The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045958	Salmonella enterica subsp. enterica serovar Birkenhead strain AUSMDU00010532 chromosome, complete genome	4692229	1124664	1215306	4692229	tRNA,capsid,tail,transposase,integrase,holin,head,plate,lysis,terminase,portal	Salmonella_phage(48.15%)	86	1155436:1155452	1186574:1186590
WP_086810745.1|1124664_1125876_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.5	4.3e-104
WP_072104906.1|1126505_1127669_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000196135.1|1127676_1129857_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533858.1|1129853_1131263_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_086810743.1|1131327_1142802_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1143416_1143899_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1144048_1144525_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1144514_1144805_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1144970_1145309_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1145457_1147119_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059160.1|1147204_1148083_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1148206_1148797_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_011264358.1|1148831_1149437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1149557_1150844_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1150863_1151655_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1151820_1153182_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1153434_1153683_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1153701_1154250_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469813.1|1154294_1155062_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1155102_1155450_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
1155436:1155452	attL	GAGCGTCTTAACTAAGA	NA	NA	NA	NA
WP_000972010.1|1155594_1155813_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	100.0	1.2e-38
WP_086810741.1|1155888_1157058_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	99.7	2.2e-214
WP_000978862.1|1157054_1157540_-|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	100.0	3.6e-86
WP_154074090.1|1157554_1159999_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	99.4	0.0e+00
WP_085984508.1|1159991_1160147_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_001029726.1|1160143_1160479_-|tail	phage tail assembly protein	tail	S4TTB2	Salmonella_phage	100.0	1.4e-52
WP_001207675.1|1160541_1161060_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_086810735.1|1161075_1162263_-|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	99.7	5.8e-223
WP_086810733.1|1162397_1162799_-|tail	phage tail protein	tail	A0A1B0V844	Salmonella_phage	90.2	4.6e-63
WP_154074091.1|1162805_1164731_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	89.9	1.8e-173
WP_154074092.1|1164741_1165272_-|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	98.3	2.3e-102
WP_086810727.1|1165264_1166173_-|plate	baseplate assembly protein	plate	Q6K1H4	Salmonella_virus	98.3	1.3e-158
WP_086810725.1|1166179_1166527_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	95.7	5.2e-55
WP_086810723.1|1166523_1167165_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	98.1	2.7e-113
WP_001293103.1|1167233_1167683_-	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	99.3	2.5e-73
WP_001169074.1|1167675_1168143_-|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	100.0	1.1e-84
WP_077941258.1|1168105_1168279_-|lysis	phage lysis protein	lysis	S4TNY4	Salmonella_phage	96.5	3.1e-24
WP_000866104.1|1168250_1168664_-|lysis	LysB family phage lysis regulatory protein	lysis	S4TRW3	Salmonella_phage	99.3	2.9e-44
WP_001144116.1|1168660_1169158_-	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	99.4	1.2e-92
WP_086810721.1|1169144_1169441_-|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	98.0	1.9e-45
WP_000868400.1|1169444_1169648_-|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	100.0	3.6e-32
WP_000214255.1|1169647_1170154_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	100.0	1.3e-91
WP_076934862.1|1170247_1170997_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	99.2	3.6e-130
WP_001247243.1|1171000_1172068_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.7	1.2e-198
WP_154074093.1|1172144_1172999_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0M3UL81	Salmonella_phage	99.6	2.2e-147
WP_086810719.1|1173164_1174937_+|terminase	terminase ATPase subunit family protein	terminase	S4TT96	Salmonella_phage	99.2	0.0e+00
WP_154074094.1|1174933_1175680_+	hypothetical protein	NA	Q6K1I9	Salmonella_virus	96.8	1.1e-139
WP_015973893.1|1175676_1176699_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	100.0	6.6e-199
WP_154074095.1|1176939_1177101_+	hypothetical protein	NA	A0A0M4R4Y4	Salmonella_phage	90.6	5.9e-22
WP_001749800.1|1177221_1177416_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	81.2	1.5e-19
WP_001222154.1|1177954_1178188_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	98.7	8.0e-36
WP_000232650.1|1178191_1178374_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	100.0	4.1e-27
WP_086810712.1|1178487_1180716_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	95.4	0.0e+00
WP_086810709.1|1180706_1180988_-	DUF3850 domain-containing protein	NA	Q7Y4B7	Escherichia_virus	43.3	9.8e-12
WP_086810706.1|1180984_1181257_-	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	80.0	9.4e-36
WP_086810884.1|1181253_1181847_-	3'-5' exonuclease	NA	A0A218M4G8	Erwinia_phage	99.5	1.2e-112
WP_000752600.1|1181962_1182184_-	TraR/DksA family transcriptional regulator	NA	A0A218M4I6	Erwinia_phage	100.0	3.8e-35
WP_001246237.1|1182183_1182411_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	100.0	6.8e-32
WP_086810704.1|1182478_1182817_-	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	92.9	5.2e-52
WP_086810702.1|1182780_1182981_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	98.5	2.7e-32
WP_025711960.1|1182988_1183498_-	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	98.8	6.2e-89
WP_025711959.1|1183548_1183902_-	hypothetical protein	NA	Q6K1F9	Salmonella_virus	99.1	1.1e-57
WP_086810700.1|1184015_1184858_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	70.1	2.3e-112
WP_086810698.1|1184857_1185421_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000218688.1|1185442_1186492_+|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	92.0	3.0e-191
WP_001030985.1|1186744_1187965_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
1186574:1186590	attR	GAGCGTCTTAACTAAGA	NA	NA	NA	NA
WP_001212380.1|1187957_1188476_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1188915_1189986_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_086810695.1|1189995_1191117_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_086810692.1|1191174_1192083_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_086810690.1|1192043_1193204_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1193303_1193351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1193454_1193793_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197660.1|1194064_1194802_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1194933_1195914_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992640.1|1195910_1196642_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235092.1|1196771_1199345_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_086011253.1|1205056_1206311_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
WP_000985653.1|1206483_1206939_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_154074096.1|1207042_1208344_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	6.9e-44
WP_020839154.1|1208340_1208664_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1208708_1210064_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_086811695.1|1210178_1212839_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000183642.1|1212892_1213573_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098732.1|1213645_1214065_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_079834460.1|1214268_1215306_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP045958	Salmonella enterica subsp. enterica serovar Birkenhead strain AUSMDU00010532 chromosome, complete genome	4692229	1595056	1660058	4692229	tail,transposase,holin,protease,terminase	Salmonella_phage(39.13%)	72	NA	NA
WP_023235080.1|1595056_1595551_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228074.1|1595964_1596456_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1596445_1596709_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1596705_1599192_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091679.1|1599198_1599894_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1599880_1600750_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1600865_1601315_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1601324_1601927_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_020839206.1|1601947_1602565_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	6.3e-11
WP_045902287.1|1602561_1603221_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266003.1|1603271_1604009_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1604005_1604218_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_086812543.1|1604214_1604694_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_079973558.1|1604690_1606622_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_086812541.1|1606618_1607176_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_154074104.1|1607172_1608216_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001115497.1|1608259_1608907_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1609636_1610200_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1610391_1610595_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_001749124.1|1610623_1610782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012664506.1|1610897_1611689_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.4	2.2e-48
WP_077906308.1|1611772_1612135_+|tail	phage tail protein	tail	S4TUB9	Salmonella_phage	85.6	9.5e-52
WP_086812293.1|1612357_1614724_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	90.8	1.2e-73
WP_086812294.1|1615523_1616708_-	recombinase	NA	A0A2D1GN00	Marinobacter_phage	30.9	4.5e-34
WP_070804467.1|1616709_1616919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086812296.1|1616958_1617528_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	93.1	3.2e-102
WP_086812298.1|1619244_1620000_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	96.8	1.1e-147
WP_086812300.1|1619999_1620533_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	90.9	8.1e-92
WP_086812302.1|1620603_1621143_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	98.9	1.1e-96
WP_086812304.1|1621279_1622107_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	98.5	1.2e-150
WP_000997190.1|1622164_1622536_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_086812306.1|1623107_1623359_+	bssS family protein	NA	NA	NA	NA	NA
WP_086812311.1|1623434_1623620_-	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	71.1	1.5e-13
WP_086812313.1|1623825_1624521_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.1	6.0e-127
WP_001191666.1|1624618_1624843_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_086812315.1|1624871_1625426_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	98.9	1.0e-100
WP_086812317.1|1625422_1626565_+	peptidase	NA	A0A1C9IHV9	Salmonella_phage	97.9	6.6e-208
WP_024145495.1|1626561_1626786_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	98.6	2.2e-38
WP_086812319.1|1626782_1627844_+	primosomal protein I	NA	U5P0A0	Shigella_phage	85.7	2.9e-80
WP_086812323.1|1627803_1628328_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	96.6	7.2e-93
WP_086812326.1|1628327_1628981_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	88.5	1.6e-113
WP_086812329.1|1629383_1630244_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	97.9	1.6e-158
WP_086812379.1|1630251_1631241_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.5	1.3e-191
WP_076010371.1|1631258_1631621_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.3	2.2e-56
WP_086812333.1|1631733_1634007_-	SET domain-containing protein	NA	NA	NA	NA	NA
WP_086812335.1|1634366_1634555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154074105.1|1634644_1635034_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	71.8	6.2e-41
WP_086812340.1|1635020_1635302_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	79.6	4.4e-36
WP_086812342.1|1635301_1635919_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	80.9	4.1e-95
WP_086812344.1|1635915_1636449_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	50.7	1.5e-08
WP_071828141.1|1636608_1636890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154074106.1|1637099_1637258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086812346.1|1637310_1637802_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	55.6	6.4e-43
WP_154074107.1|1637788_1639897_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	70.4	2.8e-292
WP_000196423.1|1639893_1640100_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	48.6	1.1e-07
WP_141120594.1|1641483_1643664_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	71.4	7.8e-274
WP_086812355.1|1643752_1644076_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	63.2	1.3e-28
WP_086812357.1|1644068_1644344_+	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_079777105.1|1644347_1644932_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	77.6	1.5e-75
WP_086812359.1|1644928_1645330_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	69.9	2.8e-52
WP_086812361.1|1645337_1646084_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	4.3e-99
WP_086812363.1|1646134_1646530_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	6.6e-30
WP_086812365.1|1646526_1646865_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	61.5	3.9e-31
WP_086812369.1|1646836_1649938_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	63.0	2.3e-279
WP_023225501.1|1649940_1650270_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	72.2	2.5e-43
WP_086812371.1|1650279_1650978_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.4	4.6e-103
WP_086812373.1|1650984_1651722_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	2.3e-129
WP_086812375.1|1651619_1652267_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	1.7e-88
WP_086812377.1|1652329_1655725_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	75.2	0.0e+00
WP_086011253.1|1655817_1657072_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
WP_086811938.1|1657083_1659522_+	shikimate transporter	NA	Q8HAB4	Salmonella_phage	73.0	2.7e-166
WP_086811981.1|1659602_1660058_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	74.2	2.5e-57
>prophage 3
NZ_CP045958	Salmonella enterica subsp. enterica serovar Birkenhead strain AUSMDU00010532 chromosome, complete genome	4692229	1733808	1742979	4692229	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_086811969.1|1733808_1734756_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|1734739_1735471_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1735451_1735559_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1735618_1736350_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1736572_1738258_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1738254_1738974_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1739020_1739488_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1739544_1740075_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1740246_1740705_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_086811971.1|1740945_1742979_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	4.7e-55
>prophage 4
NZ_CP045958	Salmonella enterica subsp. enterica serovar Birkenhead strain AUSMDU00010532 chromosome, complete genome	4692229	1910054	1920544	4692229		Morganella_phage(25.0%)	12	NA	NA
WP_001219015.1|1910054_1910528_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001736108.1|1911175_1911466_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	3.0e-08
WP_017465540.1|1911837_1912635_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001532308.1|1913115_1913277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1913403_1913823_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_086812112.1|1913825_1915094_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|1915548_1915761_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1915771_1915960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086812110.1|1916125_1917304_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.0	4.3e-109
WP_000107428.1|1917953_1918265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377038.1|1918344_1919040_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.2	2.8e-07
WP_001157308.1|1919113_1920544_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
NZ_CP045958	Salmonella enterica subsp. enterica serovar Birkenhead strain AUSMDU00010532 chromosome, complete genome	4692229	2633821	2717957	4692229	tRNA,tail,transposase,integrase,holin,protease,portal,lysis,terminase	Escherichia_phage(26.0%)	100	2700341:2700355	2719485:2719499
WP_000829543.1|2633821_2634349_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_000272238.1|2634345_2634447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460698.1|2634652_2635099_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_086810907.1|2635078_2635873_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000205343.1|2635973_2637158_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_001222530.1|2637276_2637624_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000487126.1|2637609_2637921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673489.1|2637989_2638241_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001589065.1|2638436_2638535_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000512149.1|2638673_2638922_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_012664621.1|2639235_2639877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513733.1|2640106_2640289_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_001248993.1|2640291_2640654_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457190.1|2640826_2641465_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000617984.1|2641661_2642207_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000208086.1|2642522_2642771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153218876.1|2642879_2643053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000190260.1|2643025_2643874_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001534706.1|2643942_2644536_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011264269.1|2644680_2645469_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
WP_000234684.1|2645577_2646228_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001183699.1|2646421_2646748_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_000456065.1|2646941_2648075_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000947462.1|2648156_2648747_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000950205.1|2648740_2649538_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	4.7e-11
WP_000966637.1|2649531_2650344_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001748353.1|2650333_2651308_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000946084.1|2651307_2652942_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000182479.1|2653623_2653938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929981.1|2654086_2654614_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
WP_000780157.1|2654698_2655742_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_001518864.1|2656080_2656551_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_000758946.1|2657171_2657297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000977722.1|2657674_2658019_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000789471.1|2659240_2659798_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
WP_012664625.1|2660609_2660873_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_031617243.1|2661004_2661217_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001532066.1|2661630_2662152_+	lipoprotein	NA	NA	NA	NA	NA
WP_000497451.1|2662342_2662582_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001033398.1|2663071_2663860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086810903.1|2664845_2665970_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_012218897.1|2666417_2666630_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.5e-20
WP_000334550.1|2666884_2667556_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.8e-80
WP_086810901.1|2667866_2669873_-	E3 ubiquitin--protein ligase	NA	Q9MBL9	Phage_Gifsy-2	79.6	1.5e-61
WP_154074178.1|2670018_2670351_+|tail	tail assembly chaperone	tail	A0A1B0VCD0	Salmonella_phage	66.2	1.3e-18
WP_000421115.1|2670991_2671510_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	51.4	2.5e-45
WP_086812503.1|2671524_2673972_-	shikimate transporter	NA	A0A1B0VFW4	Salmonella_phage	65.5	1.4e-151
WP_000178849.1|2674025_2674268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141120599.1|2674306_2677645_-	DUF1983 domain-containing protein	NA	A0A0K2FI38	Escherichia_phage	68.1	0.0e+00
WP_086812507.1|2677716_2678421_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|2678318_2679056_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_086812510.1|2679065_2679761_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	67.5	2.2e-89
WP_000877926.1|2679850_2680384_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2680500_2680998_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978295.1|2681096_2681429_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_086812514.1|2681425_2684413_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.0	4.8e-266
WP_086812512.1|2684492_2684822_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.0	6.5e-23
WP_000478858.1|2684818_2685217_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132757.1|2685262_2686012_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	4.8e-90
WP_000196703.1|2686023_2686425_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000774239.1|2686969_2687269_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2687261_2687585_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_086011253.1|2687626_2688882_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
WP_086812530.1|2688990_2691072_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.3	1.4e-264
WP_077679777.1|2690995_2692513_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_000989241.1|2692742_2694881_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|2694837_2695371_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|2695578_2696058_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2696075_2696528_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2696511_2696841_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|2697116_2697803_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|2698163_2698613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|2698986_2699511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|2699607_2700297_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
2700341:2700355	attL	AATCGATCAGGATGG	NA	NA	NA	NA
WP_000784710.1|2700426_2700654_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_086812449.1|2700650_2701250_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_001597144.1|2701813_2701969_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	1.2e-14
WP_000687975.1|2702172_2702445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023201654.1|2702441_2702837_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.1	3.7e-17
WP_086812447.1|2702851_2703313_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.2	3.9e-66
WP_000729537.1|2703305_2704313_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.5	7.6e-123
WP_001533160.1|2704359_2704854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086812446.1|2704840_2705095_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	59.4	2.0e-16
WP_001224472.1|2705191_2705617_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	1.2e-13
WP_001669535.1|2706071_2706386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086812444.1|2706647_2706923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086812442.1|2706926_2707133_+	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	44.1	1.9e-09
WP_000799627.1|2707208_2707544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086812440.1|2707684_2710375_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	74.9	3.1e-115
WP_001126032.1|2710367_2711198_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_001033921.1|2711233_2711554_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	3.6e-34
WP_086812438.1|2711546_2711879_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	78.8	2.6e-19
WP_000069466.1|2711875_2712379_+	hypothetical protein	NA	A0A075B8H2	Enterobacteria_phage	92.3	6.0e-36
WP_023244951.1|2712428_2712665_+	excisionase	NA	NA	NA	NA	NA
WP_000741321.1|2712654_2713797_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	80.0	1.4e-173
WP_000444509.1|2713910_2715161_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_001249411.1|2715332_2715998_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825956.1|2715994_2716324_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000476067.1|2716335_2716797_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000004540.1|2716850_2717957_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2719485:2719499	attR	CCATCCTGATCGATT	NA	NA	NA	NA
>prophage 6
NZ_CP045958	Salmonella enterica subsp. enterica serovar Birkenhead strain AUSMDU00010532 chromosome, complete genome	4692229	2968649	2978162	4692229	protease,transposase,integrase	Enterobacteria_phage(14.29%)	8	2963775:2963789	2976898:2976912
2963775:2963789	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_086016038.1|2968649_2969904_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	4.8e-18
WP_001539594.1|2970849_2971227_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|2971388_2971586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2971798_2974075_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2974105_2974426_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2974749_2974971_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_086812423.1|2975100_2977047_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	7.0e-40
2976898:2976912	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201753.1|2977043_2978162_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
>prophage 7
NZ_CP045958	Salmonella enterica subsp. enterica serovar Birkenhead strain AUSMDU00010532 chromosome, complete genome	4692229	4275980	4322782	4692229	plate,tail,tRNA	Burkholderia_phage(40.91%)	49	NA	NA
WP_001182234.1|4275980_4276979_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4277066_4278377_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4278623_4279139_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4279239_4279449_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001575282.1|4279470_4279584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128103.1|4279580_4280906_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4281084_4281693_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4281801_4282170_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4282340_4284761_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4284859_4285732_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4285745_4286243_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4286423_4287341_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973642.1|4287504_4288863_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4288951_4290061_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4290422_4291613_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382570.1|4291744_4293289_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4293303_4294194_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|4294359_4294770_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_086811339.1|4294912_4297009_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_086811337.1|4297008_4297746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824806.1|4297742_4298381_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4298444_4298687_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790032.1|4299130_4300780_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4301124_4302474_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4302604_4302952_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226439.1|4303528_4303816_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_063808960.1|4303818_4304424_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	1.2e-59
WP_000777266.1|4304436_4304751_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449436.1|4304910_4305366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875313.1|4305362_4305560_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	5.1e-07
WP_000729849.1|4305549_4306977_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.8e-194
WP_086811333.1|4306976_4307501_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	8.1e-68
WP_001003640.1|4307552_4307870_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185655.1|4307829_4307958_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_086811331.1|4308054_4310409_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.8	6.2e-67
WP_086811329.1|4310408_4311362_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4311361_4311571_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818153.1|4311558_4312602_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	1.2e-75
WP_001541288.1|4312611_4313334_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|4313660_4314023_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_023137582.1|4314019_4314949_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_086811327.1|4314948_4316496_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.2e-48
WP_001093501.1|4316659_4317019_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951730.1|4317009_4318125_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_000359503.1|4318117_4318750_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_154074174.1|4318752_4320243_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	44.8	2.5e-53
WP_001151757.1|4320249_4320864_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084338.1|4320860_4321316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086811325.1|4322053_4322782_+	hypothetical protein	NA	A0A292GAQ8	Xanthomonas_phage	28.2	4.6e-13
>prophage 1
NZ_CP045959	Salmonella enterica subsp. enterica serovar Birkenhead strain AUSMDU00010532 plasmid pAUSMDU00010532_01, complete sequence	329074	30088	200507	329074	integrase,transposase,bacteriocin	Shigella_phage(21.43%)	112	181044:181060	205341:205357
WP_154074197.1|30088_31257_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	98.7	6.4e-182
WP_154074358.1|31488_33036_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_154074198.1|33274_35077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154074199.1|35180_35933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154074200.1|36030_38628_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_154074359.1|38515_39007_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_154074201.1|39034_39781_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_154074202.1|39834_40503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154074203.1|41036_42260_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	31.8	1.2e-58
WP_154074204.1|42259_42889_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	6.7e-53
WP_154074205.1|42987_43446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154074206.1|44556_45339_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	95.4	4.3e-134
WP_154074360.1|46649_47219_+	type IV prepilin	NA	NA	NA	NA	NA
WP_154074207.1|47289_48084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154074208.1|48098_49157_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_154074209.1|49172_49631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154074210.1|49636_51199_+	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
WP_154074211.1|51198_52491_+	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_154074212.1|52474_53065_+	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
WP_154074213.1|53075_54641_+	type ii secretion system protein	NA	NA	NA	NA	NA
WP_154074214.1|54640_55693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154074215.1|55707_56118_+	transglycosylase SLT domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	40.0	3.6e-07
WP_154074216.1|56121_56697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154074217.1|56707_58270_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_154074218.1|58256_58904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154074219.1|60452_61703_-	low affinity tryptophan permease TnaB	NA	NA	NA	NA	NA
WP_154074220.1|61811_63227_-	tryptophanase	NA	NA	NA	NA	NA
WP_154074361.1|63493_63568_-	tryptophanase leader peptide	NA	NA	NA	NA	NA
WP_154074221.1|64236_64398_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	96.2	3.1e-23
WP_154074222.1|66034_66814_-	ABC transporter permease subunit	NA	A0A1L7N119	Ralstonia_phage	28.6	1.6e-08
WP_154074223.1|68001_69214_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	2.6e-101
WP_154074224.1|71679_72216_+	fimbrial protein	NA	NA	NA	NA	NA
WP_154074362.1|72337_73000_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_154074225.1|73010_75602_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_154074226.1|75758_76808_+	fimbrial protein	NA	NA	NA	NA	NA
WP_154074227.1|79448_79778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154074228.1|81243_81522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154074229.1|82442_83330_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_154074230.1|83345_84557_-	MFS transporter	NA	NA	NA	NA	NA
WP_154074231.1|84689_86414_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_154074232.1|86414_87362_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_154074233.1|87361_89095_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_154074234.1|89098_90433_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_154074235.1|90458_92660_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_154074363.1|92807_93758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154074236.1|94198_95221_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_108418454.1|96182_96290_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_154074237.1|97501_97657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154074238.1|99673_100954_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_154074239.1|100946_102749_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.3	3.2e-23
WP_154074240.1|107166_107937_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.7	1.2e-08
WP_154074241.1|108437_108695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154074242.1|109483_110579_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.4	8.5e-43
WP_154074364.1|110983_111196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154074365.1|111490_112318_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_154074243.1|112381_116266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154074366.1|117793_119000_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.5	4.5e-98
WP_154074244.1|119712_119979_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_154074245.1|121453_122662_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.8	5.6e-48
WP_154074367.1|125277_125631_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	42.4	7.0e-07
WP_088731526.1|127631_127883_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_154074246.1|128965_129811_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_154074247.1|129892_130381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064786215.1|130711_130996_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	44.8	1.5e-12
WP_154074248.1|130992_131847_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	55.8	1.5e-79
WP_154074249.1|133083_133620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154074250.1|133616_134069_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_154074251.1|134973_135303_-	nucleoside transporter	NA	NA	NA	NA	NA
WP_154074252.1|135538_136633_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_154074253.1|138502_139060_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_154074254.1|139438_139984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154074255.1|140166_142671_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_154074256.1|142802_143549_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_154074257.1|144172_144544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080102198.1|144876_145740_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	42.2	1.6e-57
WP_154074258.1|146141_147377_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	69.0	5.4e-70
WP_154074259.1|147454_147736_-	helix-turn-helix domain-containing protein	NA	A0A2I6TC97	Escherichia_phage	37.0	1.7e-08
WP_080861456.1|147716_148046_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	1.8e-09
WP_154074368.1|149437_149854_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_154074260.1|149877_150108_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_154074261.1|150705_151401_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	32.9	3.9e-17
WP_154074262.1|155807_156002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154074263.1|156362_156551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062615.1|157093_158128_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_015062614.1|158131_159625_+	xylulokinase	NA	NA	NA	NA	NA
WP_154074264.1|159628_160924_+	MFS transporter	NA	NA	NA	NA	NA
WP_154074265.1|162314_162551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062582.1|167176_167524_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	94.8	3.5e-59
WP_154074266.1|167739_167913_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	94.7	1.2e-25
WP_154074267.1|168185_171332_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	21.2	2.2e-59
WP_154074268.1|171342_172626_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_015062723.1|172729_173086_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_079963718.1|173119_174505_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_015062721.1|174690_175374_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	9.3e-32
WP_015062720.1|175363_176824_+	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.5	1.3e-25
WP_015062719.1|177002_177500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062717.1|178431_179055_+	resolvase	NA	NA	NA	NA	NA
181044:181060	attL	TACATCAGGGATGAAAC	NA	NA	NA	NA
WP_154074369.1|182181_182427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062712.1|182744_183521_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_154074269.1|183639_184140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062711.1|184185_186801_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_154074270.1|188955_189690_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015062706.1|189845_190472_+	YfdX family protein	NA	NA	NA	NA	NA
WP_015062704.1|191119_191314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154074271.1|191978_192968_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015062700.1|193726_194143_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261285.1|194139_194370_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_154074272.1|194987_195944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154074273.1|195944_196256_+	cytoplasmic protein	NA	NA	NA	NA	NA
WP_154074274.1|196245_197037_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	2.5e-52
WP_154074275.1|198347_198599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154074276.1|199859_200507_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.6	1.8e-16
205341:205357	attR	GTTTCATCCCTGATGTA	NA	NA	NA	NA
>prophage 2
NZ_CP045959	Salmonella enterica subsp. enterica serovar Birkenhead strain AUSMDU00010532 plasmid pAUSMDU00010532_01, complete sequence	329074	259629	307532	329074	integrase,transposase	Shigella_phage(25.0%)	33	282905:282964	320193:321443
WP_154074326.1|259629_260798_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	98.7	6.4e-182
WP_154074327.1|260867_261026_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_154074328.1|261416_261731_-	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
WP_080071031.1|261733_261970_-	antitoxin	NA	NA	NA	NA	NA
WP_154074329.1|262824_263505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154074330.1|263963_267401_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	25.9	1.3e-09
WP_154074372.1|267851_270875_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_154074331.1|272362_272647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154074332.1|272696_273518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154074187.1|273514_273967_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_154074333.1|273959_274151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088731532.1|275944_276253_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_088731534.1|276604_276790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154074373.1|276895_277792_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_154074334.1|278121_280221_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.5	3.2e-38
WP_154074335.1|280213_281488_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
282905:282964	attL	TTTGAAGTGGCACACTGAATTTGGCCACCTGAACAGAGGTGATATGCTCACCTCAGAACA	NA	NA	NA	NA
WP_154074197.1|282978_284146_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	98.7	6.4e-182
WP_154074336.1|284473_284941_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_154074245.1|285166_286375_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.8	5.6e-48
WP_154074337.1|286480_287014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076010490.1|287094_287577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154074338.1|287578_290089_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_154074339.1|290111_290885_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_078024746.1|291184_291514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154074340.1|296204_296492_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	47.4	2.2e-19
WP_154074341.1|296488_296740_-	antitoxin	NA	NA	NA	NA	NA
WP_154074342.1|297167_297560_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_154074343.1|298260_299277_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_154074344.1|299667_299949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154074345.1|300168_300567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154074346.1|303277_303937_-	peptidase S14	NA	A0A1V0SCT2	Indivirus	27.6	6.5e-06
WP_154074374.1|304815_305598_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	88.5	7.8e-51
WP_154074347.1|306512_307532_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
320193:321443	attR	TGTTCTGAGGTGAGCATATCACCTCTGTTCAGGTGGCCAAATTCAGTGTGCCACTTCAAATTCCGTTCACCGCCAATGTTAGCTTTTCCGGGCGGTGATAACATCTCCGGGTCACTTTTCAGAGCCAGGGCTGATGAAGAAGAAAAGCAGCACACCCACTCCCCACGATGCCACATTCCGGCAGTTTCTGACGCAACCGGATATTGCCAGGGATTTTATGGAAATCCACCTGCCCACAGAGCTGCGAGCAGTCTGCGATCTCAGCACGCTGAAACTGGAATCCGGTTCGTTCGTTGAGGATGATCTCCGCCAGTATTTCAGCAACGTGCTCTACAGCCTGAAAACCACCGCCGGCGACGGATATATTCATGTCCTGATTGAGCACCAGTCAACGCCGGACAAACATATGGTCTTTCGCCTGCTCCGCTATGCGGTGGCCGCCATGCAGCGCCACCTGGAGGCTGGCCATAAAAAACTGCCACTGGTGATACCGGTACTGTTTTATACCGGTAAACGCAGCCCGTATCCGTACTCCACCCGGTGGCTGGATGAATTTGATGATCCGGCGCTGGCGGGCAATCTCTACAGCAGCGCCTTCCCGCTGGTTGATGTTACCGTCATTCCGGATGTCGACATCGCCGGACATAGCCATCTACACGTGGCACGTCACGGCCAACCAGCAGTACCTTTCGTCTCCACTCATAGGTAAGAGAAGTTAATCAAGCAATGGATATGCCATGTATACAGGAAGGTGAATTTTGAGTGCGGATATGTGGATCGCGTTAAAACTAGTATGCAATAACAGGATCAATATTCTCCTGTGTCGTTTCCAAATTATCAAAATGAGAATCAGTGCATCATGATGGTACGTTCAATTGTATTAGCCTCGTTCTGTATGACATATCTCATTGAAAAACTTCCGGTTTTAATATGGACATTGAATCTCTCTACAAAATACGTGAACGCTTTCATGCTTAATATAAGCGGTGAAACATAGTACAGGCGGCCCCGGCGTTCAGTGTTATTTAACAGGTAGTTTACCCGTTACGGGGAGCACGTTGAGAGATAATAGTTCACACCAGCGGGAGCGGGTGGTGACCATCCAGCCCTCCATCGCCCTGACATAGCTTATATCTGTCAGCAGAACCGGACGGACTTCATCCTTTGACGGCCACCCGTGTCGCACACGTACCTTCTCAGCAGCCCCCGCACAAACGTCCTTAATCCGCTCAGATCAATAAGCGCCCCATG	NA	NA	NA	NA
