The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046009	Escherichia coli strain 1919D62 chromosome, complete genome	4669207	807071	853255	4669207	integrase,protease,transposase,tRNA	uncultured_marine_virus(20.0%)	48	800051:800099	819523:819571
800051:800099	attL	TGGTGCCCGGACTCGGAATCGAACCAAGGACACGGGGATTTTCAATCCC	NA	NA	NA	NA
WP_001352368.1|807071_808280_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_032165642.1|808403_809117_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_064670466.1|809219_809969_-	DUF3944 domain-containing protein	NA	NA	NA	NA	NA
WP_064669692.1|810112_810496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072015373.1|810573_810813_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047603611.1|810791_811256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154166946.1|811313_811742_-	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_054623357.1|811788_812220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042111456.1|812212_812566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042111457.1|813015_814206_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B3AZY4	Gordonia_phage	27.3	3.6e-15
WP_054623355.1|814279_816211_+	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_054623354.1|816285_816636_+	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_054623353.1|816687_817875_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	32.0	2.8e-31
WP_077760546.1|818220_818754_-	hypothetical protein	NA	O21975	Escherichia_phage	57.5	8.0e-55
WP_000234514.1|819703_820411_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
819523:819571	attR	TGGTGCCCGGACTCGGAATCGAACCAAGGACACGGGGATTTTCAATCCC	NA	NA	NA	NA
WP_001326492.1|820808_822944_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001049791.1|822993_824250_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000760323.1|824451_825531_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|825595_825871_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001321419.1|825898_826951_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786911.1|827111_827831_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107564.1|827830_828157_+	DUF469 domain-containing protein	NA	NA	NA	NA	NA
WP_000984796.1|828340_829060_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394132.1|829235_830282_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_095885568.1|830398_831406_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000378946.1|831461_832763_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000577033.1|832762_833266_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000784004.1|833310_834297_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_095885569.1|834610_835747_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174743.1|835739_836333_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000994920.1|836340_836631_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|836627_837194_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997795.1|837211_837916_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001326494.1|837933_838914_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_106918370.1|839140_840121_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000017106.1|840376_840793_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053178.1|840792_841356_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593273.1|841464_842415_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001300912.1|842427_843159_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286500.1|843238_843946_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001300769.1|844040_844538_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_096310327.1|844614_846009_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_001062128.1|846432_847587_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001297406.1|848241_848373_+	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001300904.1|848381_850358_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000758905.1|850503_851235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000105566.1|851370_852291_+	agmatinase	NA	NA	NA	NA	NA
WP_001319878.1|852496_853255_-|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
>prophage 2
NZ_CP046009	Escherichia coli strain 1919D62 chromosome, complete genome	4669207	1110372	1117512	4669207		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1110372_1111011_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1111007_1112270_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|1112266_1113175_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001300386.1|1113370_1114138_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1114188_1114845_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_096310198.1|1114950_1117512_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 3
NZ_CP046009	Escherichia coli strain 1919D62 chromosome, complete genome	4669207	1703177	1712618	4669207		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569357.1|1703177_1704104_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1704108_1704840_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1704820_1704928_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1704987_1705719_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1705940_1707626_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1707622_1708342_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1708388_1708859_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1708898_1709360_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001375261.1|1709484_1711485_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001333512.1|1711481_1712618_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 4
NZ_CP046009	Escherichia coli strain 1919D62 chromosome, complete genome	4669207	2232155	2299043	4669207	tail,portal,protease,transposase,terminase,lysis	Enterobacteria_phage(43.75%)	75	NA	NA
WP_001260865.1|2232155_2232977_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2233076_2233160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743957.1|2233253_2233589_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2233985_2235239_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019525.1|2235345_2236239_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2236373_2237594_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2237718_2238414_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071787903.1|2238366_2239659_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2239817_2240432_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|2240474_2241329_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2241330_2241948_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001433342.1|2241958_2244382_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.8e-208
WP_154167031.1|2244442_2246869_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.3	3.5e-214
WP_001300836.1|2247067_2247373_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2247480_2248191_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2248193_2248754_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_154167032.1|2248788_2249130_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2249264_2249591_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2249796_2251011_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836066.1|2251022_2252042_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|2252099_2252210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876991.1|2252229_2253510_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.1	1.9e-155
WP_001296941.1|2253544_2253781_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048360.1|2253868_2256340_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083271.1|2256433_2256625_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854559.1|2256621_2256810_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000159335.1|2257312_2257513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097765333.1|2257481_2257847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001580454.1|2257858_2258011_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	2.5e-06
WP_000233319.1|2258309_2258729_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|2258808_2259063_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693853.1|2259059_2259485_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262357.1|2259556_2260627_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_001151199.1|2260667_2261090_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	84.9	2.0e-61
WP_001339197.1|2262341_2263550_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_154167155.1|2264171_2265041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154167033.1|2265447_2265555_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	1.1e-08
WP_000887491.1|2265599_2265812_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_001325325.1|2266270_2266549_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	7.4e-12
WP_001265274.1|2266550_2267600_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.2	3.0e-114
WP_001204786.1|2267617_2267995_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	81.7	6.9e-53
WP_000780584.1|2268150_2268675_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_032264514.1|2268867_2269827_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000120340.1|2270233_2270947_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000839587.1|2271137_2271353_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	2.9e-32
WP_000189918.1|2271357_2271669_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
WP_001092967.1|2271665_2272199_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	92.7	4.2e-96
WP_001071773.1|2272195_2272693_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066495.1|2273056_2273269_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2273279_2273468_+	cold-shock protein	NA	NA	NA	NA	NA
WP_122134696.1|2273470_2273536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001447381.1|2273615_2273771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|2273943_2274117_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|2274412_2274619_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_000373425.1|2275170_2275665_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000934104.1|2275664_2277767_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|2277763_2277976_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_124884858.1|2277975_2278350_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.2	5.2e-61
WP_085947772.1|2278342_2279556_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001583540.1|2280689_2282720_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_001097053.1|2282806_2283130_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	2.5e-51
WP_001283153.1|2283122_2283398_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_098734318.1|2283409_2283988_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	1.6e-101
WP_001079408.1|2283984_2284386_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	7.0e-72
WP_000211105.1|2284396_2285140_+|tail	phage tail protein	tail	K7PGT7	Enterobacteria_phage	98.0	5.6e-131
WP_024198591.1|2285200_2285593_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	9.0e-64
WP_001161009.1|2285601_2285931_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_098734319.1|2285902_2288968_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.6	0.0e+00
WP_000447253.1|2288967_2289297_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_154167034.1|2289306_2290005_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	95.7	1.1e-128
WP_112793688.1|2290010_2290754_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	5.2e-145
WP_112978880.1|2290690_2291287_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	93.9	3.8e-90
WP_154167035.1|2291358_2294772_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	96.5	0.0e+00
WP_001230352.1|2294841_2295441_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.3e-109
WP_000885587.1|2298467_2299043_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	2.0e-104
>prophage 5
NZ_CP046009	Escherichia coli strain 1919D62 chromosome, complete genome	4669207	2502203	2510812	4669207	transposase,tRNA	Enterobacteria_phage(28.57%)	8	NA	NA
WP_077039487.1|2502203_2503067_+	porin	NA	Q1MVN1	Enterobacteria_phage	60.1	8.0e-89
WP_001339197.1|2503170_2504379_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_154167156.1|2504417_2504675_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	49.4	2.1e-16
WP_001300461.1|2504815_2505250_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000081418.1|2505426_2506362_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_000123745.1|2506490_2507864_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2508341_2509325_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|2509579_2510812_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 6
NZ_CP046009	Escherichia coli strain 1919D62 chromosome, complete genome	4669207	2695193	2702897	4669207	transposase	Enterobacteria_phage(33.33%)	7	NA	NA
WP_154167060.1|2695193_2695853_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	49.5	6.8e-48
WP_001339197.1|2695821_2697030_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_154167061.1|2697555_2698829_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.6e-176
WP_032082692.1|2699234_2699345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001339197.1|2699521_2700730_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_112978767.1|2701220_2701544_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	64.5	4.4e-40
WP_000444488.1|2701646_2702897_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	3.2e-22
>prophage 7
NZ_CP046009	Escherichia coli strain 1919D62 chromosome, complete genome	4669207	2828387	2869842	4669207	protease,transposase	uncultured_marine_virus(20.0%)	38	NA	NA
WP_001352368.1|2828387_2829596_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000535362.1|2831049_2832306_-	YccE family protein	NA	NA	NA	NA	NA
WP_000420621.1|2832566_2833487_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_000024560.1|2833486_2833792_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209868.1|2833884_2834484_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_094337033.1|2834480_2837027_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	7.7e-71
WP_001230242.1|2837026_2838199_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|2838328_2839021_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_094337034.1|2838993_2840022_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_096310585.1|2840104_2842849_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	4.6e-37
WP_016244489.1|2842920_2843994_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|2844041_2844215_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309400.1|2844204_2844435_-	protein YmcE	NA	NA	NA	NA	NA
WP_001352368.1|2844519_2845728_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000066490.1|2845946_2846159_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|2846444_2846657_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_096310583.1|2847098_2847383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947598.1|2847396_2848559_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_095885472.1|2848771_2849416_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_095885471.1|2849412_2850159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000742329.1|2850158_2852255_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295357.1|2852300_2853440_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|2853427_2853874_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208668.1|2853893_2856074_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_094337278.1|2856193_2857492_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000270305.1|2857567_2857660_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460792.1|2857672_2858809_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_001599662.1|2858820_2860365_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_094337276.1|2860498_2861356_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063978.1|2861352_2861751_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003670.1|2861747_2862335_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|2862331_2863039_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|2863057_2864851_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|2864847_2865966_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_154167067.1|2866686_2867346_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	3.1e-48
WP_000904442.1|2867436_2867766_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000048252.1|2867762_2868041_-	acylphosphatase	NA	NA	NA	NA	NA
WP_001339197.1|2868633_2869842_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 8
NZ_CP046009	Escherichia coli strain 1919D62 chromosome, complete genome	4669207	2925283	2987196	4669207	capsid,protease,tRNA,terminase,integrase,head	Bacillus_phage(20.0%)	53	2976889:2976906	2987363:2987380
WP_001298300.1|2925283_2926069_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899599.1|2926204_2926984_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436922.1|2926960_2927854_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011590.1|2928007_2928754_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_044380638.1|2928750_2928933_-	protein YcaR	NA	NA	NA	NA	NA
WP_096310014.1|2928984_2930217_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570540.1|2930253_2931240_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|2931236_2932985_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705765.1|2933021_2935286_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|2935493_2935778_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|2935937_2937611_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|2937721_2938405_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_114493368.1|2938577_2939342_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000445231.1|2939510_2940794_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057138.1|2940864_2941953_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000642849.1|2942151_2942844_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001295344.1|2942973_2944734_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642546.1|2945139_2945997_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|2946051_2948334_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|2948525_2949266_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001190363.1|2949347_2949938_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_094337264.1|2950037_2950946_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000918506.1|2950946_2952377_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109259.1|2952586_2953735_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165879.1|2954048_2954675_+	hydrolase	NA	NA	NA	NA	NA
WP_000534637.1|2954709_2955573_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213098.1|2955574_2956192_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850303.1|2956202_2958647_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000886683.1|2958885_2960178_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|2960268_2961612_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|2961622_2962234_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_154167069.1|2962388_2966495_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|2966629_2967124_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|2967668_2968634_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043621.1|2968756_2970523_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202201.1|2970523_2972245_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
WP_001241677.1|2972286_2972991_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2973275_2973494_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934034.1|2974176_2976453_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.1e-166
WP_000520781.1|2976483_2976804_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
2976889:2976906	attL	ATGATAGATAACTATCAT	NA	NA	NA	NA
WP_021540210.1|2977590_2977881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835287.1|2978138_2978681_-|terminase	terminase	terminase	O64316	Escherichia_phage	47.5	3.2e-35
WP_001178671.1|2978882_2979266_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001595597.1|2979277_2979619_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000228106.1|2979628_2980669_-|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.2	3.0e-66
WP_000126656.1|2980886_2981309_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000125507.1|2981305_2981551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000710150.1|2981838_2983656_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.7	1.5e-129
WP_001261502.1|2983652_2983952_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_077150795.1|2983958_2984279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001396399.1|2984271_2985318_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001206975.1|2985328_2985538_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	71.4	1.5e-17
WP_000092883.1|2985957_2987196_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.5	4.0e-126
2987363:2987380	attR	ATGATAGATAACTATCAT	NA	NA	NA	NA
>prophage 9
NZ_CP046009	Escherichia coli strain 1919D62 chromosome, complete genome	4669207	3589496	3659419	4669207	plate,holin,transposase	Streptococcus_phage(16.67%)	57	NA	NA
WP_000131044.1|3589496_3591530_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3591658_3592246_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_001514956.1|3592259_3593732_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3593745_3595416_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3595628_3596297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3596539_3597235_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|3597227_3598655_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3598665_3599385_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_154167098.1|3599911_3600766_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_097510515.1|3600991_3602317_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	1.4e-113
WP_000474077.1|3602425_3602662_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3602673_3603267_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_154167159.1|3603425_3604295_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	2.5e-53
WP_001339197.1|3605359_3606568_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000662258.1|3612221_3612323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3612686_3612950_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001147279.1|3613124_3613352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|3614175_3614718_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3614792_3615380_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716383.1|3615437_3616106_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_154167099.1|3616131_3618657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310578.1|3618646_3620290_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_154167100.1|3620258_3620969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303809.1|3621281_3621611_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000070700.1|3622890_3623580_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_096310772.1|3623576_3624533_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_154167101.1|3624529_3626728_+	molybdopterin-dependent oxidoreductase	NA	A0A0P0I429	Acinetobacter_phage	25.8	6.0e-40
WP_021577022.1|3626737_3627694_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111356.1|3627672_3628083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053901250.1|3628399_3629653_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
WP_001285288.1|3629664_3630768_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_053901249.1|3631055_3632111_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	3.1e-119
WP_154167102.1|3632149_3632551_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|3632608_3633853_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3633944_3634403_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293003.1|3634663_3636121_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_154167103.1|3636177_3636792_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_154167104.1|3636788_3637940_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	1.2e-31
WP_001059847.1|3638173_3638626_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001226164.1|3638622_3639678_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_154167105.1|3640479_3642219_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000598760.1|3642323_3642602_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_001030484.1|3642594_3642951_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001353765.1|3643007_3643781_-	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|3643966_3644227_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615979.1|3644229_3644508_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|3644663_3645404_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333379.1|3645374_3646142_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3646347_3646926_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973083.1|3647165_3649610_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|3649652_3650126_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118036.1|3650279_3651050_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_032299509.1|3651270_3652407_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_122985282.1|3653717_3653903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939262.1|3653817_3654300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154167106.1|3657140_3658373_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3658336_3659419_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 1
NZ_CP046007	Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence	186058	0	27815	186058	transposase,integrase	Escherichia_phage(33.33%)	26	22466:22478	29504:29516
WP_000845048.1|0_1014_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_072041844.1|982_1366_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|1412_2117_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000844102.1|2178_2376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|2531_3392_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|3574_4132_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001067858.1|4857_5562_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_072319970.1|5616_6033_+	resolvase	NA	A0A219YB42	Aeromonas_phage	44.0	1.4e-17
WP_001516695.1|6351_7008_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001067855.1|7613_8318_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001255015.1|11156_11462_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_136655512.1|11489_12704_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	4.2e-19
WP_001447541.1|12920_13805_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_144314413.1|13835_15329_-|transposase	IS91-like element ISVsa3 family transposase	transposase	NA	NA	NA	NA
WP_094309310.1|15667_16825_-	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_094323890.1|16814_17735_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024156253.1|18854_19112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341067.1|19448_19841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011011074.1|19907_20108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000111572.1|20097_20373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000416123.1|20520_20997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247564.1|21032_21176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232452.1|21252_22326_-	hypothetical protein	NA	NA	NA	NA	NA
22466:22478	attL	AAAAGTTACTTTT	NA	NA	NA	NA
WP_000807689.1|23865_24621_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
WP_001324690.1|26206_26419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086279.1|26633_27815_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
29504:29516	attR	AAAAGTAACTTTT	NA	NA	NA	NA
>prophage 1
NZ_CP046008	Escherichia coli strain 1919D62 plasmid p1919D62-2, complete sequence	114129	0	114122	114129	transposase,tail,integrase,terminase	Salmonella_phage(88.51%)	105	21592:21607	39675:39690
WP_124884814.1|0_4572_+	tape measure protein	NA	J9Q712	Salmonella_phage	82.8	0.0e+00
WP_000442113.1|4614_4950_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	86.4	3.0e-52
WP_124884813.1|4999_5731_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.1	4.3e-136
WP_124884812.1|5723_6521_+|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	97.7	1.2e-158
WP_064674264.1|6508_7102_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	93.9	4.3e-102
WP_124884811.1|7112_11693_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	86.0	0.0e+00
WP_124884819.1|14102_15218_+	hypothetical protein	NA	J9Q6E3	Salmonella_phage	65.2	5.8e-124
WP_096098950.1|15280_16066_+	receptor-recognizing protein	NA	A0A291LCI2	Shigella_phage	63.5	5.5e-44
WP_001711185.1|16140_16464_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	80.4	1.4e-38
WP_033546097.1|16477_17170_+	membrane protein	NA	J9Q7Y7	Salmonella_phage	90.4	4.1e-120
WP_023135660.1|17172_17424_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	65.1	1.0e-20
WP_033870689.1|17592_18114_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001711191.1|18121_18391_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000161228.1|18710_19379_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
WP_000062085.1|19378_19738_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
WP_033870691.1|19790_20558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023135656.1|20840_21566_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	96.3	1.0e-137
21592:21607	attL	AGAAAACAAATTGTTT	NA	NA	NA	NA
WP_063122790.1|21626_22967_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	98.7	4.7e-245
WP_096313786.1|23027_24239_+	DNA primase	NA	J9Q720	Salmonella_phage	94.6	1.1e-208
WP_122633168.1|24975_25098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154166893.1|25063_26221_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_001515303.1|26272_27955_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_001352368.1|28256_29465_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001067855.1|30650_31355_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032319018.1|31761_32529_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_016153548.1|32525_33104_-	thiosulfate reductase electron transport protein PhsB	NA	NA	NA	NA	NA
WP_032319017.1|33118_35392_-	thiosulfate reductase PhsA	NA	NA	NA	NA	NA
WP_072662626.1|36385_36934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032271783.1|36924_37341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003980691.1|37640_38744_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.9	1.9e-26
WP_023135736.1|38738_39128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024172742.1|39383_39596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154166890.1|39709_41941_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	84.9	0.0e+00
39675:39690	attR	AGAAAACAAATTGTTT	NA	NA	NA	NA
WP_063085645.1|42036_43272_+	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	98.5	3.7e-236
WP_152922663.1|43452_46971_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	98.3	0.0e+00
WP_053292493.1|47668_48100_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	5.8e-72
WP_063078632.1|48219_49236_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	99.0	1.5e-163
WP_087905091.1|49296_50241_+	exonuclease	NA	J9Q7S6	Salmonella_phage	97.8	2.7e-178
WP_052930801.1|50240_50507_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	98.9	4.7e-40
WP_154166891.1|50509_52849_+	recombinase RecA	NA	J9Q736	Salmonella_phage	87.8	6.0e-30
WP_104730527.1|53150_56228_-	DEAD/DEAH box helicase	NA	A0A2K5B2C2	Erysipelothrix_phage	33.1	1.6e-126
WP_104730528.1|56237_58082_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	40.6	1.2e-121
WP_023315979.1|58156_58843_-	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_064674285.1|58846_62179_-	helicase	NA	A0A2K5B2B9	Erysipelothrix_phage	41.9	1.1e-239
WP_023135696.1|62687_62963_+	hypothetical protein	NA	J9Q738	Salmonella_phage	91.2	1.1e-44
WP_023135695.1|63002_63182_+	hypothetical protein	NA	J9Q6J1	Salmonella_phage	81.4	1.6e-15
WP_023135694.1|63178_63514_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	84.5	4.5e-48
WP_063122723.1|63513_63726_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	9.9e-33
WP_001711119.1|64335_65391_-	replication protein RepA	NA	J9Q7H0	Salmonella_phage	93.8	3.3e-177
WP_023135693.1|66133_66778_+	hypothetical protein	NA	J9Q739	Salmonella_phage	98.6	1.4e-122
WP_032187693.1|67174_68260_+	exonuclease	NA	J9Q7S9	Salmonella_phage	97.8	2.5e-204
WP_032187695.1|68489_70406_+	AAA family ATPase	NA	J9Q741	Salmonella_phage	86.7	2.0e-297
WP_124884828.1|70395_71142_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	91.9	1.1e-126
WP_063091564.1|71117_71894_+	hypothetical protein	NA	A0A2I7R0K2	Vibrio_phage	40.0	2.4e-23
WP_025670519.1|71890_72460_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	80.4	7.9e-85
WP_032187593.1|72725_73604_+	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	98.6	5.2e-160
WP_087905085.1|73771_74887_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	99.5	9.6e-220
WP_032339195.1|74888_75302_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	98.5	3.3e-72
WP_033546604.1|75298_75775_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	97.5	1.9e-87
WP_053292503.1|75774_76419_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	96.3	2.7e-113
WP_025670513.1|76482_76902_+	hypothetical protein	NA	J9Q743	Salmonella_phage	95.7	4.6e-66
WP_097476179.1|76911_77466_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	94.5	1.8e-94
WP_089075301.1|77510_78467_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	72.8	2.1e-98
WP_063085663.1|78622_79216_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	99.5	4.6e-112
WP_025670509.1|79418_79649_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	97.3	3.3e-34
WP_063085666.1|80242_80851_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	98.0	6.0e-115
WP_032187601.1|80993_81494_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	84.3	1.7e-67
WP_032187602.1|81503_81692_+	hypothetical protein	NA	J9Q800	Salmonella_phage	79.0	2.5e-19
WP_077881864.1|81855_82614_+	hypothetical protein	NA	J9Q7T3	Salmonella_phage	97.1	1.1e-129
WP_089075297.1|82722_83295_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	2.4e-97
WP_000019440.1|83535_84516_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_154166895.1|84994_88777_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	35.0	1.1e-110
WP_033870678.1|91269_91488_+	hypothetical protein	NA	J9Q804	Salmonella_phage	93.1	7.8e-33
WP_032187826.1|91627_91957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001711135.1|92117_92429_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	64.1	3.0e-30
WP_033546623.1|92550_92946_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	63.8	2.0e-42
WP_077898224.1|93027_93438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085951198.1|93767_94055_+	ABC transporter	NA	J9Q753	Salmonella_phage	80.6	9.6e-39
WP_063122769.1|94259_94742_+	hypothetical protein	NA	J9Q805	Salmonella_phage	69.2	2.7e-62
WP_001711144.1|95360_95591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124062459.1|95641_96292_-	hypothetical protein	NA	J9Q754	Salmonella_phage	96.3	3.9e-112
WP_033870681.1|96606_97131_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	69.4	3.0e-54
WP_089075223.1|98019_98556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089075224.1|98621_98900_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	96.7	3.8e-40
WP_124062460.1|98902_100462_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.2	2.2e-294
WP_089075226.1|100526_101225_+	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	99.1	5.6e-125
WP_000164561.1|101224_101893_+	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
WP_016051719.1|101889_102528_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	100.0	3.8e-112
WP_089075227.1|102520_102775_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	92.9	5.0e-39
WP_089075228.1|102771_103671_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.0	1.5e-167
WP_000176291.1|103680_103947_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_022649943.1|104142_104784_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	99.1	5.2e-109
WP_124062461.1|104786_106043_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	99.0	4.5e-250
WP_124884816.1|106076_107651_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	97.1	1.2e-295
WP_063122778.1|107673_108567_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	95.0	3.1e-144
WP_032187309.1|108593_109469_+	hypothetical protein	NA	J9Q710	Salmonella_phage	98.6	4.2e-162
WP_063085588.1|109543_109972_+	Ig-like domain-containing protein	NA	J9Q6D6	Salmonella_phage	57.7	6.0e-53
WP_063122779.1|110015_110450_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	93.1	3.5e-69
WP_122224849.1|110449_111283_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	95.7	3.3e-148
WP_053292521.1|111380_111725_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	96.5	5.1e-55
WP_124884815.1|111715_112189_+	hypothetical protein	NA	J9Q711	Salmonella_phage	98.7	4.4e-81
WP_124831680.1|112190_112574_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	96.1	1.6e-65
WP_032187301.1|112648_113395_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	97.6	2.6e-128
WP_000163862.1|113454_113772_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002228782.1|113852_114122_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
