The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046006	Escherichia coli strain 1919D3 chromosome, complete genome	4710181	1035256	1048439	4710181		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1035256_1036018_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1036011_1036638_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|1036777_1037917_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1037979_1038972_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104429.1|1039065_1040430_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1040518_1041295_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1041299_1041938_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_097433311.1|1041934_1043197_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	1.4e-134
WP_000847985.1|1043193_1044102_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1044297_1045065_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141340.1|1045115_1045772_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_097433310.1|1045877_1048439_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	1.1e-29
>prophage 2
NZ_CP046006	Escherichia coli strain 1919D3 chromosome, complete genome	4710181	1652572	1662014	4710181		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569329.1|1652572_1653499_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1653503_1654235_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|1654215_1654323_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1654382_1655114_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1655335_1657021_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1657017_1657737_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1657783_1658254_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1658294_1658756_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001349936.1|1658880_1660881_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001292769.1|1660877_1662014_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 3
NZ_CP046006	Escherichia coli strain 1919D3 chromosome, complete genome	4710181	2407198	2513721	4710181	tRNA,transposase,integrase,lysis,terminase,tail	Escherichia_phage(46.15%)	96	2462331:2462373	2508343:2508385
WP_154166429.1|2407198_2408568_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001320773.1|2408703_2408853_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|2408924_2409098_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001307188.1|2409342_2409873_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000115944.1|2411104_2412544_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027942.1|2412740_2413541_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139567.1|2413812_2417715_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048948.1|2417915_2418521_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627379.1|2418571_2419888_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_124884751.1|2419877_2421635_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000890933.1|2421650_2422547_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_154166430.1|2422546_2423152_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000097801.1|2425691_2426552_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_096310736.1|2426760_2429172_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_010723099.1|2432102_2432168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024245227.1|2432271_2432862_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039879.1|2432843_2433794_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632286.1|2433894_2435208_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206186.1|2435234_2436440_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|2436439_2436862_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_097433402.1|2436851_2438279_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969780.1|2438280_2439069_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|2439068_2439836_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206374.1|2439832_2440903_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189197.1|2440910_2441408_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072831.1|2441422_2442169_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2442177_2442465_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191073.1|2442476_2443406_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_032252644.1|2443690_2445736_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535449.1|2445983_2448257_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|2448314_2449814_-	NAD-dependent phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067509.1|2450049_2450955_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001296730.1|2451126_2451453_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698140.1|2451460_2451646_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900966.1|2451642_2454282_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|2454489_2455479_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001298828.1|2455589_2456012_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2456008_2456275_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_097433404.1|2456548_2460073_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837924.1|2460439_2461573_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|2461713_2462148_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
2462331:2462373	attL	AAAATCAAGAAATTAGTAAGAAAGAACAATACAACCTGAACAA	NA	NA	NA	NA
WP_120795384.1|2462924_2463038_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2463106_2463340_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|2463656_2464247_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885584.1|2464344_2464920_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	8.5e-103
WP_154166431.1|2464919_2468270_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001230279.1|2468334_2468934_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	1.3e-109
WP_154166432.1|2469000_2472399_-	DUF1983 domain-containing protein	NA	A0A0K2FI38	Escherichia_phage	90.4	0.0e+00
WP_001399694.1|2472458_2473106_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	1.2e-110
WP_032147298.1|2473003_2473747_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.9	2.8e-146
WP_154166433.1|2473752_2474451_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.4	1.6e-127
WP_000024051.1|2474450_2474789_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_112794010.1|2474781_2478015_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.6	9.3e-114
WP_012565075.1|2478488_2478848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154166434.1|2479030_2479960_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.3	5.6e-56
WP_000673077.1|2479986_2480379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029820.1|2480375_2480756_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	43.6	3.3e-18
WP_001612943.1|2480756_2481140_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	4.9e-14
WP_000634214.1|2481139_2481535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000918487.1|2481757_2482897_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000770041.1|2482995_2483760_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	63.8	4.5e-83
WP_001363932.1|2483864_2484977_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_000763702.1|2484960_2486367_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.2	1.0e-186
WP_000625348.1|2486369_2487671_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000089447.1|2487651_2488746_-	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
WP_000126788.1|2488749_2488959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204037.1|2488936_2489869_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_112978883.1|2489861_2490653_-	transcriptional regulator	NA	R4TG31	Halovirus	39.8	4.8e-48
WP_001097895.1|2490790_2492248_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228688.1|2492444_2492630_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_000900879.1|2492846_2493164_-	lysozyme	NA	A0A2I6TCA1	Escherichia_phage	98.1	1.2e-55
WP_085947598.1|2493221_2494384_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_021554374.1|2494992_2496354_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_021554373.1|2496563_2496986_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	87.8	5.3e-62
WP_024238604.1|2497002_2497728_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.4	3.0e-81
WP_000788982.1|2497750_2498497_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	80.9	1.3e-114
WP_000693803.1|2499368_2499791_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072337.1|2499787_2500042_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|2500121_2500541_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_000233809.1|2500827_2500962_+	phage protein	NA	NA	NA	NA	NA
WP_154166435.1|2500972_2501128_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.2e-07
WP_001312793.1|2501124_2501613_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2502054_2502276_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2502275_2502446_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2502520_2502796_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_112978995.1|2502897_2505498_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	5.7e-247
WP_000166319.1|2505490_2506300_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2506356_2506551_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2506543_2506753_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2506831_2507047_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040858.1|2507048_2508284_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.6e-239
WP_154166436.1|2508335_2509271_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.7e-145
2508343:2508385	attR	AAAATCAAGAAATTAGTAAGAAAGAACAATACAACCTGAACAA	NA	NA	NA	NA
WP_000123739.1|2509399_2510773_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001296046.1|2510802_2510976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|2511250_2512234_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|2512488_2513721_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 4
NZ_CP046006	Escherichia coli strain 1919D3 chromosome, complete genome	4710181	3053632	3083750	4710181	holin,capsid,portal,integrase,head,terminase,tail	Cronobacter_phage(78.79%)	38	3047650:3047678	3088471:3088499
3047650:3047678	attL	GTAGGCCTGATAAGCGTAGCGCATCAGGC	NA	NA	NA	NA
WP_000787654.1|3053632_3053965_-	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	50.0	1.3e-23
WP_040080364.1|3054055_3055756_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	79.2	1.5e-227
WP_000200800.1|3055758_3056304_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	74.7	5.3e-62
WP_000267961.1|3056275_3057001_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.0	5.5e-67
WP_000143182.1|3056990_3057578_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	56.0	1.2e-56
WP_040080365.1|3057577_3059155_-|tail	tail protein	tail	F1BUK3	Cronobacter_phage	81.9	2.4e-131
WP_040080366.1|3059165_3059753_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	4.5e-91
WP_040080367.1|3059745_3060930_-	phage protein	NA	F1BUK6	Cronobacter_phage	79.1	8.2e-177
WP_040080368.1|3060926_3061256_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	71.4	3.2e-38
WP_040080369.1|3061252_3063220_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.5	3.0e-272
WP_040080370.1|3063407_3063665_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	62.2	4.7e-21
WP_040080372.1|3063811_3064150_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	60.4	1.2e-27
WP_000175563.1|3064149_3064491_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	92.1	9.9e-51
WP_001155239.1|3064477_3064780_-|holin	holin	holin	Q6K1I2	Salmonella_virus	58.1	4.7e-20
WP_000166744.1|3064789_3065245_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.2	2.5e-57
WP_040080373.1|3065241_3066369_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	81.3	1.5e-172
WP_040080374.1|3066365_3067073_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	78.2	8.8e-102
WP_040080375.1|3067069_3067576_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.7	9.5e-66
WP_040080391.1|3067572_3068061_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	1.2e-62
WP_040080376.1|3068121_3068823_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	68.1	1.4e-88
WP_040080377.1|3068826_3069849_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	82.6	1.9e-161
WP_040080378.1|3069911_3070715_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	55.1	3.8e-77
WP_040080379.1|3070876_3072652_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	85.8	2.3e-292
WP_040080380.1|3072648_3073710_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	78.0	5.5e-164
WP_012602735.1|3073706_3074030_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	93.3	4.7e-50
WP_040080381.1|3074003_3074210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040080382.1|3074329_3076351_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	4.7e-297
WP_040080383.1|3076347_3077208_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	83.1	4.9e-131
WP_040080384.1|3077198_3077432_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_040080385.1|3077499_3077901_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	2.2e-49
WP_040080386.1|3077900_3078329_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	55.4	4.3e-27
WP_000460875.1|3078520_3079024_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	71.9	1.3e-59
WP_001247709.1|3079054_3079276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102873.1|3079411_3079993_+	phage repressor protein	NA	F1BUS8	Erwinia_phage	40.3	1.9e-33
WP_000116246.1|3079994_3081035_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	62.9	1.4e-119
WP_001001761.1|3081202_3081331_+	manganase accumulation protein MntS	NA	NA	NA	NA	NA
WP_001054679.1|3081602_3083186_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001295296.1|3083234_3083750_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
3088471:3088499	attR	GCCTGATGCGCTACGCTTATCAGGCCTAC	NA	NA	NA	NA
>prophage 5
NZ_CP046006	Escherichia coli strain 1919D3 chromosome, complete genome	4710181	3690027	3717347	4710181	plate,transposase	Clostridioides_phage(25.0%)	24	NA	NA
WP_000006261.1|3690027_3690525_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000543899.1|3690700_3691474_-	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|3691659_3691920_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615976.1|3691922_3692201_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|3692356_3693097_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|3693067_3693835_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3694040_3694619_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973081.1|3694858_3697303_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|3697345_3697819_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118037.1|3697972_3698740_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000420818.1|3698783_3699920_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001101839.1|3700350_3700743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053901242.1|3700720_3704941_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_000103355.1|3705016_3707158_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.8e-25
WP_001142958.1|3707367_3707886_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037395.1|3708581_3709082_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3709116_3709341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096310756.1|3709391_3710867_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_096310758.1|3710873_3711287_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_154166461.1|3711290_3713141_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_097433548.1|3713104_3714187_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113703.1|3714211_3715492_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080144.1|3715488_3716013_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246416.1|3716015_3717347_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 1
NZ_CP046004	Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence	219101	12592	55609	219101	transposase,integrase	Salmonella_phage(30.77%)	37	34199:34258	57509:57690
WP_001086279.1|12592_13774_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001324690.1|13988_14201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807689.1|15786_16542_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
WP_001232452.1|18026_19100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247564.1|19176_19320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000416123.1|19355_19832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000111572.1|19979_20255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011011074.1|20244_20445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000341067.1|20511_20904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024156253.1|21240_21498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094323890.1|22617_23538_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_094309310.1|23527_24685_+	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_001120888.1|25023_26517_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_136655509.1|26878_28492_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	30.9	1.1e-30
WP_136655510.1|28539_29169_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	37.1	8.3e-19
WP_136655511.1|29391_29847_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144314414.1|29878_31225_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001447541.1|31255_32140_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_136655512.1|32356_33571_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	4.2e-19
WP_001255015.1|33598_33904_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
34199:34258	attL	CTCCAAAGCCCGCGACGCAGCGCCGGCAGGCAGAGCAAGTAGAGGGCAGCGCCTGCAATC	NA	NA	NA	NA
WP_011264039.1|37518_37758_+	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_000612791.1|37903_38767_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|38804_39050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|39518_40310_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_000800531.1|41489_41822_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_001206316.1|41991_42783_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|42875_44135_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206356.1|44396_45188_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|45193_45484_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|45595_46093_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|46237_47251_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_081316080.1|47219_47804_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|47929_48490_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|48492_51459_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_034167420.1|52602_52797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|53725_54430_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000844627.1|55366_55609_+|transposase	transposase	transposase	NA	NA	NA	NA
57509:57690	attR	GATTGCAGGCGCTGCCCTCTACTTGCTCTGCCTGCCGGCGCTGCGTCGCGGGCTTTGGAGCGGCGCAGGGCAACGAGCCGATCGCTGATCGTGGAAACGATAGGCCTATGCCATGCGGGTCAAGGCGACTTCCGGCAAGCTATACGCGCCCTAGGAGTGCGGTTGGAACGTTGGCCCAGCCA	NA	NA	NA	NA
>prophage 2
NZ_CP046004	Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence	219101	65192	73451	219101	transposase,integrase	Escherichia_phage(42.86%)	10	70452:70466	75292:75306
WP_001067858.1|65192_65897_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_063102497.1|66090_66477_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_000084745.1|66796_67189_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_136655513.1|68299_69004_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	9.9e-138
WP_020219413.1|69015_69156_-	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	93.8	1.3e-09
WP_001235713.1|69319_69877_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|70059_70920_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
70452:70466	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
WP_001067855.1|71334_72039_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_072041844.1|72085_72469_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|72437_73451_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
75292:75306	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
>prophage 1
NZ_CP046005	Escherichia coli strain 1919D3 plasmid p1919D3-2, complete sequence	95543	0	95478	95543	integrase,holin,tail,head	Escherichia_phage(65.06%)	91	11822:11838	59466:59482
WP_001615631.1|0_810_+	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	100.0	1.3e-146
WP_001369095.1|860_1106_+	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
WP_000887491.1|1230_1443_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000509939.1|1561_2071_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_000035301.1|2082_2664_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.4	7.3e-102
WP_000041772.1|2699_3515_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.5	1.4e-111
WP_000085146.1|3524_5114_-	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	98.9	4.0e-304
WP_000067710.1|5174_6881_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	100.0	0.0e+00
WP_000038866.1|7106_8108_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_001285362.1|8124_9321_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_001154687.1|9489_10299_-	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	97.8	7.1e-156
WP_001113742.1|10591_11476_-	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
WP_152961024.1|11811_12204_-	hypothetical protein	NA	Q1MVJ1	Enterobacteria_phage	93.8	5.1e-67
11822:11838	attL	CTTTCGATAAGAAGACC	NA	NA	NA	NA
WP_000007772.1|12381_12804_-	hypothetical protein	NA	Q71TL5	Escherichia_phage	87.9	3.0e-57
WP_048266579.1|12843_13632_-	hypothetical protein	NA	A0A077SK48	Escherichia_phage	98.5	7.5e-118
WP_001311689.1|13640_13820_-	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	100.0	3.1e-27
WP_001177860.1|14094_14379_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
WP_048266578.1|14371_15277_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.0	2.2e-158
WP_077151004.1|15273_18561_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	98.4	0.0e+00
WP_002433497.1|19856_20327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194035.1|20289_21000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214385.1|21053_21386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000535211.1|21503_22112_-	hypothetical protein	NA	A0A1B0V872	Salmonella_phage	91.4	1.3e-82
WP_042032533.1|22104_23121_-	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	99.1	1.5e-190
WP_032163782.1|23122_23908_-	hypothetical protein	NA	A0A1B0V7N6	Salmonella_phage	99.6	1.6e-144
WP_000896801.1|23894_24623_-	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_001141908.1|24626_25844_-	hypothetical protein	NA	A0A077SL53	Escherichia_phage	100.0	1.1e-224
WP_000235786.1|25853_26231_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_032163781.1|26377_26623_+	hypothetical protein	NA	Q71T86	Escherichia_phage	98.8	2.1e-39
WP_000008815.1|27271_27427_+	hypothetical protein	NA	Q1MVH0	Enterobacteria_phage	96.1	2.7e-19
WP_000484108.1|27928_28555_+	norphogenetic protein	NA	Q71T82	Escherichia_phage	99.0	4.0e-122
WP_024262884.1|28551_29229_+	serine/threonine protein phosphatase	NA	Q71TJ1	Escherichia_phage	96.4	6.2e-129
WP_000684869.1|29225_29927_+	hypothetical protein	NA	Q71TJ0	Escherichia_phage	97.0	4.3e-141
WP_154166351.1|30228_31491_+	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	98.8	3.3e-232
WP_097475762.1|31563_32070_+	3'-phosphatase	NA	A0A1B0VAK0	Salmonella_phage	98.8	1.2e-92
WP_154166352.1|32336_35453_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	2.2e-27
WP_154166353.1|35574_36849_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	30.5	2.8e-21
WP_072716651.1|36845_38402_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	1.1e-104
WP_001190712.1|38584_38806_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_024233187.1|38805_39186_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	4.3e-63
WP_009446826.1|39190_39370_+	hypothetical protein	NA	Q1MVE4	Enterobacteria_phage	100.0	9.2e-24
WP_024233186.1|39397_40441_+	DUF968 domain-containing protein	NA	Q1MVE3	Enterobacteria_phage	99.4	8.8e-207
WP_001326849.1|40529_40982_+	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
WP_024233185.1|41067_42261_+	hypothetical protein	NA	A0A077SL59	Escherichia_phage	99.2	2.0e-178
WP_032163774.1|42260_43745_+	hypothetical protein	NA	Q71T61	Escherichia_phage	98.4	2.9e-288
WP_071527722.1|43966_44086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071952721.1|44104_44326_+	host cell division inhibitor Icd-like protein	NA	A0A077SLM6	Escherichia_phage	78.8	7.9e-25
WP_047615714.1|44322_45435_+	antirepressor	NA	A0A077SLR9	Escherichia_phage	86.0	3.2e-175
WP_000611656.1|45467_46319_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_000874156.1|46429_46639_-	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_000542385.1|47243_47465_+	hypothetical protein	NA	Q38403	Escherichia_phage	100.0	2.6e-36
WP_000067530.1|47472_48504_+|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	100.0	9.9e-195
WP_001224236.1|48554_48866_+	hypothetical protein	NA	A0A077SK03	Escherichia_phage	99.0	2.3e-46
WP_000848375.1|49112_49673_+	recombinase	NA	A0A077SL37	Escherichia_phage	100.0	5.0e-100
WP_154166354.1|49861_50503_+	maturation control protein	NA	A0A1B0VAG4	Salmonella_phage	93.4	2.6e-108
WP_064670748.1|50545_51496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000747846.1|51557_51806_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_000224043.1|51802_52243_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_154166355.1|52276_59044_-	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.3	0.0e+00
WP_000774702.1|59119_60829_+	hypothetical protein	NA	A0A1B0V850	Salmonella_phage	99.5	0.0e+00
59466:59482	attR	CTTTCGATAAGAAGACC	NA	NA	NA	NA
WP_073884952.1|60821_61841_+|head	head processing protein	head	Q71TR6	Escherichia_phage	96.5	1.7e-178
WP_001467310.1|62132_62690_-	lysozyme	NA	Q71TF3	Escherichia_phage	98.4	3.0e-105
WP_000068865.1|62859_63348_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	100.0	5.0e-88
WP_154166356.1|63545_64340_+	hypothetical protein	NA	Q71TF1	Escherichia_phage	99.6	8.3e-149
WP_124884878.1|65560_69343_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	35.1	1.7e-111
WP_015974234.1|70336_70942_+	hypothetical protein	NA	O21975	Escherichia_phage	100.0	2.0e-115
WP_015974235.1|71053_71362_-	hypothetical protein	NA	O21974	Escherichia_phage	100.0	6.4e-49
WP_154166359.1|71351_72629_-	ddrB domain protein	NA	A0A1B0VFX4	Salmonella_phage	98.6	4.2e-235
WP_104920450.1|73052_73418_-	ddrA	NA	A0A1B0V846	Salmonella_phage	95.8	1.1e-44
WP_154166357.1|73414_75334_-	hypothetical protein	NA	A0A077SLK4	Escherichia_phage	95.6	0.0e+00
WP_002433476.1|75335_75938_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	98.5	3.0e-98
WP_000580770.1|75924_76368_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	99.3	2.9e-82
WP_000887652.1|76364_76694_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_029397816.1|76884_77151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029397815.1|77175_77727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029397814.1|77719_78862_+	lipopolysaccharide N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_029397813.1|78914_79493_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	57.3	5.4e-57
WP_064756713.1|80389_82624_-	hypothetical protein	NA	A0A077SK37	Escherichia_phage	79.6	1.7e-252
WP_001286326.1|82635_83070_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
WP_001189838.1|83148_83985_-	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	99.3	5.8e-153
WP_000047920.1|83984_85418_-	bleomycin hydrolase	NA	Q71TP2	Escherichia_phage	100.0	6.3e-272
WP_000002800.1|85414_85771_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_048266591.1|85770_89193_-	transglycosylase SLT domain-containing protein	NA	A0A077SK38	Escherichia_phage	95.4	0.0e+00
WP_048266592.1|89274_90156_-	hypothetical protein	NA	A0A1B0VBL3	Salmonella_phage	99.3	1.8e-173
WP_000506612.1|90170_90782_-	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.0	8.4e-109
WP_023155386.1|90792_91359_-	hypothetical protein	NA	A0A077SK12	Escherichia_phage	98.9	1.5e-99
WP_048266593.1|91568_92348_-	hypothetical protein	NA	Q71TC6	Escherichia_phage	100.0	4.3e-150
WP_048266594.1|92355_92673_-	hypothetical protein	NA	Q71TC5	Escherichia_phage	93.3	6.2e-23
WP_154166358.1|93252_93474_+	host cell division inhibitor Icd-like protein	NA	Q38414	Enterobacteria_phage	97.3	1.4e-37
WP_032162325.1|93470_94514_+	antirepressor	NA	Q71TN2	Escherichia_phage	96.3	1.2e-182
WP_001187871.1|94677_95478_+	protein kilA	NA	Q1MVK4	Enterobacteria_phage	99.6	5.4e-148
