The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 2
NZ_AP021874	Desulfosarcina alkanivorans strain PL12	7324708	231628	336761	7324708	tail,plate,capsid,integrase,transposase	Acidithiobacillus_phage(20.83%)	91	227342:227356	318933:318949
227342:227356	attL	ATGCCGCTGAACGGC	NA	NA	NA	NA
WP_155314685.1|231628_232393_+|transposase	transposase	transposase	NA	NA	NA	NA
227342:227356	attL	ATGCCGCTGAACGGC	NA	NA	NA	NA
WP_155314686.1|232506_233235_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155314545.1|233370_234645_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155320263.1|234641_235451_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_155314687.1|235894_236131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314688.1|236245_236467_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_155314689.1|236564_237086_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155314690.1|237703_238618_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_155314691.1|238629_241176_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_155314692.1|242679_244845_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.5	2.5e-107
WP_155314693.1|244862_245642_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_155314694.1|245659_247663_-	protein kinase	NA	A0A1V0SH95	Hokovirus	27.8	3.2e-16
WP_155314695.1|247662_247983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314696.1|248024_248291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155320275.1|248610_250407_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	28.1	2.4e-18
WP_155314697.1|250403_251780_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_155314698.1|252098_252572_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_155320276.1|253137_253374_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_155314699.1|253392_254979_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_155314700.1|254993_255245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167527551.1|255248_257108_-	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	25.4	2.5e-23
WP_155314702.1|257299_260257_-	DUF499 domain-containing protein	NA	NA	NA	NA	NA
WP_155314703.1|260275_263314_-	DUF1156 domain-containing protein	NA	Q684G2	Sulfolobus_virus	24.6	7.8e-30
WP_155314704.1|263336_264575_-	hypothetical protein	NA	A0A2D1GR68	Pseudomonas_phage	38.0	2.6e-24
WP_155314705.1|264575_265964_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_155314706.1|265967_269417_-	DUF3883 domain-containing protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	29.3	1.4e-51
WP_155314707.1|269486_269714_-	excisionase family DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	50.9	7.6e-15
WP_155314708.1|270010_271324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314709.1|271606_275200_-	DUF4815 domain-containing protein	NA	F8WQ05	Bacillus_phage	25.6	5.9e-93
WP_155314710.1|275211_275745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314711.1|275758_276220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314712.1|276342_277329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314713.1|277338_277932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314714.1|277941_279513_-|tail	phage tail protein	tail	NA	NA	NA	NA
278071:278085	attR	GCCGTTCAGCGGCAT	NA	NA	NA	NA
WP_155314715.1|279512_280922_-|plate	baseplate J protein	plate	A0A1Q1PVP2	Phage_DP-2017a	28.0	1.5e-39
278071:278085	attR	GCCGTTCAGCGGCAT	NA	NA	NA	NA
WP_155314716.1|281201_282605_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_155320277.1|282677_283178_-|plate	baseplate protein	plate	NA	NA	NA	NA
WP_155314717.1|283177_284146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314718.1|284160_284463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314719.1|284473_284740_-	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	72.4	1.9e-09
WP_155314720.1|284742_285117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314721.1|285109_285877_-	glycosyltransferase	NA	A0A0F7L2F7	uncultured_marine_virus	30.0	2.1e-08
WP_155314722.1|285888_286938_-|plate	baseplate assembly protein V	plate	NA	NA	NA	NA
WP_155311006.1|286953_287280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314723.1|287266_287698_-	DUF882 domain-containing protein	NA	A0A2I7R3E7	Vibrio_phage	48.2	5.3e-25
WP_155314724.1|287711_288977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314725.1|289076_289367_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155314726.1|289363_289834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314727.1|289836_290148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314728.1|290155_293908_-|tail	phage tail tape measure protein	tail	H7BVM4	unidentified_phage	43.2	1.9e-70
WP_155314729.1|294053_294731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155306459.1|294747_295209_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_155314731.1|297080_297359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314732.1|297375_297924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314733.1|297995_298481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167528049.1|298470_298827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314735.1|298829_299282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314736.1|299268_299640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314737.1|299655_300519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314738.1|300538_300901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314739.1|300916_304771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314740.1|304929_306516_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_155314741.1|308256_309783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155310984.1|310054_310246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155314742.1|310276_310681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155314743.1|310634_311576_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	25.9	3.8e-15
WP_155314744.1|311887_312418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314745.1|312507_312777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314746.1|312773_313523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314747.1|313945_317278_-	DNA primase	NA	NA	NA	NA	NA
WP_155314748.1|317301_319539_-	AAA family ATPase	NA	A0A218KCE8	Bacillus_phage	30.1	2.0e-62
WP_155314749.1|319508_319970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314750.1|319971_320466_-	DUF669 domain-containing protein	NA	NA	NA	NA	NA
WP_155314751.1|320489_321269_-	AAA family ATPase	NA	A0A2H4PB95	Lactobacillus_phage	27.8	6.5e-13
WP_155314752.1|321292_322309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314753.1|322308_322623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314754.1|322760_323348_-	RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
WP_155314755.1|323524_323857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314756.1|324231_324654_-	hypothetical protein	NA	K4HZX2	Acidithiobacillus_phage	34.7	4.7e-10
WP_155314757.1|324650_326237_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	46.0	1.6e-90
WP_155314758.1|326229_326754_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	34.4	7.2e-16
WP_155314759.1|326789_327038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314760.1|327341_327965_+	repressor LexA	NA	E5DV74	Deep-sea_thermophilic_phage	34.5	8.3e-11
WP_155314761.1|328011_329178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155320279.1|329170_330247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011369119.1|332825_333059_-	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	56.3	4.1e-16
WP_155314762.1|333072_333711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167527552.1|333763_334000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167527553.1|334063_334387_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155314765.1|334467_335226_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.1	8.1e-61
WP_167527554.1|335222_336761_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	50.3	4.4e-138
>prophage 3
NZ_AP021874	Desulfosarcina alkanivorans strain PL12	7324708	352351	402391	7324708	tail,plate,portal,capsid,integrase,transposase	uncultured_Mediterranean_phage(23.08%)	54	386168:386185	403405:403422
WP_155314775.1|352351_353386_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	33.7	6.1e-43
WP_155314776.1|353751_354954_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155314777.1|354950_355490_-	TolC family protein	NA	NA	NA	NA	NA
WP_155314778.1|355486_356962_-	TolC family protein	NA	NA	NA	NA	NA
WP_155314779.1|356958_357579_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155314780.1|357735_358248_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_040202369.1|358259_358613_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_155314781.1|358641_359421_-	glucosamine 6-phosphate synthetase	NA	A0A1B1IUF7	uncultured_Mediterranean_phage	39.1	1.7e-50
WP_155314782.1|359405_359927_-	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_011367788.1|359938_360898_-	amidoligase	NA	A0A1B1IUD7	uncultured_Mediterranean_phage	61.4	2.1e-106
WP_022993020.1|361146_361404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314783.1|361416_364965_-	DUF4815 domain-containing protein	NA	F8WQ05	Bacillus_phage	25.8	5.7e-72
WP_155314784.1|364980_365514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314785.1|365526_365988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314786.1|366110_367100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314787.1|367110_367704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314788.1|367714_369289_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_155314789.1|369288_370698_-|plate	baseplate J protein	plate	A0A1Q1PVP2	Phage_DP-2017a	25.3	3.0e-40
WP_155314790.1|370797_371715_-	hypothetical protein	NA	M4SKQ1	Cyanophage	37.6	1.8e-06
WP_155314791.1|371714_372605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314792.1|372617_373628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314793.1|373624_373933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011366988.1|373943_374207_-	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	67.9	1.9e-09
WP_155314794.1|374203_374578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314795.1|374590_375640_-|plate	baseplate assembly protein V	plate	NA	NA	NA	NA
WP_155314796.1|375632_376052_-	DUF1353 domain-containing protein	NA	A0A2H4JDM4	uncultured_Caudovirales_phage	45.4	2.8e-15
WP_011700609.1|376048_376423_-	DUF882 domain-containing protein	NA	I7FWL0	Pectobacterium_phage	45.0	5.5e-18
WP_155314797.1|376415_377699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314798.1|377765_378056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011366981.1|378052_378523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314799.1|378525_378837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314800.1|378845_382481_-|tail	phage tail tape measure protein	tail	H7BVM4	unidentified_phage	40.0	1.0e-76
WP_155314801.1|382624_383302_-	hypothetical protein	NA	A0A127AX46	Bacillus_phage	27.1	2.4e-08
WP_015721240.1|383317_383779_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_155314802.1|383794_385324_-|tail	phage tail protein	tail	A0A127AW39	Bacillus_phage	35.6	1.8e-75
WP_028577512.1|385326_385584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314803.1|385596_386145_-	hypothetical protein	NA	NA	NA	NA	NA
386168:386185	attL	GGTTACTTACCGGAAGCG	NA	NA	NA	NA
WP_155314804.1|386204_386690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314805.1|386679_387039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028320579.1|387025_387490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011366970.1|387476_387836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011366969.1|387854_388718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314806.1|388736_389099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314807.1|389111_391508_-	DNA methyltransferase	NA	NA	NA	NA	NA
WP_011366966.1|391611_391965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314808.1|391961_392474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314809.1|392470_397060_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_155314810.1|397059_398568_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_155314811.1|398682_400206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022992990.1|400205_400484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155320282.1|400480_400753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314812.1|400893_401088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155314813.1|401121_401496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155314814.1|401476_402391_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	27.6	2.1e-15
403405:403422	attR	GGTTACTTACCGGAAGCG	NA	NA	NA	NA
>prophage 4
NZ_AP021874	Desulfosarcina alkanivorans strain PL12	7324708	427658	438436	7324708		Bacillus_virus(33.33%)	6	NA	NA
WP_155314830.1|427658_429086_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	40.0	1.3e-72
WP_155314831.1|429190_431485_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.7	7.1e-84
WP_155320283.1|431644_433555_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.4	1.3e-91
WP_155320284.1|433866_434538_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	38.7	1.1e-21
WP_155314832.1|434627_435377_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.3	4.5e-11
WP_155314833.1|435703_438436_-	CBS domain-containing protein	NA	R4T733	Halovirus	28.4	3.1e-09
>prophage 5
NZ_AP021874	Desulfosarcina alkanivorans strain PL12	7324708	550418	602441	7324708	tRNA,transposase,integrase	Moraxella_phage(33.33%)	41	559912:559927	595093:595108
WP_155314931.1|550418_552146_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_155314932.1|552135_552630_+	bifunctional nuclease family protein	NA	NA	NA	NA	NA
WP_155314933.1|552807_554007_-	aminopeptidase	NA	NA	NA	NA	NA
WP_155314934.1|554024_554276_-	cytoplasmic protein	NA	NA	NA	NA	NA
WP_155314935.1|554623_555313_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155314936.1|555381_555840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155314937.1|556011_556428_+	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_155320288.1|556561_557386_+	P-loop NTPase	NA	NA	NA	NA	NA
WP_167527566.1|557870_560201_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
559912:559927	attL	TTAAAAACGGTATTGA	NA	NA	NA	NA
WP_167527567.1|560262_561603_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_155314940.1|561734_562511_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_155314941.1|562756_565186_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.0	1.8e-178
WP_155314942.1|565182_565872_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_155314943.1|566031_566700_+	phosphatidylserine decarboxylase family protein	NA	NA	NA	NA	NA
WP_155314944.1|566959_567427_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_155314945.1|567441_567642_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_155320289.1|567881_568544_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	35.6	2.2e-30
WP_155314946.1|568698_569484_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_155314947.1|569566_570991_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_155314948.1|570987_572460_-	histidine kinase	NA	NA	NA	NA	NA
WP_155314949.1|572437_575098_-	pyruvate, water dikinase	NA	NA	NA	NA	NA
WP_155314950.1|575239_575926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314951.1|575922_577221_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_155320290.1|577309_577714_-	response regulator	NA	NA	NA	NA	NA
WP_155314952.1|577719_578130_-	response regulator	NA	NA	NA	NA	NA
WP_155314953.1|578189_578621_-	response regulator	NA	NA	NA	NA	NA
WP_155314954.1|578651_580385_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_155314955.1|580763_581759_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	43.4	3.3e-62
WP_155314956.1|582133_582454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155314957.1|582823_586210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155314958.1|586769_587813_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_155314959.1|588243_588900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155314960.1|589685_590468_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155320291.1|590628_591078_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155314958.1|591613_592657_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_155314961.1|593482_594874_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_155314962.1|595615_596476_+	hypothetical protein	NA	NA	NA	NA	NA
595093:595108	attR	TTAAAAACGGTATTGA	NA	NA	NA	NA
WP_155314963.1|596812_598450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155314964.1|598631_600698_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_155314965.1|600690_600876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155314960.1|601658_602441_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_AP021874	Desulfosarcina alkanivorans strain PL12	7324708	1032297	1103128	7324708	tRNA,transposase	Bacillus_phage(14.29%)	56	NA	NA
WP_155315305.1|1032297_1033728_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	29.2	9.0e-53
WP_155315306.1|1033734_1035729_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_155315307.1|1035903_1037751_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_155315308.1|1037935_1038868_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_155315309.1|1039200_1040118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155315310.1|1040216_1040831_+	gliding motility protein	NA	NA	NA	NA	NA
WP_155315311.1|1040846_1042055_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155315312.1|1042292_1042643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155315313.1|1042716_1043613_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	37.3	1.3e-49
WP_155315314.1|1043602_1044550_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_155315315.1|1044919_1045552_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155315316.1|1045774_1047808_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	35.7	6.5e-73
WP_155315317.1|1047964_1049767_+	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_155315318.1|1050028_1050256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155315319.1|1050449_1050818_+	response regulator	NA	W8CYM9	Bacillus_phage	38.5	8.0e-14
WP_155315320.1|1050814_1053001_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	34.8	7.9e-16
WP_155315321.1|1053019_1054138_+	DNA photolyase	NA	NA	NA	NA	NA
WP_155315322.1|1054134_1054815_+	hypothetical protein	NA	A0A1P8CWK6	Bacillus_phage	41.1	4.3e-13
WP_155315323.1|1054969_1057045_-	elongation factor G	NA	A0A2K9L6L3	Tupanvirus	21.8	4.0e-17
WP_155315324.1|1057261_1058050_-	TlyA family rRNA (cytidine-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_167528051.1|1058050_1059961_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_155315326.1|1059997_1060891_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_155315327.1|1060902_1061139_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_155315328.1|1061207_1062575_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	38.2	1.1e-39
WP_155315329.1|1062668_1062962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155315330.1|1063145_1063841_+	BAX inhibitor (BI)-1/YccA family protein	NA	NA	NA	NA	NA
WP_155315331.1|1064022_1065387_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_155315332.1|1065593_1066823_-	protein GlmU	NA	NA	NA	NA	NA
WP_155320311.1|1066885_1067308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155315333.1|1067325_1067610_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155315334.1|1067629_1069480_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_155315335.1|1069763_1070738_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	34.5	4.1e-33
WP_155315336.1|1071230_1073165_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A0N9QYX6	Chrysochromulina_ericina_virus	29.0	2.9e-38
WP_155315337.1|1073201_1074581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155315338.1|1074577_1075801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167527603.1|1075805_1077200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155315340.1|1077189_1078434_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_155315341.1|1078571_1079396_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_155315342.1|1079543_1080800_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_155315343.1|1080868_1081960_-	GDP-mannose 4,6-dehydratase	NA	M1HAR7	Acanthocystis_turfacea_Chlorella_virus	66.1	4.5e-137
WP_155315344.1|1081974_1082343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155315346.1|1083735_1084953_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	25.3	1.3e-07
WP_155315347.1|1085228_1086518_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_167527604.1|1086647_1087778_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_155315350.1|1089968_1091372_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_155315351.1|1091659_1092649_-	NAD-dependent epimerase/dehydratase family protein	NA	M4QRT5	Synechococcus_phage	44.8	1.5e-70
WP_155315352.1|1092677_1093442_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_167527605.1|1093444_1094380_-	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	57.6	4.7e-103
WP_155320313.1|1094372_1095551_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_155315353.1|1095663_1097949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155315354.1|1098492_1099005_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_155315355.1|1099100_1099961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155320314.1|1099971_1100607_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155320315.1|1100623_1101649_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_167527606.1|1102237_1102750_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_167527607.1|1102789_1103128_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_AP021874	Desulfosarcina alkanivorans strain PL12	7324708	1120811	1129735	7324708	integrase,transposase	Sulfolobus_monocaudavirus(100.0%)	8	1111584:1111598	1121314:1121328
1111584:1111598	attL	ATAAATATCCAATAG	NA	NA	NA	NA
WP_155315372.1|1120811_1121063_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155315354.1|1121853_1122366_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
1121314:1121328	attR	CTATTGGATATTTAT	NA	NA	NA	NA
WP_155315373.1|1122738_1123632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155315374.1|1123774_1124110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155320316.1|1124610_1125834_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155315375.1|1126366_1126801_-|transposase	IS200/IS605 family transposase	transposase	W0UUZ0	Sulfolobus_monocaudavirus	36.1	9.1e-17
WP_167527609.1|1126932_1128036_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155315377.1|1128376_1129735_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_AP021874	Desulfosarcina alkanivorans strain PL12	7324708	2055421	2122606	7324708	integrase,protease,transposase	uncultured_Mediterranean_phage(20.0%)	58	2064711:2064757	2113716:2113762
WP_155316124.1|2055421_2055940_-|protease	DJ-1/PfpI/YhbO family deglycase/protease	protease	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	32.9	2.4e-16
WP_155316125.1|2056017_2056935_-	DUF2156 domain-containing protein	NA	NA	NA	NA	NA
WP_155316126.1|2056931_2057345_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155316127.1|2057452_2058370_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_155316128.1|2058534_2060331_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	28.0	3.7e-27
WP_155316129.1|2060574_2061861_+	homoaconitate hydratase family protein	NA	NA	NA	NA	NA
WP_155316130.1|2062030_2062555_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_155316131.1|2062631_2064425_+	SLC13 family permease	NA	NA	NA	NA	NA
2064711:2064757	attL	GACTGAAAATCCCCGTGTCGGCAGTTCGATTCTGTCCCTCGGCACCA	NA	NA	NA	NA
WP_155316132.1|2064817_2065897_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_155316133.1|2066244_2067894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155316134.1|2067912_2069040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155316135.1|2069156_2069495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155316136.1|2069841_2070417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167527682.1|2071233_2071548_-	helix-turn-helix transcriptional regulator	NA	S5M643	Brevibacillus_phage	46.9	5.6e-08
WP_155316138.1|2071723_2072461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155316139.1|2072479_2073106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155316140.1|2073316_2076103_-	DEAD/DEAH box helicase family protein	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	25.9	5.7e-43
WP_155316141.1|2076083_2076584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155316142.1|2076586_2077144_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_155316143.1|2077140_2078328_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_155316144.1|2078339_2081912_-	DUF1156 domain-containing protein	NA	K9MDJ7	Sulfolobus_virus	21.1	4.4e-08
WP_155316145.1|2081908_2082859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155316146.1|2082855_2085654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155316147.1|2085696_2085903_-	excisionase family DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	62.5	1.9e-17
WP_155316148.1|2086122_2086347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155316149.1|2086636_2086954_-	DUF2958 domain-containing protein	NA	NA	NA	NA	NA
WP_155316150.1|2086934_2087738_-	antirestriction protein	NA	NA	NA	NA	NA
WP_155316151.1|2088192_2088552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155316152.1|2088684_2088882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155316153.1|2089004_2089715_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6W0	Gordonia_phage	32.3	2.3e-09
WP_155316154.1|2089831_2090779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155320365.1|2091757_2092699_+	sirohydrochlorin cobaltochelatase	NA	NA	NA	NA	NA
WP_155316155.1|2092809_2093607_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.0	3.9e-13
WP_155316156.1|2093603_2094416_-	cobalt ECF transporter T component CbiQ	NA	NA	NA	NA	NA
WP_155316157.1|2094504_2095536_-	cobalamin biosynthesis protein CbiM	NA	NA	NA	NA	NA
WP_155316158.1|2095571_2095811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155316159.1|2095780_2096893_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_155316160.1|2096954_2097662_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155320366.1|2097792_2100381_+	HAD-IC family P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	30.0	4.9e-73
WP_155316161.1|2100481_2101066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167527683.1|2101368_2101776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155316163.1|2101772_2102237_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_155316164.1|2102233_2102779_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_155316165.1|2102929_2103175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155316166.1|2103278_2103845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155316167.1|2103943_2104804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155316168.1|2104863_2105703_+	c-type cytochrome biogenesis protein CcsB	NA	NA	NA	NA	NA
WP_155316169.1|2105970_2106789_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_155316170.1|2107852_2108131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155316171.1|2108238_2108547_+	glycoside hydrolase	NA	NA	NA	NA	NA
WP_155316172.1|2108723_2110454_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155316173.1|2110708_2111473_-	YjbE family putative metal transport protein	NA	W8EBD0	Pseudomonas_phage	37.2	1.7e-26
WP_155316174.1|2111993_2112506_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
WP_155316175.1|2112898_2113243_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_155316176.1|2115888_2116971_+	endonuclease	NA	NA	NA	NA	NA
2113716:2113762	attR	GACTGAAAATCCCCGTGTCGGCAGTTCGATTCTGTCCCTCGGCACCA	NA	NA	NA	NA
WP_155316177.1|2118881_2119487_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_155316178.1|2119999_2121316_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_167527684.1|2121472_2122606_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_AP021874	Desulfosarcina alkanivorans strain PL12	7324708	2765735	2823382	7324708	tRNA,integrase,transposase,holin,protease	Anomala_cuprea_entomopoxvirus(14.29%)	58	2814603:2814620	2821611:2821628
WP_155316689.1|2765735_2766242_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_155316690.1|2766455_2767787_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_155316691.1|2767969_2768284_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_155316692.1|2768711_2769566_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_155316693.1|2769757_2770726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155316694.1|2771070_2771871_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	30.3	2.2e-08
WP_155316695.1|2771867_2772764_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_155316696.1|2772984_2773974_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155316697.1|2774154_2774442_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_155316698.1|2774533_2775364_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_155316699.1|2775596_2775818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155320396.1|2775804_2777424_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_155316700.1|2777695_2779360_-|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	30.5	1.5e-59
WP_155316701.1|2779498_2781391_-	aldehyde ferredoxin oxidoreductase	NA	NA	NA	NA	NA
WP_155316702.1|2781383_2781818_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_155316703.1|2781933_2783154_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155316704.1|2783332_2784298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155316705.1|2784304_2785204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155316706.1|2785321_2786026_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.8	5.6e-16
WP_155320397.1|2786009_2786771_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.2	9.8e-06
WP_155316707.1|2786767_2787490_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155316708.1|2788070_2789798_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	28.9	1.9e-36
WP_155316709.1|2790218_2791175_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	9.4e-14
WP_155316710.1|2791369_2791975_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	53.4	9.3e-60
WP_155316711.1|2792016_2792391_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_155316712.1|2792672_2793275_-	formylmethanofuran dehydrogenase	NA	NA	NA	NA	NA
WP_155316713.1|2793276_2793825_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_155316714.1|2793906_2796057_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_155316715.1|2796414_2797506_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155316716.1|2797707_2798460_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.3	4.2e-17
WP_155320398.1|2798456_2799413_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_155316717.1|2799785_2801291_-	succinate CoA transferase	NA	NA	NA	NA	NA
WP_155316718.1|2801734_2802820_+	YedE-related selenium metabolism membrane protein	NA	NA	NA	NA	NA
WP_155316719.1|2802831_2803050_+	preprotein translocase subunit TatB	NA	NA	NA	NA	NA
WP_155316720.1|2803012_2803609_+	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_155316721.1|2803596_2804454_+	sugar kinase	NA	NA	NA	NA	NA
WP_155316722.1|2804671_2805805_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_155316723.1|2806068_2806266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155316724.1|2806734_2806917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155316725.1|2807398_2807755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155316726.1|2807878_2808313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167527740.1|2808317_2809004_-	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_155314961.1|2809134_2810526_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_155316728.1|2810721_2811195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155315006.1|2811447_2813112_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_155316729.1|2813294_2813891_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_155316730.1|2813919_2814405_-	hypothetical protein	NA	NA	NA	NA	NA
2814603:2814620	attL	TTTTCTCTTTAACCGCCA	NA	NA	NA	NA
WP_155316731.1|2815020_2815335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155316732.1|2815347_2816283_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	30.3	7.7e-29
WP_155316733.1|2816263_2817250_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	32.5	9.3e-33
WP_155316734.1|2817438_2820084_-	toprim domain-containing protein	NA	F4YCQ9	Synechococcus_phage	26.6	2.7e-18
WP_155316735.1|2820080_2820371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155316736.1|2820539_2820884_+	helix-turn-helix domain-containing protein	NA	A0A2I7SDF8	Paenibacillus_phage	28.2	6.4e-05
WP_167528063.1|2820928_2821135_+	prevent-host-death protein	NA	NA	NA	NA	NA
WP_155316738.1|2821103_2821373_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_155316739.1|2821652_2822582_-	hypothetical protein	NA	F4YCQ9	Synechococcus_phage	25.7	9.7e-16
2821611:2821628	attR	TGGCGGTTAAAGAGAAAA	NA	NA	NA	NA
WP_155316735.1|2822578_2822869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155316736.1|2823037_2823382_+	helix-turn-helix domain-containing protein	NA	A0A2I7SDF8	Paenibacillus_phage	28.2	6.4e-05
>prophage 10
NZ_AP021874	Desulfosarcina alkanivorans strain PL12	7324708	3384139	3393707	7324708		Staphylococcus_phage(50.0%)	11	NA	NA
WP_155317188.1|3384139_3384886_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.1	4.3e-14
WP_155317189.1|3385032_3385263_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	31.5	1.9e-05
WP_155317190.1|3385391_3386633_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_155317191.1|3386994_3387447_+	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_155317192.1|3387463_3388732_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A240F3L3	Aeromonas_phage	50.9	1.2e-93
WP_155317193.1|3388744_3389254_+	cytidine deaminase	NA	A0A285PY53	Cedratvirus	57.3	9.6e-50
WP_155317194.1|3389317_3389779_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_155317195.1|3389998_3391099_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.4	1.3e-46
WP_155317196.1|3391138_3391804_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.7	8.2e-33
WP_155317197.1|3391988_3393215_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.0	3.9e-97
WP_155317198.1|3393233_3393707_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.0	7.3e-36
>prophage 11
NZ_AP021874	Desulfosarcina alkanivorans strain PL12	7324708	4170324	4226268	7324708	transposase	Pike_perch_iridovirus(33.33%)	46	NA	NA
WP_155317786.1|4170324_4170426_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_167527852.1|4170385_4170646_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_167527850.1|4170761_4171289_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_155317773.1|4171381_4172866_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_155317788.1|4172915_4174532_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	46.7	2.4e-14
WP_155317789.1|4174579_4175026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155317790.1|4175041_4175332_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_155317791.1|4175910_4177347_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_155315006.1|4177565_4179230_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_155317792.1|4179977_4180250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155317793.1|4180599_4181751_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_155317794.1|4182145_4183792_+	long-chain-fatty-acid--CoA ligase	NA	Q75ZG1	Hepacivirus	24.2	4.2e-38
WP_155317795.1|4183860_4185045_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_167527853.1|4185239_4186574_+	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_155317797.1|4186574_4187780_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
WP_155317798.1|4187823_4188654_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_155317799.1|4188724_4189564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155317800.1|4189763_4190969_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_155317801.1|4191038_4192157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155320478.1|4192240_4192546_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155320479.1|4192798_4193011_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155317802.1|4193098_4194223_-	CoA transferase	NA	NA	NA	NA	NA
WP_155317803.1|4194259_4195429_-	thiolase family protein	NA	NA	NA	NA	NA
WP_155317804.1|4195425_4195845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155317805.1|4195982_4197134_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_155317806.1|4197255_4198923_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	24.7	2.9e-26
WP_155317807.1|4198984_4199767_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_155317808.1|4199798_4200566_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155317809.1|4200853_4202389_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_155317810.1|4202793_4204647_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_155317811.1|4204660_4205815_-	CoA transferase	NA	NA	NA	NA	NA
WP_155317812.1|4205825_4206263_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_155317813.1|4206266_4207409_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_155317814.1|4207419_4208559_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_155317815.1|4208566_4210225_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_155317816.1|4210396_4210747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155317817.1|4210749_4211136_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_155317818.1|4211203_4212346_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_155317819.1|4212385_4213540_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_167527854.1|4213791_4215273_-	long-chain fatty acid--CoA ligase	NA	NA	NA	NA	NA
WP_155317821.1|4215321_4216533_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
WP_155317822.1|4216548_4219278_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155317823.1|4219302_4221408_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155317824.1|4221572_4222202_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155317825.1|4223392_4224550_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_155315006.1|4224603_4226268_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_AP021874	Desulfosarcina alkanivorans strain PL12	7324708	5666894	5676403	7324708	integrase,protease	Virus_Rctr41k(50.0%)	9	5659340:5659355	5672455:5672470
5659340:5659355	attL	GACCTGCGGCGCCTGC	NA	NA	NA	NA
WP_155318980.1|5666894_5668076_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJP1	Virus_Rctr41k	28.8	3.6e-07
WP_155314548.1|5668062_5669031_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_155314547.1|5669027_5670047_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_155318981.1|5670628_5671276_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_155318982.1|5671570_5672620_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
5672455:5672470	attR	GCAGGCGCCGCAGGTC	NA	NA	NA	NA
WP_155318983.1|5672616_5673585_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_155318984.1|5673671_5674022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155318985.1|5674124_5674409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155318986.1|5674438_5676403_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.2	5.3e-112
>prophage 14
NZ_AP021874	Desulfosarcina alkanivorans strain PL12	7324708	6351438	6412480	7324708	tRNA,protease,transposase	Ostreococcus_tauri_virus(10.0%)	47	NA	NA
WP_155319505.1|6351438_6353376_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	A9YVR1	Ostreococcus_tauri_virus	41.7	8.3e-110
WP_155319506.1|6353449_6354922_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_155319507.1|6354896_6355286_-	DUF3568 family protein	NA	NA	NA	NA	NA
WP_155319508.1|6356090_6356723_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_155319509.1|6356768_6358694_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	50.7	7.1e-154
WP_155319510.1|6358857_6360432_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	28.1	1.5e-24
WP_155319511.1|6360740_6361106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155320571.1|6361416_6362997_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	32.1	2.4e-38
WP_155319512.1|6363064_6363385_+	DUF1844 domain-containing protein	NA	NA	NA	NA	NA
WP_155319513.1|6363409_6364300_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_155319514.1|6364436_6365390_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	37.4	5.3e-49
WP_167527982.1|6365413_6366061_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_155319516.1|6366112_6366694_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_167528079.1|6366735_6368730_+	sodium-translocating pyrophosphatase	NA	NA	NA	NA	NA
WP_155319518.1|6369000_6369546_+	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_155319519.1|6369558_6370551_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_155320572.1|6370628_6372692_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155319520.1|6372922_6373495_-	RnfABCDGE type electron transport complex subunit A	NA	NA	NA	NA	NA
WP_155319521.1|6373514_6374138_-	RnfABCDGE type electron transport complex subunit E	NA	NA	NA	NA	NA
WP_155319522.1|6374151_6374745_-	RnfABCDGE type electron transport complex subunit G	NA	NA	NA	NA	NA
WP_155319523.1|6374746_6375709_-	RnfABCDGE type electron transport complex subunit D	NA	NA	NA	NA	NA
WP_155319524.1|6375698_6376982_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_155319525.1|6377056_6377506_-	cytochrome C	NA	NA	NA	NA	NA
WP_155319526.1|6377817_6379389_-	DUF4445 domain-containing protein	NA	NA	NA	NA	NA
WP_155319527.1|6379430_6380195_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	28.1	4.2e-17
WP_155319528.1|6380354_6381194_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155319529.1|6381215_6382055_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155319530.1|6382062_6382740_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	33.0	5.8e-18
WP_155319531.1|6382802_6383753_-	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	34.9	7.3e-51
WP_155319532.1|6383842_6384592_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_155319533.1|6385157_6385475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155319534.1|6385485_6387183_+	phosphotransferase	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	30.7	1.1e-44
WP_167527983.1|6387854_6395303_+	cadherin-like domain-containing protein	NA	E5ERA2	Bathycoccus_sp._RCC1105_virus	27.7	6.8e-51
WP_155319536.1|6395326_6395914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155319537.1|6396035_6397235_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155315350.1|6397317_6398721_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_155319538.1|6399401_6399992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155314961.1|6400032_6401424_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_155319539.1|6401554_6403729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155319540.1|6403960_6404866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155319541.1|6404889_6405480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155319542.1|6405476_6406985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155316279.1|6406898_6408290_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_155319543.1|6408374_6409223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155319544.1|6409454_6410372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155319545.1|6410404_6411031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155319546.1|6411190_6412480_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_AP021874	Desulfosarcina alkanivorans strain PL12	7324708	6786311	6853216	7324708	tRNA,transposase,integrase	Cronobacter_phage(10.0%)	43	6839045:6839104	6846616:6847906
WP_155319857.1|6786311_6787601_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	34.1	2.6e-67
WP_155319858.1|6798701_6800291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155319859.1|6800268_6801651_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_155319860.1|6801812_6802433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155319861.1|6802739_6803753_+	transporter substrate-binding domain-containing protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	42.8	2.1e-72
WP_155319862.1|6803910_6805089_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155319863.1|6805085_6806180_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155319864.1|6806331_6807108_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.1	6.6e-34
WP_155319865.1|6807145_6808267_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.0	9.0e-32
WP_155319866.1|6808352_6811790_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_167528009.1|6811896_6812751_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_155319868.1|6813014_6814406_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_155319869.1|6814406_6815762_+	AAA family ATPase	NA	G3MBE0	Bacillus_virus	43.9	3.5e-91
WP_155319870.1|6815869_6816271_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
WP_155319871.1|6816508_6817003_+	DUF3124 domain-containing protein	NA	NA	NA	NA	NA
WP_155319872.1|6817208_6818069_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_155319873.1|6818117_6819428_-	TolC family protein	NA	NA	NA	NA	NA
WP_155319874.1|6819445_6820567_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_155319875.1|6820570_6821698_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_155320598.1|6821979_6823905_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.0	6.1e-20
WP_155319876.1|6823928_6825116_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155319877.1|6825112_6825814_-	CerR family C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_155319878.1|6826150_6827071_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	40.5	4.0e-22
WP_155319879.1|6827301_6829176_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_155319880.1|6829172_6829781_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_155319881.1|6829777_6830587_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_155319882.1|6830706_6831609_+	DnaJ domain-containing protein	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	29.2	1.6e-15
WP_155319883.1|6831829_6832351_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	30.1	1.9e-08
WP_155320599.1|6832366_6834691_+	DUF3426 domain-containing protein	NA	NA	NA	NA	NA
WP_155319884.1|6834926_6836699_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_155319885.1|6836792_6837089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314545.1|6837769_6839044_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155320263.1|6839040_6839850_+	AAA family ATPase	NA	NA	NA	NA	NA
6839045:6839104	attL	ATACGCCGTATCTGCCGTTCTTCGGTTTTGAGAAAGAGCCCTTCACGGCGGATATCGCGG	NA	NA	NA	NA
WP_155319886.1|6840288_6841149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155319887.1|6841402_6841648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155319888.1|6841748_6842063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155319889.1|6842589_6843724_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	29.9	4.7e-20
WP_155319890.1|6843907_6844288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314545.1|6845340_6846615_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155320263.1|6846611_6847421_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_155319891.1|6849061_6850510_-|transposase	transposase	transposase	NA	NA	NA	NA
6846616:6847906	attR	ATACGCCGTATCTGCCGTTCTTCGGTTTTGAGAAAGAGCCCTTCACGGCGGATATCGCGGTGACGGATATACTTGAAACGGATCAACTGGCGGCAGCGAAGAACCGTTTCGATTACAGTTTGGGGTTAGGGGCGATTTATCTGATCACCGGTGAGATCGGCTCCGGTAAATCCACAGCCATCCGTTATCTGGTAAACGGTCTGCATCCTTCCGAGTACAAGCTGGTCTACGTCACAGCCACGTCCGGTTCCATCCTGGAACTGTACCGCCTGATCATGGGAGAACTGGGAATGAAACCTGCCGGGACCTCCCGTGCGGCCATGACCGATGGAATCAAACGAGAAGTATTGGAATTGATCCACGGGAAAAAACAAAATGTCGTTCTGGTCATCGATGAAGCCTCTTTGCTCCGTCTGGAAGTCTTCGTGGAGCTGCATACGCTGTGTCAGTTCGAGATGGACTCAAAACCCTACCTGCCCATGGTACTGGCCGGACAAACTCATTTGATCGACAACCTGCGATATCCGGGTTGTCTTCCCCTGGCATCGCGGGTGGTGGCCAAAAGCCATTTCATCGGTTCCAAAAAAGAACAGATGCAAACCTATCTTCAGCATCATCTGACCATTGCCGGAATCGACCGGATGCTGTTCGAAGGTGATGCTATCACGGCCATCCACCAAGGATCGGGCGGCATCTTCAGGAAAGCCAACCACCTGGCTCGCGGTGCCCTGGTTGCCGCGGCAATGGGTCATGAAAAAACTGTCAACGCGGAACATGTGCGGCTTGCCGCATCCGAAATATTTTAGGAAAGGAGTCGATATGCCATCCCATCCGACCGCCGAAGATATCCGCCAAAAACTGGAGGCGCTTGTATTGGCCGCCATCTTAAATGTGCTCAACCGATTAACGGATGAGTTGTCTGTGGTAAGCCAGCAGAAAAAGATGAAATTTTAATCCGATTCGATACGGTTTGCCCGGTGAAACGGAGACAGGCTCTGCTGGGGAGCAACCTGTCAAGGGATAGCCGGGTGCAGGAGGCATTGAATAAAATGCCCAGAGGGGAGTAGCAAATCAGAAATGCTGCTCCCCTCATTTTATTCAAGCCTTCCTGCCCATGCCTTGAAAAACCCATAAGATTGGAGCGCGTAGCGCACCCTAATAGAGGTCCGACCAACGGTGGAAAGTCGTTGAAAACCGGTGGATATAAACAAAGTTCCAGTAAATTTGAAAACTTCGAAAACTCTTCAATTTAATCCGAAAATTGTCTTCCGTTGATTGCGGGAATCAACAA	NA	NA	NA	NA
WP_155319892.1|6850819_6851407_-	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_155316411.1|6851857_6853216_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_AP021874	Desulfosarcina alkanivorans strain PL12	7324708	6861899	6924064	7324708	integrase,transposase	Cyanophage(33.33%)	43	6891263:6891322	6922080:6922173
WP_167528011.1|6861899_6862247_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_155319901.1|6862902_6872625_+	cadherin-like domain-containing protein	NA	E5ERA2	Bathycoccus_sp._RCC1105_virus	31.1	2.9e-46
WP_155319902.1|6872644_6873340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155319903.1|6873383_6875567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155319904.1|6875589_6875883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155319905.1|6876147_6877203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155319906.1|6877254_6877830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155319907.1|6877826_6879923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155319908.1|6879945_6880290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155315006.1|6880276_6881941_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_155319909.1|6882433_6883447_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155319910.1|6883575_6884964_+	hypothetical protein	NA	A0A127KLT2	Cyanophage	40.4	1.6e-09
WP_155319911.1|6884983_6885523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155314958.1|6885861_6886905_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_155319912.1|6887137_6887455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155319913.1|6887497_6888619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155316279.1|6888757_6890149_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_155319909.1|6890313_6891327_+|transposase	transposase	transposase	NA	NA	NA	NA
6891263:6891322	attL	CTGTGAAACGGGGAGAGGGGATCGTCAAGGAAAGAAGGTTCGATATTTCAGACTTCCTAC	NA	NA	NA	NA
WP_155319914.1|6891698_6897194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155319915.1|6897577_6898012_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_155319916.1|6898017_6898500_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155319917.1|6898789_6899161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155319918.1|6899117_6901790_+	toprim domain-containing protein	NA	A0A1S5RF71	Helicobacter_phage	25.4	5.8e-21
WP_155319919.1|6901971_6902958_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	31.7	4.6e-32
WP_155319920.1|6902938_6903874_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	30.3	1.0e-28
WP_155316731.1|6903886_6904201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155319915.1|6905583_6906018_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_155319916.1|6906023_6906506_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155319921.1|6906795_6907110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155319909.1|6907147_6908161_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_167528012.1|6908209_6910969_+	hypothetical protein	NA	A0A127KLT2	Cyanophage	39.1	4.8e-18
WP_155319923.1|6911020_6911545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155319924.1|6911573_6913664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155319925.1|6913686_6913980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155314961.1|6914088_6915480_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_155319926.1|6915943_6916852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155319927.1|6916871_6917411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155319928.1|6917749_6917914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155314961.1|6918071_6919463_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_167528013.1|6919534_6920365_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_155319909.1|6921035_6922049_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155319930.1|6922184_6922973_+	hypothetical protein	NA	NA	NA	NA	NA
6922080:6922173	attR	CTGTGAAACGGGGAGAGGGGATCGTCAAGGAAAGAAGGTTCGATATTTCAGACTTCCTACCGTAATTTATATATTTATGGATGTCCCTAAGGTT	NA	NA	NA	NA
WP_155319931.1|6923059_6924064_+|transposase	transposase	transposase	NA	NA	NA	NA
