The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045955	Salmonella enterica subsp. enterica serovar Enteritidis strain AUSMDU00010528 chromosome, complete genome	4703625	1121479	1215180	4703625	plate,tRNA,integrase,tail,head,capsid,lysis,portal,transposase	Salmonella_phage(78.26%)	84	1105848:1105866	1150036:1150054
1105848:1105866	attL	TGGCAATAACGTATTGTTT	NA	NA	NA	NA
WP_089113803.1|1121479_1122590_+|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
WP_000445376.1|1123386_1124190_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
WP_001142974.1|1124588_1125182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001585446.1|1125441_1126467_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.9	4.0e-196
WP_001749755.1|1126470_1127103_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	56.7	1.5e-63
WP_023225961.1|1127222_1127471_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	70.7	8.9e-25
WP_001749756.1|1127503_1128013_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	93.5	3.5e-84
WP_000957775.1|1128020_1128254_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
WP_000166366.1|1128201_1128660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000963195.1|1128879_1129221_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
WP_001244234.1|1129288_1129522_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
WP_154074470.1|1129521_1129749_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	1.9e-34
WP_001749757.1|1129745_1130603_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	80.4	2.7e-129
WP_154074471.1|1130593_1133005_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	96.0	0.0e+00
WP_001154444.1|1133159_1133348_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
WP_023225963.1|1133359_1133593_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	98.7	2.8e-36
WP_023238320.1|1133721_1134462_-	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	99.6	1.7e-143
WP_023260023.1|1134820_1135066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080160387.1|1135075_1135933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080160388.1|1135954_1136986_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	91.0	3.3e-182
WP_154074472.1|1136985_1138752_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	98.8	0.0e+00
WP_080068599.1|1138894_1139728_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	2.9e-128
WP_080160390.1|1139744_1140809_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.9	2.7e-195
WP_154074473.1|1140812_1141463_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	98.6	1.6e-113
WP_010835209.1|1141556_1142021_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.7	6.4e-85
WP_000868184.1|1142020_1142224_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1142227_1142443_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069921.1|1142423_1142939_+	lysozyme	NA	E5G6N1	Salmonella_phage	99.4	1.2e-95
WP_080157480.1|1142935_1143364_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	92.9	4.1e-62
WP_001039945.1|1143459_1143891_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_080068853.1|1143883_1144330_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	82.4	1.4e-60
WP_154074474.1|1144355_1145207_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_065348317.1|1145199_1146459_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_140236981.1|1146559_1147138_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	97.9	2.6e-107
WP_154074475.1|1147134_1147494_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	97.5	1.0e-58
WP_000268332.1|1147480_1148389_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_154074476.1|1148381_1148987_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	98.0	7.0e-116
WP_000680167.1|1150752_1151280_+|tail	tail protein	tail	NA	NA	NA	NA
1150036:1150054	attR	TGGCAATAACGTATTGTTT	NA	NA	NA	NA
WP_154074477.1|1151410_1152583_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	3.7e-222
WP_001207652.1|1152592_1153108_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	98.8	7.9e-92
WP_001280962.1|1153162_1153465_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_000763316.1|1153479_1153599_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_154074478.1|1153591_1156399_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.1	0.0e+00
WP_154074479.1|1156395_1156881_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	98.5	3.1e-66
WP_154074480.1|1156877_1157978_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	97.3	6.2e-195
WP_000980498.1|1158046_1158265_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_072095627.1|1158816_1159980_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000196151.1|1159987_1162168_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_080083562.1|1162164_1163574_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_154074481.1|1163638_1175113_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1175732_1176215_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1176364_1176841_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1176830_1177121_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1177286_1177625_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001525072.1|1177773_1179435_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_080083560.1|1179520_1180399_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1180521_1181112_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287931.1|1181146_1181752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1181872_1183159_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1183178_1183970_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1184135_1185497_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1185810_1186059_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1186077_1186626_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469807.1|1186670_1187438_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1187478_1187826_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001212379.1|1189195_1189714_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1190153_1191224_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_000225188.1|1191233_1192355_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000632386.1|1192412_1193321_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200080.1|1193281_1194442_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1194541_1194589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1194692_1195031_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197660.1|1195302_1196040_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1196171_1197152_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992639.1|1197148_1197880_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235092.1|1198009_1200583_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_000985653.1|1206357_1206813_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_079899153.1|1206916_1208218_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.1	3.4e-43
WP_001264473.1|1208214_1208538_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1208582_1209938_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_080083455.1|1210052_1212713_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000183642.1|1212766_1213447_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098732.1|1213519_1213939_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|1214142_1215180_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP045955	Salmonella enterica subsp. enterica serovar Enteritidis strain AUSMDU00010528 chromosome, complete genome	4703625	1690855	1700026	4703625	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1690855_1691803_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_079820938.1|1691786_1692518_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1692498_1692606_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1692665_1693397_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1693619_1695305_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1695301_1696021_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1696067_1696535_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1696591_1697122_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1697293_1697752_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1697992_1700026_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 3
NZ_CP045955	Salmonella enterica subsp. enterica serovar Enteritidis strain AUSMDU00010528 chromosome, complete genome	4703625	1767223	1777730	4703625		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144951.1|1767223_1768627_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|1768804_1769698_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1770074_1771160_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|1771159_1772059_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|1772106_1772985_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1772985_1773537_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018223.1|1773542_1774517_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1774532_1775306_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|1775310_1776390_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1776416_1777730_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NZ_CP045955	Salmonella enterica subsp. enterica serovar Enteritidis strain AUSMDU00010528 chromosome, complete genome	4703625	2583456	2673089	4703625	tRNA,integrase,tail,terminase,protease,holin,portal,lysis	Escherichia_phage(25.53%)	98	2624023:2624045	2670858:2670880
WP_001221014.1|2583456_2584152_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128807.1|2584209_2586120_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
WP_000029550.1|2586251_2586596_+	RidA family protein	NA	NA	NA	NA	NA
WP_000457328.1|2586601_2586781_-	YoaH family protein	NA	NA	NA	NA	NA
WP_079798329.1|2586861_2588226_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	35.3	1.5e-44
WP_000381531.1|2588229_2588808_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624277.1|2589071_2590436_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_080083509.1|2590573_2592175_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000421815.1|2592196_2593756_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
WP_000150521.1|2594228_2595197_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406918.1|2595249_2596050_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_001518647.1|2596062_2596914_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156274.1|2596971_2597430_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001518359.1|2597839_2598406_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_080083508.1|2598402_2599212_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_000730322.1|2599277_2601023_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_001062678.1|2601242_2601452_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001537930.1|2601464_2601608_-	YobF family protein	NA	NA	NA	NA	NA
WP_001000660.1|2602256_2602544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714547.1|2602614_2602758_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001236777.1|2602915_2603155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262195.1|2603366_2604158_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_000416128.1|2604333_2605707_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984498.1|2605754_2606636_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_080083507.1|2606829_2608878_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|2608897_2609584_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_000145727.1|2609681_2610266_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207294.1|2610307_2611591_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001535256.1|2611559_2614193_+	PqiB family protein	NA	NA	NA	NA	NA
WP_001670762.1|2614270_2615710_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_000978523.1|2615824_2616064_+	YebV family protein	NA	NA	NA	NA	NA
WP_000457836.1|2616174_2616366_+	YebW family protein	NA	NA	NA	NA	NA
WP_080083506.1|2616384_2617035_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	3.2e-58
WP_001134856.1|2617258_2617423_-	membrane protein	NA	NA	NA	NA	NA
WP_080083505.1|2617707_2618430_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_000422890.1|2619113_2619509_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	33.6	8.3e-17
WP_000030946.1|2619838_2620315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354407.1|2620701_2621121_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001752421.1|2621490_2621760_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
WP_001617922.1|2621925_2622066_+	hypothetical protein	NA	NA	NA	NA	NA
2624023:2624045	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_001233445.1|2625192_2626107_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|2626239_2626398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848069.1|2626407_2627022_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_001574229.1|2628169_2628295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001751604.1|2628863_2629064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001034748.1|2630513_2630702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|2630766_2630934_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001013467.1|2631710_2631941_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_072101013.1|2632130_2632625_+	RecE	NA	A0A0U2I1R6	Escherichia_phage	68.9	1.1e-21
WP_139770496.1|2632684_2633539_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.2	7.2e-74
WP_001536069.1|2634483_2635284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000161704.1|2635763_2636486_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000143175.1|2636681_2637257_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	90.5	3.4e-96
WP_154074522.1|2637256_2639455_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	53.7	3.0e-87
WP_000178851.1|2639508_2639751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077911794.1|2639789_2640665_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	79.7	1.5e-50
WP_001576012.1|2643211_2643916_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_023205988.1|2643813_2644551_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.2e-114
WP_023205989.1|2644560_2645256_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.7e-89
WP_000877926.1|2645345_2645879_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2645995_2646493_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978295.1|2646591_2646924_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_080083498.1|2646920_2649908_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.8	1.5e-264
WP_010989009.1|2649987_2650317_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478858.1|2650313_2650712_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_023205991.1|2650757_2651507_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.2	5.3e-89
WP_000196703.1|2651518_2651920_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000453194.1|2651916_2652483_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|2652463_2652763_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2652755_2653079_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|2653169_2655251_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_077679777.1|2655174_2656692_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_000196190.1|2656718_2656925_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|2656921_2659060_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|2659016_2659550_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|2659757_2660237_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2660254_2660707_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2660690_2661020_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|2661295_2661982_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798706.1|2662342_2662792_+	lipoprotein	NA	NA	NA	NA	NA
WP_080083499.1|2663165_2663690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|2663786_2664476_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|2664605_2664833_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940756.1|2664829_2665429_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	3.6e-96
WP_000911592.1|2665492_2665741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001597144.1|2665992_2666148_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	1.2e-14
WP_000687975.1|2666351_2666624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000089421.1|2666620_2667016_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.1	1.7e-17
WP_000140163.1|2667030_2667492_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.8e-67
WP_080083488.1|2667484_2667991_-	prepilin peptidase	NA	A0A0U2RT81	Escherichia_phage	68.9	9.2e-61
WP_000280163.1|2668612_2668798_+	DUF1187 family protein	NA	NA	NA	NA	NA
WP_001518052.1|2669088_2669313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001575998.1|2669385_2669664_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_022742740.1|2669638_2670718_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.8	1.3e-101
WP_000722368.1|2671100_2671454_-	YebY family protein	NA	NA	NA	NA	NA
2670858:2670880	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979706.1|2671470_2672346_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|2672346_2672721_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|2672858_2673089_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 5
NZ_CP045955	Salmonella enterica subsp. enterica serovar Enteritidis strain AUSMDU00010528 chromosome, complete genome	4703625	2974436	2981749	4703625	protease,integrase	Ralstonia_phage(16.67%)	7	2969232:2969246	2980485:2980499
2969232:2969246	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_023228156.1|2974436_2974814_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|2974975_2975173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2975385_2977662_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2977692_2978013_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_080083530.1|2978336_2978558_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	7.2e-18
WP_000125894.1|2978687_2980634_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
2980485:2980499	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201751.1|2980630_2981749_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
