.7	5.3e-207
WP_000219913.1|4514870_4516199_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_001439754.1|4516289_4516802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023200330.1|4516883_4518716_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.2	4.7e-304
WP_000661047.1|4518857_4519127_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000090998.1|4519126_4519483_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_022630977.1|4519482_4520979_-|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.0	7.7e-273
WP_000497751.1|4520962_4521133_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779279.1|4521141_4521702_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_022630978.1|4521698_4522205_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	5.0e-91
WP_000702388.1|4522179_4522590_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_000927719.1|4522586_4522910_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_021577001.1|4522884_4523112_-	hypothetical protein	NA	S5FNU1	Shigella_phage	94.9	2.2e-22
WP_021567480.1|4523161_4524367_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	3.5e-223
WP_021578635.1|4524381_4525032_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.1	3.6e-118
WP_001514795.1|4525009_4526251_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.0e-241
WP_000605606.1|4526250_4526433_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000088161.1|4526444_4528178_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	100.0	0.0e+00
WP_048306293.1|4528191_4528677_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	98.8	6.1e-86
WP_001135098.1|4528802_4529153_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|4529203_4529536_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001530346.1|4529998_4530391_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001624504.1|4530387_4531002_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_000422366.1|4531001_4531283_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|4531269_4531656_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001624505.1|4531801_4532059_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_048306282.1|4532209_4532962_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	99.6	9.0e-145
WP_033567167.1|4532975_4533965_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	2.1e-194
WP_001061444.1|4533972_4534782_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001398927.1|4534801_4535191_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	100.0	5.4e-69
WP_000210170.1|4535187_4535514_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001433188.1|4535510_4536164_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
WP_086936917.1|4536163_4536658_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	4.7e-86
WP_000104942.1|4536654_4537596_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_001250269.1|4537585_4537765_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515829.1|4537940_4538498_-	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_000649477.1|4538541_4538742_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|4538832_4539507_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_001369946.1|4539678_4539882_+	ClpX C4-type zinc finger	NA	A0A1C9IHZ4	Salmonella_phage	68.3	8.9e-15
WP_001514782.1|4539890_4540166_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	97.8	7.0e-47
WP_001323604.1|4540748_4541129_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	1.3e-62
WP_033567165.1|4541194_4542019_+	DUF2303 family protein	NA	U5P439	Shigella_phage	98.9	1.1e-148
WP_000008210.1|4542146_4542683_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_001565177.1|4542673_4543036_+	phage protein	NA	U5P092	Shigella_phage	97.5	1.5e-65
WP_000206745.1|4543035_4543845_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	61.8	3.3e-76
WP_001061343.1|4543844_4544417_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	96.8	3.7e-106
WP_001093909.1|4544453_4544726_+	hypothetical protein	NA	S5MQM5	Escherichia_phage	86.7	5.9e-38
WP_000549966.1|4544752_4545187_-	hypothetical protein	NA	A0A0S2SYH1	Pseudomonas_phage	51.0	5.2e-36
>prophage 12
NZ_CP045947	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010530 chromosome, complete genome	4964749	4571636	4592056	4964749	tail,plate	Burkholderia_phage(45.0%)	26	NA	NA
WP_000615248.1|4571636_4571984_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4572559_4572847_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4572849_4573455_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4573467_4573782_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4573941_4574397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4574393_4574591_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4574580_4576008_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4576007_4576532_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4576583_4576901_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4576860_4576989_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4577085_4579440_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|4579439_4580393_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4580392_4580602_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4580589_4581633_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4581642_4582365_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4582692_4583055_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4583051_4583981_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4583980_4585528_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4585691_4586051_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4586041_4587157_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4587149_4587782_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4587784_4589530_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4589534_4590140_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4590136_4590592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4590840_4591131_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4591327_4592056_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
