The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045696	Muribaculaceae bacterium DSM 108610 strain Oil-RF-744-WCA-WT-10 chromosome, complete genome	3340670	2160117	2169853	3340670		Lactococcus_phage(12.5%)	12	NA	NA
WP_154327973.1|2160117_2160720_+	DUF1071 domain-containing protein	NA	A0A126H911	Lactococcus_phage	61.0	1.4e-47
WP_154327974.1|2160723_2161791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154327975.1|2161828_2162665_+	hypothetical protein	NA	A0A173G9H6	Propionibacterium_phage	27.5	1.4e-13
WP_154327976.1|2162676_2163111_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	39.8	2.8e-18
WP_154327977.1|2163112_2163370_+	demethylase	NA	NA	NA	NA	NA
WP_154327978.1|2163366_2163813_+	hypothetical protein	NA	A0A2I7R7P2	Vibrio_phage	39.6	1.1e-09
WP_154327979.1|2164226_2165435_+	ATP-dependent helicase	NA	A0A2I2L6J1	Escherichia_phage	36.3	1.9e-43
WP_154327980.1|2165431_2166025_+	hypothetical protein	NA	Q8W6N9	Burkholderia_virus	35.4	5.4e-12
WP_154327981.1|2166030_2166915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154327982.1|2166907_2167513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154327983.1|2167625_2168195_+	hypothetical protein	NA	L0P6F5	Lactobacillus_phage	40.9	8.8e-36
WP_154327984.1|2168221_2169853_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	30.0	1.1e-19
>prophage 2
NZ_CP045696	Muribaculaceae bacterium DSM 108610 strain Oil-RF-744-WCA-WT-10 chromosome, complete genome	3340670	2173705	2217918	3340670	transposase,head,terminase,integrase,capsid,portal	Flavobacterium_phage(30.0%)	58	2171721:2171741	2198711:2198731
2171721:2171741	attL	ATAAGTCAAACATTTAATTCA	NA	NA	NA	NA
WP_154327995.1|2173705_2174839_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_154327996.1|2174838_2175594_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_154327997.1|2175610_2175862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154327998.1|2175858_2176089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154327999.1|2176108_2176408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328000.1|2176397_2177204_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_154328001.1|2177225_2177471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328002.1|2177500_2177923_+	DUF4494 domain-containing protein	NA	NA	NA	NA	NA
WP_154328003.1|2177912_2178332_+	dUTP diphosphatase	NA	I2GUG7	Acinetobacter_phage	49.7	2.0e-29
WP_154328004.1|2178352_2178559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328005.1|2178641_2178992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328006.1|2179045_2179717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328007.1|2179713_2180466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328008.1|2180545_2181097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328009.1|2181130_2181910_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_154328010.1|2181979_2182129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328011.1|2182271_2182547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328012.1|2182546_2184559_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2I7RGD2	Vibrio_phage	31.2	8.3e-20
WP_154328013.1|2184693_2185281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328014.1|2185461_2186874_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_154328015.1|2186827_2187880_+|head	phage prohead protein	head	Q5ZGF7	Flavobacterium_phage	39.1	8.1e-27
WP_154328016.1|2187899_2189498_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_154328017.1|2189504_2189882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328018.1|2189891_2190392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328019.1|2190391_2190961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328020.1|2190964_2191816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328021.1|2192049_2192595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328022.1|2192591_2192780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328023.1|2192784_2197239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328024.1|2197235_2197838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328025.1|2197992_2198163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328026.1|2198152_2198626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154329023.1|2198742_2199081_+	DUF2693 domain-containing protein	NA	F5A3D3	Riemerella_phage	40.6	9.0e-12
2198711:2198731	attR	ATAAGTCAAACATTTAATTCA	NA	NA	NA	NA
WP_154328027.1|2199092_2199362_+	DUF3846 domain-containing protein	NA	NA	NA	NA	NA
WP_154328028.1|2199500_2201663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328029.1|2201659_2202517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328030.1|2202523_2203189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328031.1|2203192_2203426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328032.1|2203428_2204625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328033.1|2204626_2206219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328034.1|2206273_2206822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328035.1|2206818_2207268_+	peptidase M15	NA	H2A0C2	Bacteroides_phage	50.0	5.0e-26
WP_154328036.1|2207272_2207755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328037.1|2207969_2208908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328038.1|2208962_2209349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328039.1|2209345_2209555_+	helix-turn-helix domain-containing protein	NA	A0A2I6UI15	Bacillus_phage	40.0	1.7e-05
WP_154328040.1|2209838_2210111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328041.1|2210107_2210425_+	hypothetical protein	NA	A0A218M789	Flavobacterium_phage	54.2	3.7e-23
WP_154328042.1|2210421_2210778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328043.1|2210756_2211095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328044.1|2211098_2211404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328045.1|2211400_2211712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154328046.1|2211714_2212920_+	hypothetical protein	NA	A0A1B0WMP3	Flavobacterium_phage	50.0	7.7e-106
WP_154328047.1|2212916_2214185_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	53.5	1.7e-132
WP_154328048.1|2214181_2214676_+	chromosome partitioning protein ParB	NA	L0P6I1	Lactobacillus_phage	74.8	9.3e-66
WP_154328049.1|2214672_2215302_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_154328050.1|2215516_2216704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154328051.1|2217471_2217918_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
