The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045695	[Clostridium] scindens strain BL389WT3D chromosome, complete genome	3785527	419271	482939	3785527	transposase,integrase	Planktothrix_phage(18.18%)	57	426992:427008	483604:483620
WP_154321997.1|419271_420264_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_154321940.1|420670_421909_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	27.1	2.0e-32
WP_009247786.1|422216_423029_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009247785.1|423043_423712_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_154322049.1|423721_424465_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.8	4.4e-27
WP_154322050.1|424560_427788_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
426992:427008	attL	TCCTGCAGACGCTTCTG	NA	NA	NA	NA
WP_009247782.1|428064_429261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009247781.1|429398_430691_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_154322051.1|430769_431954_-|integrase	tyrosine-type recombinase/integrase	integrase	H7BW99	unidentified_phage	32.6	1.7e-36
WP_154322052.1|431987_432182_-	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_154322053.1|432536_432854_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_154322054.1|433090_433285_+	2-ketoisovalerate ferredoxin oxidoreductase	NA	NA	NA	NA	NA
WP_002588696.1|433746_434958_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_154322055.1|435257_436400_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_154322056.1|436434_437478_+	endonuclease	NA	A0A139ZPJ9	Marinitoga_camini_virus	32.9	3.6e-35
WP_154322057.1|437512_439750_+	ATP-dependent RecD-like DNA helicase	NA	A0A0H3UZA5	Geobacillus_virus	28.8	1.2e-67
WP_154322058.1|439853_440798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154322059.1|440865_442074_+	DNA primase	NA	NA	NA	NA	NA
WP_154322060.1|442136_442919_+	class B sortase	NA	NA	NA	NA	NA
WP_154322061.1|443036_443969_+	plasmid segregation actin-type ATPase ParM	NA	NA	NA	NA	NA
WP_154322062.1|443986_444364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154323316.1|444505_444835_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_154323317.1|445234_445693_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_154323318.1|445692_445881_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_154322063.1|446075_446888_+	class B sortase	NA	NA	NA	NA	NA
WP_154322064.1|447082_447898_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_154322065.1|447918_448755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154322066.1|448745_448997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154322067.1|449099_449573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154322068.1|449650_455326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154322069.1|455559_456561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154322070.1|456550_457762_+	heme ABC transporter substrate-binding protein IsdE	NA	NA	NA	NA	NA
WP_154322071.1|457776_458850_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_154323319.1|458977_459721_+	ATP-binding cassette domain-containing protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	26.0	3.1e-12
WP_117540336.1|459725_460130_+	DUF454 domain-containing protein	NA	NA	NA	NA	NA
WP_154322072.1|460131_460470_+	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_154322073.1|460480_462217_+	ATP-binding cassette domain-containing protein	NA	A0A076FI99	Aureococcus_anophage	35.2	1.3e-21
WP_154322074.1|462216_464001_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SJ29	Klosneuvirus	25.6	6.0e-14
WP_154322075.1|464215_464521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154322076.1|464521_466636_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	29.8	5.4e-62
WP_154322077.1|466632_467037_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_154322078.1|467257_467470_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_154322079.1|467482_467704_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_154322080.1|467777_469952_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_154322081.1|469994_470141_+	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_154323320.1|470214_470622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154322082.1|470648_470882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154322083.1|471506_471929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154322084.1|472287_472641_+	copper resistance protein CopZ	NA	NA	NA	NA	NA
WP_154322085.1|472700_473357_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_154322086.1|473442_474144_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.0	1.7e-33
WP_154322087.1|476875_477439_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_154322088.1|477512_479132_+	FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	36.2	6.2e-50
WP_154322089.1|479176_480154_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_154322090.1|480323_480902_+	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_154322091.1|480898_481603_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_002588696.1|481727_482939_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
483604:483620	attR	CAGAAGCGTCTGCAGGA	NA	NA	NA	NA
>prophage 2
NZ_CP045695	[Clostridium] scindens strain BL389WT3D chromosome, complete genome	3785527	637041	648727	3785527		Streptococcus_phage(72.73%)	14	NA	NA
WP_055257532.1|637041_637404_+	helix-turn-helix transcriptional regulator	NA	A0A090D830	Clostridium_phage	38.7	1.3e-05
WP_001835223.1|638599_638797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000802831.1|638764_639424_-	RibD family protein	NA	A0A1B0RXM8	Streptococcus_phage	100.0	3.1e-125
WP_072387101.1|639534_639942_-	WYL domain-containing protein	NA	A0A1B0RXM3	Streptococcus_phage	98.3	1.1e-59
WP_078154339.1|639914_640130_-	WYL domain-containing protein	NA	E4ZFP5	Streptococcus_phage	98.6	3.4e-33
WP_001096887.1|640762_641557_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_000627290.1|641649_642192_-	streptothricin N-acetyltransferase Sat4	NA	A0A1B0RXL7	Streptococcus_phage	100.0	8.9e-94
WP_001255866.1|642188_643097_-	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	E4ZFP8	Streptococcus_phage	100.0	2.8e-177
WP_000662263.1|643129_643864_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
WP_000228166.1|643844_644714_-	hypothetical protein	NA	A0A1X9I6C9	Streptococcus_phage	95.8	4.3e-159
WP_000567889.1|644816_645062_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_033860794.1|645172_646744_-	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	61.1	5.1e-174
WP_000510187.1|646747_647161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024400883.1|647161_648727_-	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	54.8	2.4e-160
>prophage 4
NZ_CP045695	[Clostridium] scindens strain BL389WT3D chromosome, complete genome	3785527	1040626	1101608	3785527	transposase,coat	Staphylococcus_phage(20.0%)	60	NA	NA
WP_154321997.1|1040626_1041619_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_154322338.1|1041813_1042281_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009248721.1|1042508_1042952_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004605300.1|1043072_1043750_+	epoxyqueuosine reductase	NA	NA	NA	NA	NA
WP_154322339.1|1044028_1045000_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_154323332.1|1045113_1046037_+	DegV family EDD domain-containing protein	NA	NA	NA	NA	NA
WP_004605303.1|1048489_1048942_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_154322340.1|1048946_1049651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154322341.1|1050065_1050395_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_004605307.1|1050412_1050622_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004605308.1|1050802_1051168_+	DUF2089 domain-containing protein	NA	NA	NA	NA	NA
WP_004605309.1|1051203_1051590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004605310.1|1051601_1051865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004605311.1|1051961_1052561_+	VanZ family protein	NA	NA	NA	NA	NA
WP_154322342.1|1052894_1053398_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_004605595.1|1053852_1054674_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_154322343.1|1054660_1055302_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_154322344.1|1055298_1055958_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_009248714.1|1056043_1056889_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_154322345.1|1056892_1058065_+	putative hydroxymethylpyrimidine transporter CytX	NA	NA	NA	NA	NA
WP_154322346.1|1058161_1059583_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_154322347.1|1059636_1061103_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_154322348.1|1061460_1062972_+	ABC-F type ribosomal protection protein	NA	A0A2K9L3Z8	Tupanvirus	25.6	6.2e-28
WP_154322349.1|1063083_1064397_+	AAA family ATPase	NA	G3MBE0	Bacillus_virus	42.3	8.5e-90
WP_004605604.1|1064374_1064776_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_154322350.1|1064910_1065591_+	response regulator	NA	W8CYM9	Bacillus_phage	36.1	2.9e-33
WP_154322351.1|1065578_1066799_+	HAMP domain-containing protein	NA	Q6XLV6	Feldmannia_irregularis_virus	32.4	5.4e-06
WP_009248707.1|1066872_1067751_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.6	3.7e-25
WP_004605608.1|1067750_1068989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154323333.1|1068981_1069566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004605610.1|1069641_1070232_+	DUF3841 domain-containing protein	NA	NA	NA	NA	NA
WP_154322352.1|1070238_1071285_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_004605612.1|1071522_1071705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130574545.1|1071886_1073689_-|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	27.5	4.3e-44
WP_009248704.1|1073797_1074886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002588696.1|1075190_1076402_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_009249919.1|1076708_1078139_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_009248703.1|1078310_1079024_+	inosine monophosphate cyclohydrolase	NA	NA	NA	NA	NA
WP_154322353.1|1079065_1080244_+	phosphoribosylaminoimidazolecarboxamide formyltransferase	NA	NA	NA	NA	NA
WP_004605617.1|1080811_1081396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004605618.1|1081427_1082840_+	radical SAM protein	NA	NA	NA	NA	NA
WP_004605619.1|1082996_1083992_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_004605620.1|1083996_1084584_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_154322354.1|1084682_1086074_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004605622.1|1086257_1087604_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_009248701.1|1087642_1088485_-	YitT family protein	NA	NA	NA	NA	NA
WP_154322355.1|1088848_1090162_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	60.7	1.3e-138
WP_004605627.1|1090261_1091212_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	44.2	4.4e-72
WP_154322356.1|1091208_1093782_+	YfhO family protein	NA	NA	NA	NA	NA
WP_004605629.1|1093858_1094101_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_154322357.1|1094184_1096344_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.5	4.3e-83
WP_154322358.1|1096324_1096792_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	54.9	3.8e-37
WP_004605632.1|1096802_1097045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154322359.1|1097074_1097629_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_004605634.1|1097762_1098188_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_154322360.1|1099041_1099572_-	rubrerythrin family protein	NA	NA	NA	NA	NA
WP_154322361.1|1099858_1100485_+	cytidylate kinase-like family protein	NA	NA	NA	NA	NA
WP_009248695.1|1100585_1101194_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_154322362.1|1101193_1101442_-|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_009248694.1|1101431_1101608_-|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
>prophage 5
NZ_CP045695	[Clostridium] scindens strain BL389WT3D chromosome, complete genome	3785527	1433476	1444125	3785527	tail,integrase	Erysipelothrix_phage(66.67%)	8	1426417:1426431	1440096:1440110
1426417:1426431	attL	AATCTTATCGTCCTT	NA	NA	NA	NA
WP_154322459.1|1433476_1434856_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	34.2	5.6e-60
WP_154322460.1|1435181_1436750_-	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	62.7	5.8e-154
WP_154322461.1|1436749_1437166_-|integrase	integrase	integrase	A0A2K5B2B3	Erysipelothrix_phage	39.4	1.3e-20
WP_154322462.1|1437166_1438729_-	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	49.8	2.8e-140
WP_154322463.1|1438783_1439005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154322464.1|1439132_1440296_-	hypothetical protein	NA	H7BV89	unidentified_phage	65.5	4.4e-90
1440096:1440110	attR	AATCTTATCGTCCTT	NA	NA	NA	NA
WP_154322465.1|1440292_1440943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154322466.1|1440939_1444125_-|tail	phage tail tape measure protein	tail	B6CXF2	Clostridium_phage	45.2	2.1e-86
>prophage 6
NZ_CP045695	[Clostridium] scindens strain BL389WT3D chromosome, complete genome	3785527	1448620	1459611	3785527		Streptococcus_phage(62.5%)	11	NA	NA
WP_154322473.1|1448620_1448902_-	VRR-NUC domain-containing protein	NA	M1PFY8	Streptococcus_phage	60.0	9.1e-26
WP_154322474.1|1449041_1451315_-	DNA primase	NA	A0A1X9I6B6	Streptococcus_phage	47.4	5.2e-196
WP_154322475.1|1451314_1451644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154322476.1|1451647_1452067_-	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	53.2	2.6e-37
WP_154322477.1|1452219_1454160_-	hypothetical protein	NA	A0A2K5B2B0	Erysipelothrix_phage	71.7	6.5e-280
WP_154322478.1|1454291_1454480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154322479.1|1454495_1455068_-	DUF2815 family protein	NA	Q6DMW3	Streptococcus_phage	75.1	1.3e-74
WP_154322480.1|1455060_1456200_-	DUF2800 domain-containing protein	NA	A0A1X9I6D8	Streptococcus_phage	58.4	1.0e-123
WP_154322481.1|1456201_1456522_-	DNA ligase	NA	A0A2K5B2A7	Erysipelothrix_phage	36.8	1.5e-08
WP_154322482.1|1456810_1457329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154322483.1|1457736_1459611_-	ImmA/IrrE family metallo-endopeptidase	NA	E4ZFJ9	Streptococcus_phage	27.9	8.5e-51
>prophage 7
NZ_CP045695	[Clostridium] scindens strain BL389WT3D chromosome, complete genome	3785527	1508722	1541251	3785527	transposase,terminase	Bacillus_phage(55.56%)	33	NA	NA
WP_154323314.1|1508722_1510255_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_004605482.1|1510247_1511021_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	29.9	3.0e-18
WP_004604852.1|1511013_1511256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004607679.1|1512010_1512229_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_154322496.1|1512251_1513109_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	61.0	8.8e-88
WP_004607683.1|1514971_1515577_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_154322497.1|1515623_1516040_+	DUF3795 domain-containing protein	NA	NA	NA	NA	NA
WP_154322498.1|1516059_1516482_+	DUF3788 family protein	NA	NA	NA	NA	NA
WP_154322499.1|1516579_1516912_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_154322500.1|1518263_1519151_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_154322501.1|1519151_1519667_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_154322502.1|1519659_1520202_+	phosphatidylglycerophosphate synthase	NA	NA	NA	NA	NA
WP_154322503.1|1520206_1520569_+	glyoxalase	NA	NA	NA	NA	NA
WP_004605464.1|1520717_1521146_+|transposase	IS200/IS605 family transposase	transposase	W0UUZ0	Sulfolobus_monocaudavirus	39.0	5.5e-22
WP_154322504.1|1521270_1521912_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_039909955.1|1521999_1522197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154322505.1|1522218_1523316_+	cell filamentation protein	NA	NA	NA	NA	NA
WP_154323343.1|1525047_1525476_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_154322506.1|1525697_1526003_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_154322507.1|1525999_1526329_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_154322508.1|1526376_1526940_-|terminase	terminase	terminase	A0A2K5B285	Erysipelothrix_phage	80.2	2.3e-84
WP_154322509.1|1527601_1528261_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_154322510.1|1528424_1529591_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	27.1	1.3e-22
WP_004608055.1|1529583_1530291_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.4	9.3e-43
WP_154322511.1|1531155_1531839_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_004608059.1|1532191_1532869_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.8	1.1e-35
WP_009249226.1|1532852_1534253_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	27.8	1.6e-22
WP_009249946.1|1534552_1535755_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	43.3	2.4e-83
WP_154322512.1|1536167_1536602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154322513.1|1536613_1537831_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_154322514.1|1537832_1539269_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_154322515.1|1539285_1539507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154322223.1|1539820_1541251_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP045695	[Clostridium] scindens strain BL389WT3D chromosome, complete genome	3785527	1747942	1814055	3785527	transposase	Wolbachia_phage(18.18%)	58	NA	NA
WP_154322223.1|1747942_1749373_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004606242.1|1749535_1750813_+	MFS transporter	NA	NA	NA	NA	NA
WP_004606241.1|1750911_1752360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154322570.1|1752370_1753132_-	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_154322571.1|1753312_1754785_+	stage IV sporulation protein A	NA	NA	NA	NA	NA
WP_154322572.1|1754950_1755337_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_009249335.1|1755329_1756007_+	LrgB family protein	NA	NA	NA	NA	NA
WP_004606236.1|1756058_1756529_+	MogA/MoaB family molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
WP_154321940.1|1756651_1757890_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	27.1	2.0e-32
WP_009249333.1|1758197_1758896_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004606234.1|1758900_1759380_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	49.0	2.9e-32
WP_004606233.1|1759903_1760344_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_009249331.1|1760358_1761276_-	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	39.5	8.9e-54
WP_009249330.1|1761288_1761825_-	nitroreductase	NA	NA	NA	NA	NA
WP_081702058.1|1761884_1762268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154322223.1|1762505_1763936_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_009249329.1|1764099_1765230_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_154322573.1|1765242_1766532_+	DUF815 domain-containing protein	NA	NA	NA	NA	NA
WP_009249328.1|1766719_1767094_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	54.6	8.4e-35
WP_004606224.1|1767331_1769071_-	fibronectin/fibrinogen-binding protein	NA	NA	NA	NA	NA
WP_154322574.1|1769202_1770084_+	YicC family protein	NA	NA	NA	NA	NA
WP_004606222.1|1770103_1770724_+	guanylate kinase	NA	NA	NA	NA	NA
WP_009249326.1|1770729_1770969_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_009249325.1|1771076_1772402_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_004606219.1|1772398_1772941_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_154322575.1|1772944_1774189_+	competence/damage-inducible protein A	NA	B5TK85	Pseudomonas_phage	40.7	5.7e-19
WP_154322576.1|1774192_1775650_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004606215.1|1775955_1776648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004606214.1|1776668_1777679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154322577.1|1778137_1779034_+	MBL fold metallo-hydrolase	NA	Q332C0	Clostridium_botulinum_C_phage	41.3	6.4e-57
WP_154322578.1|1779154_1779943_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009249320.1|1779957_1780644_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004606209.1|1780627_1781362_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	4.3e-35
WP_004606208.1|1781518_1782232_+	lantibiotic protection ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	51.6	4.6e-58
WP_154322579.1|1782224_1782989_+	lantibiotic immunity ABC transporter MutE/EpiE family permease subunit	NA	NA	NA	NA	NA
WP_154322580.1|1782989_1783745_+	lantibiotic immunity ABC transporter MutG family permease subunit	NA	NA	NA	NA	NA
WP_154322581.1|1783737_1784397_+	response regulator	NA	NA	NA	NA	NA
WP_154322582.1|1784369_1785770_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_154322583.1|1785836_1790093_-	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_004606201.1|1790374_1791232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004606200.1|1791257_1792694_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_004606199.1|1793241_1793928_+	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_004606198.1|1793924_1795199_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_154322584.1|1795232_1795871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130574545.1|1796111_1797914_-|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	27.5	4.3e-44
WP_154323347.1|1798393_1799503_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_009249854.1|1799578_1802194_+	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	38.3	4.3e-69
WP_004606194.1|1802206_1802797_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_004606193.1|1802818_1803616_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004606191.1|1804081_1804936_+	DegV family protein	NA	NA	NA	NA	NA
WP_004606190.1|1805012_1806296_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_039909584.1|1806475_1807831_+	magnesium transporter	NA	NA	NA	NA	NA
WP_009248563.1|1807946_1808948_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_004606187.1|1808985_1810176_+	acetate kinase	NA	NA	NA	NA	NA
WP_154321997.1|1810341_1811334_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004606186.1|1811825_1812353_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_004606185.1|1812356_1812536_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_154321940.1|1812816_1814055_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	27.1	2.0e-32
>prophage 9
NZ_CP045695	[Clostridium] scindens strain BL389WT3D chromosome, complete genome	3785527	2472600	2521139	3785527	transposase	unidentified_phage(16.67%)	34	NA	NA
WP_044942000.1|2472600_2473149_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_154322808.1|2473126_2473294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154322809.1|2473386_2473980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154322810.1|2473999_2477437_-	N-acetylmuramoyl-L-alanine amidase	NA	H7BVK7	unidentified_phage	39.1	5.4e-27
WP_154322811.1|2479031_2479748_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_154322223.1|2479888_2481319_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_154322812.1|2481485_2481626_-	sugar nucleotide-binding protein	NA	NA	NA	NA	NA
WP_154321940.1|2481933_2483172_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	27.1	2.0e-32
WP_154322813.1|2483319_2484783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154322814.1|2484792_2487246_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_009248886.1|2487267_2487870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009248887.1|2487885_2488620_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	1.8e-12
WP_009248888.1|2488632_2489409_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009248889.1|2489443_2491360_-	DUF2142 domain-containing protein	NA	NA	NA	NA	NA
WP_154322815.1|2491356_2491749_-	DUF2304 family protein	NA	NA	NA	NA	NA
WP_009248891.1|2491748_2492441_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_154323358.1|2492455_2493553_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_009248893.1|2493628_2494498_-	LicD family protein	NA	A0A1V0SD50	Indivirus	41.8	5.5e-05
WP_154322816.1|2494528_2495800_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_083825251.1|2495822_2496791_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_049892948.1|2497089_2497728_-	LTA synthase family protein	NA	NA	NA	NA	NA
WP_009248898.1|2498009_2499614_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	NA	NA	NA	NA
WP_154322817.1|2499677_2501495_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002588696.1|2501778_2502990_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_154322818.1|2503083_2503713_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_154323359.1|2503751_2503883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009248901.1|2505736_2507674_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_009248902.1|2507696_2509289_-	hypothetical protein	NA	D2KRB9	Lactobacillus_phage	37.5	1.6e-10
WP_009248903.1|2509683_2511207_-	BCCT family transporter	NA	NA	NA	NA	NA
WP_009248904.1|2511196_2512078_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_154322819.1|2512070_2513816_-	phosphotransferase	NA	NA	NA	NA	NA
WP_154322820.1|2517291_2518914_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	26.4	8.4e-47
WP_154322821.1|2519117_2519399_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_154322223.1|2519708_2521139_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP045695	[Clostridium] scindens strain BL389WT3D chromosome, complete genome	3785527	2793034	2850430	3785527	transposase	Enterobacteria_phage(21.43%)	56	NA	NA
WP_002588696.1|2793034_2794246_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_154322927.1|2794370_2795075_-	DUF5058 family protein	NA	NA	NA	NA	NA
WP_009249414.1|2795347_2795941_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004606785.1|2795990_2796917_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	46.4	1.2e-71
WP_154322928.1|2796985_2797864_-	phosphatidylserine decarboxylase	NA	A0A2K9L169	Tupanvirus	25.5	3.0e-06
WP_009249416.1|2797895_2798570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004606788.1|2798601_2799633_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_154322929.1|2799629_2800346_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004606790.1|2800511_2801027_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_025642794.1|2801062_2801914_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_154322930.1|2801942_2803133_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_009249420.1|2803178_2804084_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_083825263.1|2804786_2805092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154323364.1|2805310_2805652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154322931.1|2805557_2805785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154322932.1|2805987_2806416_-|transposase	IS200/IS605 family transposase	transposase	W0UUZ0	Sulfolobus_monocaudavirus	39.0	5.5e-22
WP_154322933.1|2806693_2807590_+	FAD-binding protein	NA	G3MA85	Bacillus_virus	34.2	2.5e-40
WP_004604852.1|2807967_2808210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004605482.1|2808202_2808976_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	29.9	3.0e-18
WP_009249919.1|2810100_2811531_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_009249426.1|2812716_2813007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154322934.1|2813167_2813326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009249428.1|2813583_2813910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044942479.1|2813988_2814831_-	EamA family transporter	NA	NA	NA	NA	NA
WP_154322935.1|2814890_2815628_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.9	6.1e-29
WP_154322936.1|2815615_2816281_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_009249432.1|2816296_2817130_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009249433.1|2817156_2817723_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_154322937.1|2820761_2822636_-	recombinase family protein	NA	Q6DMS5	Streptococcus_phage	32.3	3.1e-53
WP_154322938.1|2822677_2822827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154322939.1|2822857_2823379_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	33.3	3.5e-07
WP_154322940.1|2823665_2823827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154323365.1|2824012_2824483_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_154322941.1|2824841_2826452_-	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.3	8.9e-25
WP_154322942.1|2827015_2827717_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	5.4e-27
WP_154322943.1|2827704_2830311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154322944.1|2830773_2831052_-	peptide maturation system acyl carrier-related protein	NA	NA	NA	NA	NA
WP_154322945.1|2831063_2832113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154322946.1|2832321_2833761_-	Cys-rich peptide radical SAM maturase CcpM	NA	NA	NA	NA	NA
WP_154322947.1|2834009_2834189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154322948.1|2834181_2834958_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	33.2	1.5e-30
WP_154322949.1|2834957_2836430_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	25.3	1.4e-16
WP_154322950.1|2836595_2837288_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	40.3	6.1e-31
WP_154322951.1|2837297_2838263_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_154322952.1|2838265_2839366_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_154322953.1|2839367_2840216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154322954.1|2840205_2840439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154322955.1|2840476_2840749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154322956.1|2840815_2841388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154322957.1|2842729_2842987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154322958.1|2843089_2844889_-	type 2 lantipeptide synthetase LanM	NA	NA	NA	NA	NA
WP_004604852.1|2844898_2845141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004605482.1|2845133_2845907_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	29.9	3.0e-18
WP_154323314.1|2845899_2847432_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_154322959.1|2847668_2848835_-	type 2 lantipeptide synthetase LanM	NA	NA	NA	NA	NA
WP_154322223.1|2848999_2850430_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP045695	[Clostridium] scindens strain BL389WT3D chromosome, complete genome	3785527	3339459	3394022	3785527	transposase,integrase	Enterobacteria_phage(17.65%)	55	3354121:3354141	3382025:3382045
WP_009249946.1|3339459_3340662_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	43.3	2.4e-83
WP_004607470.1|3340965_3341406_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_004607469.1|3341502_3342285_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_154323151.1|3342375_3343335_-	phosphoglycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	35.4	5.0e-31
WP_154323152.1|3343350_3344745_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A0P0C6S9	Ostreococcus_lucimarinus_virus	26.8	5.3e-34
WP_004607466.1|3344758_3345526_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_154323153.1|3345548_3346172_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_154323154.1|3346208_3347489_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_154323155.1|3347491_3347980_-	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_154323156.1|3347976_3349017_-	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_154323157.1|3349027_3350449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154323158.1|3350472_3351489_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_004607459.1|3351706_3352450_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_154323159.1|3352430_3353693_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	3.1e-65
WP_154323160.1|3353867_3355325_-	xylulokinase	NA	NA	NA	NA	NA
3354121:3354141	attL	GGGCTTTTGGCTCCGCCTCCG	NA	NA	NA	NA
WP_154323161.1|3355408_3356893_-	fucose isomerase	NA	NA	NA	NA	NA
WP_154323162.1|3356929_3357547_-	DUF4867 family protein	NA	NA	NA	NA	NA
WP_004607453.1|3357709_3358549_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_154323163.1|3358555_3359542_-	kinase	NA	NA	NA	NA	NA
WP_154323375.1|3359619_3361146_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_004607450.1|3361582_3362479_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	2.2e-20
WP_004607449.1|3362674_3362878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154323164.1|3362879_3363872_-	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_154323314.1|3364324_3365857_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_004605482.1|3365849_3366623_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	29.9	3.0e-18
WP_004604852.1|3366615_3366858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130574645.1|3367178_3367334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004607442.1|3367337_3367532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004607441.1|3367537_3367900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004607440.1|3367954_3368176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154323165.1|3368352_3370365_-	AlwI family type II restriction endonuclease	NA	A0A2K5B262	Erysipelothrix_phage	42.9	5.0e-134
WP_154323376.1|3370349_3372269_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A2I4R668	Erysipelothrix_phage	74.1	1.3e-269
WP_004607436.1|3372268_3372487_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	77.8	7.8e-25
WP_009249581.1|3372661_3373477_-	methyltransferase domain-containing protein	NA	A8ATN5	Listeria_phage	32.1	3.5e-09
WP_082210547.1|3373676_3373844_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_154323166.1|3373847_3374420_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	25.0	1.2e-08
WP_154323167.1|3374395_3374701_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_083825274.1|3374743_3374950_-	maturase	NA	NA	NA	NA	NA
WP_154323168.1|3375130_3375931_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004607429.1|3375948_3376389_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_004607427.1|3376771_3377407_-	HAD-IA family hydrolase	NA	A0A1D8KNV9	Synechococcus_phage	26.7	1.6e-09
WP_154323169.1|3377406_3378912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004606349.1|3378931_3379984_-	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_004606350.1|3379980_3380652_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_004606351.1|3380682_3381720_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	30.9	2.4e-31
WP_004606352.1|3381723_3383253_-	carbohydrate kinase	NA	NA	NA	NA	NA
3382025:3382045	attR	GGGCTTTTGGCTCCGCCTCCG	NA	NA	NA	NA
WP_009249588.1|3383312_3384251_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_154323170.1|3384541_3385180_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_004606355.1|3385192_3386188_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_004606356.1|3386235_3387327_-	erythritol/L-threitol dehydrogenase	NA	A0A1E1EWH3	Acanthamoeba_castellanii_mimivirus	25.2	4.7e-09
WP_154323171.1|3387365_3388490_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	32.4	9.3e-21
WP_009249589.1|3388494_3389649_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	3.4e-18
WP_004606359.1|3389659_3390493_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_009249591.1|3390534_3391470_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_154321940.1|3392783_3394022_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	27.1	2.0e-32
>prophage 12
NZ_CP045695	[Clostridium] scindens strain BL389WT3D chromosome, complete genome	3785527	3465340	3495127	3785527	tRNA,transposase,integrase	Enterobacteria_phage(28.57%)	26	3489747:3489806	3498516:3499848
WP_154323189.1|3465340_3465751_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_154322011.1|3465917_3467720_-|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	27.5	4.3e-44
WP_009249917.1|3467783_3468125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009249918.1|3468213_3469152_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009249919.1|3469358_3470789_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_009249922.1|3472272_3472614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009249924.1|3472872_3473499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004604852.1|3474145_3474388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004605482.1|3474380_3475154_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	29.9	3.0e-18
WP_154323314.1|3475146_3476679_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_009248289.1|3477878_3478319_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_154323190.1|3478509_3479151_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_009248291.1|3479160_3480159_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_044941828.1|3480174_3480927_-	D-threitol dehydrogenase	NA	NA	NA	NA	NA
WP_009248293.1|3481074_3482043_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_044941831.1|3482117_3483062_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009248295.1|3483114_3484599_-	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	25.6	3.7e-09
WP_154323191.1|3484791_3486267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154323380.1|3486268_3487261_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	30.1	2.0e-22
WP_009248298.1|3487315_3488905_-	response regulator	NA	NA	NA	NA	NA
WP_004606453.1|3489300_3489465_+	helix-turn-helix domain-containing protein	NA	A0A1S5SF07	Streptococcus_phage	57.4	1.9e-12
3489747:3489806	attL	GTATAATGGTATCGTAATTTAAGACACTTCAAGAGACATTTTTTAATGAATCTGATATAC	NA	NA	NA	NA
WP_154323192.1|3491286_3491775_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SEW7	Streptococcus_phage	48.1	2.4e-45
WP_004606456.1|3491822_3492446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154323193.1|3492472_3493027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154323194.1|3493246_3493717_-|tRNA	methionine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_154323195.1|3493891_3495127_-|integrase	tyrosine-type recombinase/integrase	integrase	H7BUX8	unidentified_phage	49.6	1.9e-115
3498516:3499848	attR	GTATAATGGTATCGTAATTTAAGACACTTCAAGAGACATTTTTTAATGAATCTGATATACTGTAAACACTACAGAAAGAAGGATCATTATTATGTCACGAACAAGAAGGAGTTTCTCCGCTAAATTCAAATCAGAGCTGGTCATTGAATTGCTCAAAGGAGAAAAAGACTTAAATACGATAGCTGCTGAAAATAATATTCAACCGAATCTTCTCCGCAATTGGAAGAAAGAATTCCTTGATAAAGCTTCTGTTGTCTTTGACGATACACGGGAAAACAATCTGAAAGAGAAGCTTGCCTTAGAGCGCAAGGAAAAAGCGGAATATGCTAAAAAAGTTGGCCAGCTCACCATGCAGGTGGATTGGTTGAAAAAAAAATCTGAAGAAACACTTGGACCTGACTACGAGAGTAAATTTAGTCCGAAACCTTTTGAAGACTAAGGAACTCCCTGCCAAAACGGGTGCAACTCTTCTCGGTATCAACCGTACCAGCGTGTATTACAACGGAACACCCGTGTCTCAGGAAGAATTGGACTGCAAAGCGATCATAGACCGTCTACACACGGATAATCCAGCATGGGGAGCCCGTCAGATGTCTTCACAATTGAAAATGCGCGGTCATGAAGTCGGTCGCCGAAAAGCACGCCGCTATATGACAGAAATGGGGATTGATCCAATCTATCCAAAGATGAACCTTTCCAAACGTATGCAACAGGCAAAGGTCTGCCCGTATCTGCTGCGCAACGCCGTTATCGATCGTCCGAATCAGGCATGGTCAATCGACATTACCTACATCCCCATCAAACGTGGATTCCTGTATCTGACAGCCGTAATTGACTGGTATAGCCGCTGTATTGTAGGCTGGGATATTGATGATACCCTGGATACCAGAATGGTCATAAACGCATTGAAAAAGGCATTTAAGGTGGCGAAACCCGTTATCCTAAACTCGGATCAGGGATGTCAGTTTACAAGCAGCGAATACATAAATTTTCTCAAAGAGAACCACATTCGTCAGAGCATGGATGGCAAAAGTCGCTGGGCCGACAATATTATGATTGAGAGATGGTTTCGCAGTTTCAAATACGAGGAAGCATACCTTACCCAATATACCAACATCCGCGAGGCTCGAAAGGCGATAGGGAAATATATCCATACCTACAATTTTGAACGCTGTCATTCTGCTATCAACAACCAGACTCCTGCATCCTGCTACTATCCGGCACTGTTGATTGATTATGCAGCATAGGGGGAGCATCCTTCCCCCTCTTCAACTACATATATCAGTTCATTATAAAAAGATTGAATTTGTGTCTTGACAACTGAGCCACTATA	NA	NA	NA	NA
>prophage 13
NZ_CP045695	[Clostridium] scindens strain BL389WT3D chromosome, complete genome	3785527	3561254	3571349	3785527	tRNA	Bacillus_phage(37.5%)	13	NA	NA
WP_154323236.1|3561254_3562526_-	DNA repair protein	NA	O64031	Bacillus_phage	29.5	1.3e-42
WP_154323237.1|3562830_3563241_+	helix-turn-helix domain-containing protein	NA	Q0H244	Geobacillus_phage	30.8	1.2e-05
WP_009263235.1|3563333_3563849_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	31.6	2.0e-10
WP_009263236.1|3563908_3564070_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_154323238.1|3564202_3564913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154323239.1|3564969_3565479_+	GNAT family N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	49.7	4.3e-34
WP_154323240.1|3565581_3565878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154323241.1|3565888_3566887_-	hypothetical protein	NA	A0A2P0VK56	Streptococcus_phage	36.8	9.5e-17
WP_154323242.1|3566977_3567877_-	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	22.6	4.4e-05
WP_101882731.1|3567866_3568652_-	ParA family protein	NA	Q8JL10	Natrialba_phage	36.6	3.8e-21
WP_101882732.1|3568630_3568888_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_008976884.1|3568920_3569157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154323243.1|3569396_3571349_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.1	1.6e-84
