The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	39929	57640	3116276	transposase	uncultured_Caudovirales_phage(25.0%)	20	NA	NA
WP_081007013.1|39929_40229_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211577.1|40581_43275_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.8	2.6e-69
WP_129556616.1|43306_43894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664863.1|43938_44979_+	beta-eliminating lyase	NA	NA	NA	NA	NA
WP_016211572.1|45100_45325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556427.1|45566_46142_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46087_46453_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211193.1|46651_47413_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_016211195.1|47714_49241_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49612_50452_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50491_51799_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51773_52943_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|52997_53723_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54001_54391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54550_55456_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55531_55675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274979.1|55722_56562_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375632.1|56554_56890_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_155046698.1|57068_57230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|57346_57640_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
>prophage 2
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	136472	225643	3116276	protease,tRNA,transposase	Staphylococcus_phage(20.0%)	94	NA	NA
WP_054300271.1|136472_137447_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|137948_139361_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|139853_140861_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|140880_142401_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_129556430.1|142457_142664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211018.1|143639_144956_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|145059_145443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|145577_148643_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|148711_149815_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_075273381.1|150507_151077_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211020.1|151196_151952_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_054300545.1|152118_153180_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212564.1|153493_153643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212565.1|153610_153970_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|153991_154357_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|154413_154578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|154567_154867_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|155119_155485_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|155430_156006_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_164997250.1|156030_156363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|156451_157027_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|156972_157338_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|157817_158384_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|158395_159181_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|159812_160736_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|160787_161783_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|161814_162309_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_032126724.1|162400_162658_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|162747_163170_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|163488_164205_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_016210247.1|164248_164500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556431.1|164513_165941_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|165968_167411_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|167498_167837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|167921_168452_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|168512_170705_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|170747_171233_-	ProQ/FinO family protein	NA	NA	NA	NA	NA
WP_016210226.1|171502_171934_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_016210245.1|171951_172782_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|172796_172940_-	lipoprotein	NA	NA	NA	NA	NA
WP_016210239.1|172970_173855_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|173826_174048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|174221_174500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|175470_176376_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_129556686.1|176778_177660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|177893_178469_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|178414_178780_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126847.1|178852_179599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126848.1|180132_180933_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_016211858.1|181149_181908_+	ion transporter	NA	NA	NA	NA	NA
WP_016211859.1|181984_182272_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_075273327.1|182275_182851_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|182796_183162_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212443.1|183291_183498_+	pyridoxine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_016212441.1|183765_183990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372761.1|185005_185455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|185518_186247_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016210779.1|186289_187219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210775.1|187511_188105_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_017377589.1|188073_188727_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016210784.1|188904_189876_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210782.1|189898_190795_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_016210786.1|190953_191400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210787.1|191396_192038_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016210789.1|192147_192726_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_016210776.1|193201_193639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047085.1|193963_195304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210785.1|195567_196962_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_075274986.1|198410_199478_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209863.1|199530_199953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209853.1|200193_200637_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_016209873.1|200691_200949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209868.1|200926_201553_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_016209871.1|201630_203613_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|203822_205166_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|205432_208102_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|208125_210045_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|210214_211636_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|211781_212756_+	phospholipase A	NA	NA	NA	NA	NA
WP_016209855.1|212787_213183_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209859.1|213185_213407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|213570_215232_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|215304_215595_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_016209861.1|215820_216276_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|216340_216805_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|216897_218244_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|218243_219149_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|219210_220197_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|220189_220432_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|220553_222098_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_032126611.1|222144_223431_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|223473_224868_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|224891_225071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|225067_225643_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	239235	295551	3116276	tRNA,transposase,tail	Acinetobacter_phage(50.0%)	54	NA	NA
WP_016210080.1|239235_239529_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_122940784.1|239635_240442_-	trfA family protein	NA	NA	NA	NA	NA
WP_016210083.1|240746_241601_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_016210082.1|241755_242805_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_016210087.1|242855_243509_-	DedA family protein	NA	NA	NA	NA	NA
WP_016210097.1|243526_244807_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_016210096.1|245080_246442_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_032126863.1|246841_247393_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_016211802.1|252825_254097_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_016211801.1|254153_255137_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_016211800.1|255133_255919_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_032126362.1|256615_256981_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274991.1|256926_257502_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274992.1|257505_258054_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556436.1|258121_259008_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046701.1|259034_259184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|259328_259529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|259576_260038_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|260461_261943_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|262005_263115_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|263212_265174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|265703_266108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|266160_267222_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046702.1|267347_267503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034402.1|267651_267789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|270448_271601_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556437.1|271643_272066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556438.1|272335_273802_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_032126861.1|274005_274320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046703.1|274513_274651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|274654_275541_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212538.1|275712_276153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210630.1|276682_277798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126365.1|277769_278423_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_032126366.1|278416_279394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210638.1|279432_280596_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210640.1|281060_281285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|281670_281958_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_016210633.1|282132_282888_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556439.1|282893_283349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210637.1|283324_283801_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210636.1|283807_285385_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_032126367.1|285388_286153_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016210629.1|286206_286743_+	tim44-like domain protein	NA	NA	NA	NA	NA
WP_016210634.1|286739_287471_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_032126368.1|287579_288734_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016211902.1|288878_289256_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016211903.1|289513_290482_-	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_016211898.1|290735_291359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211899.1|291686_291980_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_105962625.1|292076_292963_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046704.1|293574_293727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212296.1|293742_294471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126374.1|294579_295551_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	329456	375011	3116276	transposase	Hokovirus(33.33%)	46	NA	NA
WP_075273298.1|329456_330032_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210127.1|330084_331110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210128.1|331203_331467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|331833_332652_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|332724_335097_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_016210125.1|335809_337237_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|337271_338294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|338310_338688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126491.1|339045_339363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210122.1|339529_340222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|340848_341823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|341812_343585_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|343585_343933_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_032126493.1|344182_345409_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|345498_346797_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664834.1|346830_347190_-	VUT family protein	NA	NA	NA	NA	NA
WP_016210138.1|347235_347439_-	VUT family protein	NA	NA	NA	NA	NA
WP_016210137.1|347560_348112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210134.1|348338_349577_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|349753_350044_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_016212281.1|350355_351810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|352009_352585_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|352530_352896_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212359.1|353631_353850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|354217_355192_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212044.1|355730_355985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|356707_357694_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|357831_358026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211794.1|358711_359356_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_129556444.1|359348_359771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211797.1|359932_361336_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|361386_361962_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|361907_362222_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556445.1|362262_363149_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126227.1|363787_364078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212008.1|364115_364814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212010.1|364830_365127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556446.1|365244_366396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273619.1|366668_367244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211273.1|367301_368135_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	29.0	3.5e-17
WP_016211268.1|368250_369435_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211271.1|369453_370398_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016211269.1|370702_371488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211272.1|371605_371974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211270.1|372201_373779_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_054300173.1|373949_375011_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	461099	550022	3116276	tRNA,transposase	Escherichia_phage(35.48%)	91	NA	NA
WP_054300511.1|461099_461399_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275005.1|461557_461893_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|462809_464216_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|464233_465220_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_032126129.1|465216_466377_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|466373_467069_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|467203_468694_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210494.1|468714_469764_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|469830_471225_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210489.1|472103_474035_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_075273353.1|474039_474570_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|474604_474799_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|474841_475201_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|475620_476616_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_032126132.1|476628_479010_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|479015_479303_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|479574_480051_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|480195_480393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|480517_481492_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|483600_483699_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210477.1|484183_485473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126626.1|485709_486402_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|486443_487217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|487218_488160_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|488292_489870_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|490079_491837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|492385_493144_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|493351_493924_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|494027_494576_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|494877_495123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|495151_495448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300307.1|495652_496381_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_016212268.1|497025_497610_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_016212269.1|497613_498297_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|498579_499308_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_052104629.1|499644_500670_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212159.1|500813_501011_-	antirestriction protein ArdA	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_054300201.1|501119_501848_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_164997251.1|501927_502857_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556625.1|503071_503629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212111.1|503597_503960_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.9e-24
WP_016212109.1|503952_504300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212114.1|504296_504527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212110.1|504530_505001_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	62.5	7.6e-33
WP_054300201.1|505647_506376_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_016212024.1|506771_507020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212021.1|507016_507616_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212022.1|507615_507834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212023.1|508320_509313_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_075273432.1|509309_510044_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_129556453.1|510463_510895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126854.1|511039_511471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|511920_512649_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_051307368.1|513306_514587_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_016211918.1|514586_515555_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_144019154.1|515930_516203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126737.1|516258_516987_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_032126150.1|517067_517301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|517399_518374_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_075275025.1|519889_521905_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_162034472.1|522154_522325_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728351.1|522263_522422_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556454.1|522685_524698_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_075275029.1|524866_525595_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	9.6e-43
WP_075275032.1|526338_527148_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	1.1e-15
WP_032126239.1|527198_527471_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|527482_528319_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_016211646.1|528688_528928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211642.1|528920_529274_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_016211643.1|529583_530177_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211641.1|530181_530637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211645.1|530659_531409_+	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	28.2	2.4e-09
WP_016211640.1|531440_532043_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211639.1|532422_532725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211644.1|532839_533106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|533247_533976_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211235.1|534470_534908_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|535337_536726_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211238.1|537168_538662_+	amino acid permease	NA	NA	NA	NA	NA
WP_129556456.1|538863_539613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211242.1|539656_540625_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_016211244.1|540578_541274_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_036776715.1|541675_542404_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211663.1|542497_543163_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211661.1|543227_544184_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_032126810.1|544442_545141_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211662.1|545183_546296_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_075273327.1|546900_547476_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|547421_547787_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212580.1|547874_548225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|548960_550022_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	561059	614483	3116276	tRNA,transposase,plate	Synechococcus_phage(33.33%)	54	NA	NA
WP_075275036.1|561059_562121_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211491.1|562381_562678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211493.1|562960_564424_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211489.1|564426_565479_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_016211494.1|565468_565924_+	arginine repressor	NA	NA	NA	NA	NA
WP_016211487.1|565948_566272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|566619_566931_-	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_032126201.1|567060_567807_+	lipoprotein	NA	NA	NA	NA	NA
WP_054300148.1|567828_568890_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|569000_569975_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126197.1|570115_571069_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016212075.1|571182_571380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047032.1|571592_571826_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212072.1|571855_572053_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212074.1|572139_572361_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|572387_572753_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275038.1|572698_573289_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046713.1|573426_573591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126195.1|573885_575322_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016210532.1|575363_576815_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016210537.1|576926_577214_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|577403_578447_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210536.1|578462_579362_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210528.1|579358_579877_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210527.1|579946_580564_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016210531.1|580573_582061_+	ribonuclease G	NA	NA	NA	NA	NA
WP_016210534.1|582070_585751_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_016210535.1|585824_586637_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210530.1|586633_587314_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_081007010.1|588154_588775_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556461.1|588824_589115_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275039.1|589918_590413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007066.1|590407_590746_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126205.1|591125_591491_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210435.1|593084_593891_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_016210431.1|593950_594343_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_016210434.1|594387_595206_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_016210429.1|595218_596202_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_016210428.1|596203_597475_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_032126192.1|597481_599983_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_016210436.1|600115_601141_+	phosphotransferase	NA	NA	NA	NA	NA
WP_016210439.1|601137_601848_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_033923648.1|601844_602126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556463.1|602104_602602_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016210438.1|602729_603113_+	response regulator	NA	NA	NA	NA	NA
WP_162034439.1|603147_604011_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_016210432.1|604092_604764_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_016210437.1|604822_605398_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.5	3.7e-58
WP_017376335.1|605496_606297_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_032126191.1|606429_606951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209533.1|607095_607416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209536.1|609277_612448_-	intracellular multiplication and macrophage-killing family protein	NA	NA	NA	NA	NA
WP_016209529.1|612460_613171_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032126189.1|613175_614483_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 7
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	623142	666972	3116276	transposase,plate	Bacillus_thuringiensis_phage(12.5%)	52	NA	NA
WP_032126187.1|623142_623541_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016209524.1|623537_625226_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_016209506.1|625207_626164_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_016209515.1|626206_626722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|626826_627759_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209534.1|627978_628365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164997271.1|628381_629029_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209504.1|629206_630046_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_016209502.1|630121_630724_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209512.1|630724_631579_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209537.1|631935_632247_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209519.1|632271_633663_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|633818_634550_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_129556465.1|634546_635119_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|635105_635663_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_016209498.1|635668_636649_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209539.1|636788_637589_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_033923645.1|637592_638360_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209535.1|638356_638821_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_016209507.1|638843_639497_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209517.1|639500_639848_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209505.1|639881_640133_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|640207_641476_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209527.1|641478_642237_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209508.1|642298_643189_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|643239_643923_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_075273445.1|644008_644266_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155046714.1|644538_646737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210408.1|646728_647601_-	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_016210409.1|647768_649598_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210411.1|649761_650403_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_075273448.1|650644_651175_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_016210404.1|651192_651366_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_016210402.1|651424_652474_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210405.1|652480_653431_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210406.1|653484_654429_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210415.1|654456_655194_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|655282_655525_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|655599_656823_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210400.1|656854_657703_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210401.1|657699_658752_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_032126181.1|658872_659493_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_016210407.1|659508_660495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080743011.1|660605_661061_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_164997253.1|661020_661239_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_164997254.1|661963_662116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|662122_663028_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075275050.1|663103_663799_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275052.1|663943_664453_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212599.1|664502_664712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|665946_666393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|666396_666972_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	692450	833678	3116276	tRNA,transposase,protease	Staphylococcus_phage(15.0%)	118	NA	NA
WP_129556470.1|692450_693337_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_164997255.1|694030_694204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126800.1|694430_695165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|695289_696351_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940948.1|696673_697378_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210599.1|697471_698185_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016210601.1|698267_699359_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210603.1|699430_700012_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210606.1|700017_700644_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_168183191.1|700740_701688_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.7	5.8e-40
WP_016210600.1|702035_702698_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210598.1|702848_703508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210607.1|703676_704936_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210611.1|704932_706018_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210605.1|706010_706892_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210612.1|706880_708131_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_075275125.1|709722_710766_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|712902_713268_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|713213_713789_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209387.1|713926_714811_-	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_016209373.1|714940_715762_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_016209389.1|715763_716801_-	asparaginase	NA	NA	NA	NA	NA
WP_016209367.1|716801_719459_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_016209375.1|719536_720346_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_032126579.1|720768_721536_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_016209372.1|721710_722589_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_016209399.1|722592_723330_+	UMP kinase	NA	NA	NA	NA	NA
WP_016209396.1|723333_723891_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_032126580.1|723907_724645_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.5	7.2e-22
WP_016209379.1|724652_725459_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016209397.1|725546_726422_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_152498662.1|726542_728201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209400.1|728671_730633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209393.1|731177_731717_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_016209364.1|731713_732742_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_016209394.1|732731_733796_-	GHMP kinase	NA	NA	NA	NA	NA
WP_080664815.1|733783_735997_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_051307309.1|735998_737039_-	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_129556472.1|737377_739771_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_016209381.1|739851_740385_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_016209391.1|740436_741486_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_016209390.1|741512_741950_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_016209377.1|741949_742723_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_016209376.1|742741_743896_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_032126583.1|744108_744678_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	42.9	5.7e-27
WP_016209365.1|744701_748208_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.5	4.9e-193
WP_016209366.1|748285_749245_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_016209374.1|749219_750671_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209368.1|750706_752236_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_016209380.1|752811_753234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556473.1|753366_754455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126585.1|754996_755917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209384.1|756267_757083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209395.1|757374_760065_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_016209388.1|760355_761534_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|761701_763408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209398.1|764006_765233_+	MFS transporter	NA	NA	NA	NA	NA
WP_075274832.1|765797_766772_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_075273456.1|766894_767194_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|767153_767609_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212416.1|767610_768141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212417.1|768264_768510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|768560_768926_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|768871_769447_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052047106.1|769520_769997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|770712_771078_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|771023_771599_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300173.1|771625_772687_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211819.1|773563_773794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|774090_774591_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211818.1|774793_776050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211822.1|776406_776820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|777129_778191_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275065.1|778490_779165_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.9e-10
WP_016212172.1|780055_781528_+	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_054300271.1|781547_782522_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210742.1|782672_782948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|783113_783734_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_016210737.1|784052_786029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210739.1|786184_787642_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210743.1|787710_789291_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_016210744.1|789331_789817_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210746.1|789913_793810_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210741.1|793816_794140_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_054300173.1|794825_795887_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210303.1|795936_796176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210299.1|796535_797483_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.3e-35
WP_016210294.1|797800_798145_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_075273633.1|798282_798909_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_016210301.1|798958_799786_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_032126460.1|799962_800400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126457.1|801307_801727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210293.1|802771_804052_+	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_016210287.1|804172_805036_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_016210290.1|805124_805919_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_129556475.1|806141_807164_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_032126458.1|807169_808696_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_032126463.1|808776_810033_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210297.1|810089_811469_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_032126464.1|811584_812370_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.2e-32
WP_033923708.1|812574_813450_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211687.1|813705_814350_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211685.1|814380_816186_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|816209_816785_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556476.1|817329_818340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|818435_819410_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016209640.1|819828_820848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209649.1|821306_822272_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209646.1|822316_822892_-	VOC family protein	NA	NA	NA	NA	NA
WP_016209651.1|822922_824197_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126159.1|824823_825537_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_016209641.1|825616_826354_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016209658.1|826474_827830_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_075273478.1|828006_828678_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_032126160.1|828793_829672_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_016209645.1|830272_831577_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|831689_832295_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|832376_833678_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
>prophage 9
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	852470	894240	3116276	integrase,transposase	Staphylococcus_phage(20.0%)	42	854739:854798	882921:884024
WP_075275067.1|852470_853538_+|transposase	transposase	transposase	NA	NA	NA	NA
854739:854798	attL	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAA	NA	NA	NA	NA
WP_054300271.1|854774_855749_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126362.1|855920_856286_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051307360.1|857125_858055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211512.1|859146_859953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|860295_862188_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_032126157.1|862474_862879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923634.1|863083_863632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|863621_864508_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212436.1|864846_865257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556479.1|865470_865653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274918.1|866140_866506_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|866451_867027_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211529.1|867485_867638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664862.1|868200_868899_+	P-loop NTPase	NA	NA	NA	NA	NA
WP_016211528.1|868879_869185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211532.1|869831_870782_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	35.8	1.8e-09
WP_016211534.1|870768_871278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211530.1|871283_872180_-	Abi family protein	NA	A3QSC6	Clostridium_virus	32.0	5.3e-35
WP_016211531.1|872533_873214_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_032126152.1|873277_873868_-|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016212424.1|874070_874349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|874341_874614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|874758_875841_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211300.1|875891_876932_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_129556480.1|877443_882933_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|882956_883931_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212302.1|884244_884544_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
882921:884024	attR	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCTGCTCTCTATCATCATAAATATAACGGTAAATCGTGCTTTCACTCACCTGGATATCATGCTCTCGTATAAGTTCCTGACTGATAACATCGGGGGATGTATGGGTGCTTAACCGTTGATGGATCAACATTTTTGCCTCCTCTGAAATTTGTCGAAAAGCTTGACCTTGCTTAGCGTTAGCTCGTTTTTCTTGTGCACAGCGAGAAGTAAGCCGGTGACAATAAAGACCTTTAAAATCGATTGGGGTGTGCCGTTTAATCTCACGGCTAATCGTGCTAGGAGAAAAGCCAAGTGCTCTAGCAATTGATCTGAGCGAGTCTCCCTCTGATAACCGTTGTTCGATATAAAAACGATCTTTTTCATTTAAGTGCCGATAAACCATCTCTACCCTCTAAGTCAAAAGGCGAACTAGAGAGTTTATCTGTATGAATATGAACTCTCTACTGAGTGTTGCACTTCAGATGACGGAGGGCGT	NA	NA	NA	NA
WP_129556481.1|884728_885160_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_054300162.1|885417_886500_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211579.1|886723_887209_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211583.1|887276_888185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211581.1|888461_889232_+	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.9	8.9e-31
WP_016211585.1|889350_889908_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016211582.1|889969_890749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|890846_891200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|891266_891461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211578.1|891476_891821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|892178_892754_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|892699_893065_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275068.1|893149_893740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047108.1|893841_894240_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	910078	1009633	3116276	tRNA,transposase	unidentified_phage(12.5%)	99	NA	NA
WP_075273371.1|910078_910654_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212461.1|910657_911032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275071.1|911407_912382_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_054300264.1|912484_912823_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_054300265.1|912967_913228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164997253.1|913187_913406_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126553.1|913997_915419_-	sodium:proton antiporter NhaD	NA	NA	NA	NA	NA
WP_016211426.1|915801_917244_+	MFS transporter	NA	NA	NA	NA	NA
WP_075273490.1|918226_919519_+	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_054300148.1|919759_920821_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556485.1|920973_923532_+	HAD-IC family P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	30.6	6.3e-73
WP_032126554.1|923551_924637_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_016210417.1|925078_925516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210423.1|925512_926397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210416.1|926486_927017_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_016210420.1|927087_928266_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.1	2.0e-50
WP_016210425.1|928414_932263_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_016210422.1|932249_933752_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_172673410.1|934296_934938_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_081377899.1|935250_936114_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211781.1|936528_937776_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_161625476.1|938148_939435_+	methyltransferase regulatory domain-containing protein	NA	NA	NA	NA	NA
WP_129556486.1|939520_939868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273492.1|939958_940078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275075.1|940186_941248_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007012.1|941242_941413_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046696.1|941402_941567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|941623_941989_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300269.1|942010_942379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126559.1|942523_943267_-	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_016210898.1|943290_943641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|943729_944020_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210894.1|944494_944797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210897.1|945137_946118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556487.1|946196_947534_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210903.1|947652_948024_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_016210904.1|948244_948895_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210896.1|948937_950020_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210899.1|950073_951957_+	APC family permease	NA	NA	NA	NA	NA
WP_032126790.1|952456_953362_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075275077.1|953446_954283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212218.1|954427_954778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|956228_957290_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|957415_958498_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_032126801.1|959168_959678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556488.1|960934_961784_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126540.1|962933_963797_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|964677_965043_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|964988_965564_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|965793_966159_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|966104_966680_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126869.1|967200_967440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|967417_968479_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556489.1|968724_969921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|969924_970811_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212326.1|971036_971234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122941816.1|971320_971629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212323.1|971705_971978_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_075274676.1|972052_972250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211709.1|972408_972555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|974814_976851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211085.1|977574_979275_-	BatD family protein	NA	NA	NA	NA	NA
WP_016211090.1|979276_980911_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016211089.1|980923_981949_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|981945_982407_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_016211081.1|982447_983383_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211087.1|983410_984406_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_016211088.1|984625_985588_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126778.1|985766_985961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274675.1|986256_986997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377357.1|987081_987483_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_164997256.1|987641_987797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164997257.1|988023_988287_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_075275084.1|988334_989396_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212519.1|989470_989851_+	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_052047081.1|990121_990559_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_016212356.1|990609_991455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|992391_992757_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|992702_993278_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274822.1|993647_994622_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016212585.1|994733_995054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212621.1|995348_995753_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_075273327.1|995749_996325_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|996270_996636_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126498.1|996697_997258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211126.1|997390_997780_-	lipoprotein	NA	NA	NA	NA	NA
WP_016211125.1|997949_998780_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211128.1|999002_999908_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_016211119.1|1000071_1000833_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_016211122.1|1000836_1001703_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032126499.1|1001799_1002411_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211118.1|1002789_1004037_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126500.1|1004173_1004890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275089.1|1005023_1005356_-	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	37.3	8.0e-05
WP_016212439.1|1005500_1006013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275091.1|1006676_1007162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273307.1|1007432_1007843_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300412.1|1007987_1008302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210280.1|1008538_1009633_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 11
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	1025759	1132793	3116276	tRNA,transposase	Bacillus_phage(16.67%)	96	NA	NA
WP_075273327.1|1025759_1026335_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080664860.1|1026298_1026736_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_016211367.1|1026891_1027674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126330.1|1027821_1028781_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_032126331.1|1028835_1030845_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_016211366.1|1030900_1031188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126332.1|1031440_1032640_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_081007069.1|1033286_1033439_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046718.1|1033411_1033750_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1033806_1034172_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|1034305_1035169_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|1035399_1035693_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_164997258.1|1035765_1035903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556495.1|1036673_1036931_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211589.1|1037053_1038286_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_016211592.1|1038275_1038938_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_129556496.1|1039212_1040451_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_032126329.1|1040636_1041266_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211588.1|1041341_1042043_+	cyclase family protein	NA	NA	NA	NA	NA
WP_105962623.1|1042210_1043363_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212343.1|1043602_1044409_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_016209806.1|1045221_1045371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209808.1|1045713_1046082_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_016209824.1|1046078_1046897_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_016209813.1|1046997_1047813_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_016209801.1|1048097_1050152_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_032126324.1|1050151_1050574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209805.1|1050752_1052246_-	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_016209818.1|1052378_1053194_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_016209799.1|1053289_1053706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209815.1|1054091_1054631_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_032126326.1|1055398_1056661_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	3.1e-25
WP_016209812.1|1057113_1058937_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	9.7e-44
WP_016209821.1|1059026_1059359_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016209800.1|1059389_1059986_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_016209802.1|1059982_1061107_+	D-isomer specific 2-hydroxyacid dehydrogenase catalytic domain protein	NA	NA	NA	NA	NA
WP_016209822.1|1061242_1061890_+	class I SAM-dependent methyltransferase	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_016209810.1|1061951_1063865_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	6.9e-117
WP_016209803.1|1064069_1065107_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209820.1|1065165_1068465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209817.1|1069166_1070135_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_016209809.1|1070241_1070730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209823.1|1071154_1071598_+	response regulator	NA	NA	NA	NA	NA
WP_075275095.1|1071642_1072419_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075275097.1|1072820_1073396_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1073341_1073707_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300408.1|1073757_1074414_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_080664854.1|1074750_1075332_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_032126179.1|1075289_1075541_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_016211113.1|1075570_1076896_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_016211112.1|1076951_1077599_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211115.1|1077791_1079744_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211114.1|1079876_1082807_+	insulinase family protein	NA	NA	NA	NA	NA
WP_075274672.1|1083172_1083766_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1083937_1084303_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1084248_1084824_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1084837_1085128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1085073_1085649_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212254.1|1085638_1087081_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016212252.1|1087118_1087277_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_016212466.1|1087591_1088317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372269.1|1088521_1088893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211395.1|1089249_1089585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779999.1|1089500_1089932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211393.1|1089951_1091508_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_016211391.1|1091519_1092095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728317.1|1092161_1095527_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275098.1|1095717_1096647_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.1e-24
WP_016210591.1|1096805_1096961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556498.1|1097159_1097768_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210596.1|1097764_1099705_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	3.1e-72
WP_016210594.1|1099840_1100494_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_016210595.1|1100670_1101849_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210588.1|1102216_1103542_+	fimV domain protein	NA	NA	NA	NA	NA
WP_032126176.1|1103632_1104415_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210587.1|1104516_1105377_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_016210590.1|1105551_1106814_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210593.1|1106893_1107424_+	CvpA family protein	NA	NA	NA	NA	NA
WP_016210586.1|1107445_1108951_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210592.1|1108963_1109620_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016212005.1|1110009_1111770_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_129556499.1|1112670_1113823_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_032126856.1|1114128_1114470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377901.1|1114530_1115241_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275102.1|1115421_1115880_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211525.1|1116468_1119204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|1121503_1122319_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046719.1|1124537_1124696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1124714_1124987_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377862.1|1124998_1125835_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126803.1|1126321_1127554_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_016211764.1|1127754_1128576_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211767.1|1129126_1129936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211289.1|1131264_1131537_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211286.1|1131648_1131996_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_016211285.1|1132013_1132793_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	1159304	1222544	3116276	protease,tRNA,transposase	Klosneuvirus(22.22%)	55	NA	NA
WP_075274836.1|1159304_1160195_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046721.1|1160375_1160543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212367.1|1161684_1162542_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209842.1|1163269_1163659_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209834.1|1163835_1164594_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209829.1|1164590_1166990_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209839.1|1168369_1169668_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209838.1|1169865_1170759_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209836.1|1170758_1171973_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_032126639.1|1171992_1173279_-	GTPase HflX	NA	NA	NA	NA	NA
WP_016209846.1|1173294_1173549_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016209830.1|1173784_1175152_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209826.1|1175482_1176505_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_164997259.1|1176597_1176744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209845.1|1177027_1178503_+	APC family permease	NA	NA	NA	NA	NA
WP_161625459.1|1178743_1179616_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_016209827.1|1179934_1181494_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_016209841.1|1181569_1181764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209831.1|1181983_1182682_+	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209832.1|1182960_1183224_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209848.1|1183530_1186125_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209835.1|1186121_1186604_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209844.1|1186581_1187622_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209840.1|1187794_1188280_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_032126641.1|1188387_1190958_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_075278621.1|1190993_1191335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126643.1|1191523_1191730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211648.1|1192933_1193473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211650.1|1194132_1195617_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211651.1|1195741_1197277_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032126362.1|1197510_1197876_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556501.1|1197821_1198397_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046722.1|1198429_1199305_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080728346.1|1199309_1199642_+	ester cyclase	NA	NA	NA	NA	NA
WP_054300375.1|1200448_1200649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210928.1|1200863_1201169_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_016210929.1|1201203_1201560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046724.1|1201556_1201724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210921.1|1201948_1202533_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_032126562.1|1202624_1203332_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.1	1.7e-28
WP_032126561.1|1203434_1204619_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210917.1|1204832_1206275_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.5	5.4e-21
WP_161625467.1|1206411_1207350_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210930.1|1207410_1208184_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210918.1|1208187_1208937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210926.1|1209021_1210491_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_075273571.1|1211422_1212100_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211012.1|1212249_1212822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211008.1|1212930_1214433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211010.1|1214525_1216955_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_016211011.1|1217233_1218430_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_016211013.1|1218490_1220857_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_032126565.1|1221174_1221447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1221657_1222023_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1221968_1222544_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	1227080	1280343	3116276	tRNA,transposase	Bacillus_phage(13.33%)	56	NA	NA
WP_081007040.1|1227080_1227737_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016210510.1|1227767_1228496_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_016210506.1|1228488_1229727_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210512.1|1229862_1230900_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_172673419.1|1230980_1231856_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.6e-55
WP_016210514.1|1231964_1233218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|1233275_1236773_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_075273576.1|1236832_1237561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210507.1|1237688_1238237_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016210508.1|1238557_1240255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300289.1|1240263_1241076_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	9.9e-57
WP_032126637.1|1242191_1242485_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_016212482.1|1243028_1243172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032127044.1|1243386_1243587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1243790_1244852_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047029.1|1244924_1245266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|1245433_1245799_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273298.1|1245744_1246320_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211467.1|1246394_1246961_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_032126344.1|1246963_1248052_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032126343.1|1248172_1248985_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_016211471.1|1249115_1251101_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_016211470.1|1251160_1251814_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_129556505.1|1252580_1253546_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1253586_1254561_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212421.1|1255311_1255494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1255985_1256351_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1256296_1256872_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|1257664_1257958_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556508.1|1258019_1258463_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300380.1|1258733_1259390_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1259491_1259857_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1259802_1260378_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212483.1|1260374_1261172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1261182_1262265_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300173.1|1262567_1263629_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211841.1|1264488_1264941_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211839.1|1265058_1266531_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211840.1|1266689_1267154_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211838.1|1267624_1267798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274832.1|1268109_1269084_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_032126143.1|1269183_1270455_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_016211422.1|1270543_1271014_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_051307357.1|1271036_1271630_-	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211417.1|1271766_1272816_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_016211415.1|1272839_1273763_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1273779_1274241_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211414.1|1274348_1275167_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_129556449.1|1275382_1275889_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1275903_1276269_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081377858.1|1276472_1277183_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300382.1|1277401_1277824_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046725.1|1278040_1278181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1278224_1279199_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075274829.1|1279222_1279495_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1279506_1280343_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
>prophage 14
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	1290697	1582506	3116276	tRNA,integrase,transposase,protease	Staphylococcus_phage(15.79%)	279	1398147:1398206	1411852:1412140
WP_054300162.1|1290697_1291780_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212040.1|1291983_1293333_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_016212039.1|1293509_1294067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133287.1|1294255_1294654_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075274828.1|1294755_1296078_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	1.2e-11
WP_054300384.1|1296486_1297302_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212251.1|1297463_1298000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212250.1|1298161_1298812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126600.1|1298934_1299456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126789.1|1299727_1299910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1300259_1301537_-	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_080664858.1|1301533_1301671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211223.1|1302182_1303784_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211221.1|1303800_1304943_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211218.1|1305195_1305933_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211224.1|1305957_1307229_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_075274826.1|1307485_1308391_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211680.1|1308621_1311021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211682.1|1311068_1312751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209976.1|1313620_1313854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126209.1|1314054_1314675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209969.1|1314641_1315607_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_016209951.1|1315597_1316008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209957.1|1316014_1316350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378255.1|1316350_1316971_-	type IVB secretion system apparatus protein IcmL/DotI	NA	NA	NA	NA	NA
WP_016209950.1|1317197_1317989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209973.1|1318025_1321130_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_016209965.1|1321159_1321957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209956.1|1321961_1324952_-	ATPase AAA	NA	NA	NA	NA	NA
WP_016209975.1|1324957_1325389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209972.1|1325439_1326006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126210.1|1326005_1327049_-	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_016209954.1|1327054_1327579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209953.1|1327600_1329907_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_016209962.1|1329958_1330198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209958.1|1330199_1331327_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_016209964.1|1331326_1332079_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_051307320.1|1332071_1332578_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_016209959.1|1332602_1333010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556635.1|1333037_1334045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209971.1|1334103_1335009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209955.1|1335015_1336209_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_032126212.1|1336205_1337114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164997260.1|1337932_1338070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211310.1|1338360_1339074_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SEW9	Cyanophage	39.1	2.2e-39
WP_016211308.1|1339149_1339428_-	lipoprotein	NA	NA	NA	NA	NA
WP_032126213.1|1339457_1340348_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_016211307.1|1340432_1340906_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_016211313.1|1341041_1341563_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_016211309.1|1341603_1342398_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_016211305.1|1342400_1342682_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211306.1|1342678_1343632_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016211312.1|1344337_1345084_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075274825.1|1345205_1346267_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126239.1|1346544_1346817_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1346828_1347665_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_016211999.1|1348044_1348398_+	ras family protein	NA	NA	NA	NA	NA
WP_016211998.1|1348387_1348951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212000.1|1349081_1349810_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_162034415.1|1349944_1350208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172673420.1|1351248_1351470_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016210889.1|1351487_1354334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210887.1|1354843_1355794_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210886.1|1355876_1356656_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_155053505.1|1356724_1357447_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210888.1|1357392_1357644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|1357666_1357963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|1358496_1359270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|1359302_1359899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210885.1|1359956_1360838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300399.1|1361179_1361446_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300400.1|1361590_1361833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183217.1|1361847_1362417_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107517381.1|1363082_1363277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1363490_1363844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211827.1|1364175_1364796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211823.1|1364836_1365025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274823.1|1365059_1369070_-	cadherin-like domain-containing protein	NA	NA	NA	NA	NA
WP_016211770.1|1369269_1370403_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_016211771.1|1370416_1370605_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_075274822.1|1370897_1371872_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016209929.1|1373330_1374224_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209948.1|1374332_1375250_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_016209943.1|1375301_1376057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209939.1|1376124_1377399_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209927.1|1377533_1378211_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209944.1|1378411_1379839_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209938.1|1379813_1380452_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209925.1|1380661_1380940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209935.1|1381173_1382118_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_032126634.1|1382139_1384008_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209930.1|1384028_1384382_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_016209936.1|1384420_1385536_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.6	1.4e-93
WP_016209932.1|1385718_1386759_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209945.1|1386761_1387796_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209926.1|1387792_1388854_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209931.1|1388965_1390438_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_016209937.1|1390590_1391034_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209940.1|1391109_1393881_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_016209946.1|1394037_1395267_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1395293_1395956_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_054300405.1|1396477_1396978_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_129556510.1|1397079_1398183_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	7.3e-10
1398147:1398206	attL	GCGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGC	NA	NA	NA	NA
WP_033923779.1|1398706_1399543_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1399554_1399827_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1399911_1400886_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210841.1|1401099_1401471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210839.1|1401529_1402303_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_129556514.1|1402454_1404911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126340.1|1405190_1405952_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556513.1|1406032_1407778_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_016210844.1|1407953_1409081_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.2	5.7e-10
WP_016210843.1|1409167_1409398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556637.1|1410012_1410792_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016212589.1|1411266_1411704_-	MFS transporter	NA	NA	NA	NA	NA
WP_164997261.1|1411738_1411888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300363.1|1412127_1412475_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
1411852:1412140	attR	GCGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_129556512.1|1412420_1412996_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212275.1|1412985_1413969_-	MFS transporter	NA	NA	NA	NA	NA
WP_016212276.1|1414120_1414474_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036774189.1|1414521_1415529_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1415528_1415786_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_173018586.1|1416053_1416542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211335.1|1416651_1416969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126267.1|1416962_1417205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211330.1|1417552_1418653_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_098082827.1|1418827_1420129_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.9	4.1e-28
WP_016211328.1|1420236_1420698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126265.1|1421021_1421939_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016211336.1|1422004_1422619_-	chorismate mutase	NA	NA	NA	NA	NA
WP_016211334.1|1422667_1422856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210322.1|1423473_1424370_+	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016210320.1|1424506_1425580_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_032126606.1|1425729_1426251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210323.1|1426162_1426873_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.7	6.3e-39
WP_016210319.1|1427079_1428492_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210321.1|1428688_1429657_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_016210329.1|1429705_1430224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210327.1|1430284_1431616_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210325.1|1431751_1433128_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210326.1|1433281_1434580_-	ankyrin repeats family protein	NA	NA	NA	NA	NA
WP_032126607.1|1434919_1436203_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_016210333.1|1436276_1436906_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_016210330.1|1437109_1437493_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210332.1|1437590_1438334_+	ribonuclease T2 family protein	NA	NA	NA	NA	NA
WP_075273555.1|1438464_1438998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210328.1|1438977_1439127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212498.1|1439275_1439959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212081.1|1440103_1440280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126599.1|1440598_1441942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211804.1|1442636_1444022_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
WP_033923779.1|1444065_1444902_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075274829.1|1444913_1445186_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1445209_1446184_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046726.1|1446227_1446386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211805.1|1446369_1447908_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211806.1|1447950_1448676_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_032126239.1|1449465_1449738_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1449749_1450586_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_081377864.1|1450599_1450839_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211148.1|1450920_1452249_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|1452512_1453082_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211151.1|1453097_1453409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1453418_1454375_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1454487_1454841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211153.1|1454844_1455909_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211145.1|1455909_1457649_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211152.1|1457655_1458078_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211144.1|1458061_1458691_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075273474.1|1459247_1460222_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_075274844.1|1460402_1460654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1460662_1461499_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1461510_1461783_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556515.1|1461801_1462161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046727.1|1462986_1463331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1463574_1464549_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_173018587.1|1464525_1465227_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212529.1|1465489_1466047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1466087_1466360_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1466371_1467208_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_080664876.1|1467520_1469383_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_081377865.1|1469741_1470026_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556638.1|1471370_1472051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273551.1|1472050_1472353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211974.1|1472452_1473574_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075274847.1|1473856_1474732_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212011.1|1474965_1476087_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_016212013.1|1476308_1476692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212012.1|1476707_1477385_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_054300271.1|1477621_1478596_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300271.1|1479243_1480218_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_164997262.1|1480327_1480471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556517.1|1480615_1480903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1480921_1481758_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1481769_1482042_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212348.1|1482905_1484135_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_016211994.1|1485553_1486090_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_032126537.1|1486126_1486312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211991.1|1486552_1487458_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016212219.1|1488366_1489677_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_016212220.1|1489685_1489841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007034.1|1490049_1490334_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_080728343.1|1490315_1490456_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_016211561.1|1490537_1494404_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_016211564.1|1494569_1495445_+	ParA family protein	NA	NA	NA	NA	NA
WP_016211563.1|1495477_1495639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049900.1|1495987_1496293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046728.1|1496421_1497396_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	6.8e-28
WP_052047138.1|1497658_1497892_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126690.1|1503939_1504422_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_016210112.1|1505115_1506543_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.0	2.5e-55
WP_122943012.1|1506659_1507115_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_016210108.1|1507300_1508566_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	9.1e-49
WP_016210114.1|1508658_1509918_+	calcineurin-like phosphoesterase	NA	NA	NA	NA	NA
WP_016210107.1|1509989_1510262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036793752.1|1510551_1512024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210113.1|1512470_1513520_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.5	7.9e-30
WP_016210110.1|1513707_1514463_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	5.4e-65
WP_016210102.1|1514523_1516113_-	APC family permease	NA	NA	NA	NA	NA
WP_016210106.1|1516295_1517387_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_016210105.1|1517406_1517727_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210099.1|1517810_1519088_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_017377579.1|1519109_1519946_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210111.1|1519952_1521587_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_016210117.1|1522007_1522367_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210115.1|1522400_1522574_-	membrane protein	NA	NA	NA	NA	NA
WP_016210103.1|1522648_1524007_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_081377868.1|1524082_1524739_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211627.1|1525044_1525209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211632.1|1525434_1526289_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016211634.1|1526324_1527146_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211631.1|1527401_1528208_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_155046729.1|1528466_1529513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|1529730_1530024_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_075273327.1|1530099_1530675_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1530620_1530986_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556520.1|1530946_1531843_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	1.8e-54
WP_105962625.1|1532515_1533402_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_144019377.1|1534553_1536080_-	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	25.6	1.5e-05
WP_032126825.1|1536829_1538143_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.5e-51
WP_016211481.1|1538375_1539518_+	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_098082850.1|1539592_1539769_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_032126824.1|1539804_1540464_-	MarC family protein	NA	NA	NA	NA	NA
WP_032126823.1|1540547_1541270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211482.1|1541258_1543532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377347.1|1543670_1544006_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1543965_1544421_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212267.1|1544587_1544947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1545227_1545875_+	LysE family translocator	NA	NA	NA	NA	NA
WP_155046730.1|1546142_1546283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274856.1|1546501_1547527_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211733.1|1549282_1550107_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_016211731.1|1550162_1551269_-	protein kinase	NA	NA	NA	NA	NA
WP_016211734.1|1551284_1551554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|1551975_1552674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211402.1|1553037_1553214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211398.1|1553278_1553566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211399.1|1553712_1554456_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016211403.1|1554469_1555513_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_016211405.1|1555648_1557421_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_129556522.1|1557627_1558860_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_162034419.1|1561459_1561606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211669.1|1561967_1562318_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211666.1|1562472_1565292_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211664.1|1565664_1566393_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211555.1|1566929_1568288_-	dGTPase	NA	NA	NA	NA	NA
WP_032126677.1|1568362_1568926_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211557.1|1569120_1570350_-	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_016211554.1|1570395_1571022_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_032126678.1|1571348_1572359_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_075274857.1|1572369_1573245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274858.1|1574824_1575910_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1576046_1576412_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046718.1|1576468_1576807_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007069.1|1576779_1576932_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1577622_1578597_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1579151_1580213_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274822.1|1580310_1581285_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_129556523.1|1581620_1582506_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	1610532	1654751	3116276	transposase	Staphylococcus_phage(42.86%)	46	NA	NA
WP_081377870.1|1610532_1611051_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	31.0	1.6e-07
WP_054300239.1|1611086_1611920_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051307341.1|1612751_1614350_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_016210848.1|1614516_1615701_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1615996_1616551_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210850.1|1616799_1618053_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210851.1|1618037_1618709_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210847.1|1618731_1619736_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210849.1|1619764_1621213_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210855.1|1621330_1622308_+	DMT family transporter	NA	NA	NA	NA	NA
WP_129556525.1|1622461_1623281_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1623357_1624332_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212475.1|1624529_1624736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212474.1|1624816_1624993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211182.1|1625720_1626050_-	DUF4404 family protein	NA	NA	NA	NA	NA
WP_032126448.1|1626081_1626462_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_016211178.1|1626552_1627581_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016211180.1|1627643_1628108_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_032126449.1|1628128_1629052_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_052047064.1|1629196_1629727_+	Smr/MutS family protein	NA	NA	NA	NA	NA
WP_032126450.1|1629839_1631834_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_016211177.1|1632201_1633422_+	amino acid permease	NA	NA	NA	NA	NA
WP_016212445.1|1633636_1633903_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_164997263.1|1633953_1634685_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.1	2.7e-45
WP_075274822.1|1634743_1635718_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016211736.1|1635741_1635942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211739.1|1636058_1636565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126783.1|1636675_1637917_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211741.1|1638062_1638839_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211738.1|1639315_1639960_-	membrane protein	NA	NA	NA	NA	NA
WP_032126790.1|1640030_1640936_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_059372279.1|1641900_1642236_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1642195_1642651_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126602.1|1642803_1644111_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211857.1|1644361_1645240_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_016211855.1|1645236_1645704_-	bacterioferritin	NA	NA	NA	NA	NA
WP_016211856.1|1645830_1646016_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_054300271.1|1646231_1647206_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556640.1|1647472_1648699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211351.1|1648774_1649113_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_032127067.1|1649109_1649712_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211349.1|1649708_1651703_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211350.1|1651766_1652705_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211352.1|1653383_1653824_+	universal stress protein	NA	NA	NA	NA	NA
WP_059372279.1|1654000_1654336_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1654295_1654751_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	1665061	1721749	3116276	transposase	Cedratvirus(14.29%)	51	NA	NA
WP_052047040.1|1665061_1666000_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1666069_1666327_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556528.1|1666748_1667177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211836.1|1668700_1669189_-	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_051307365.1|1669208_1669469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211834.1|1669725_1670040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664871.1|1670130_1671753_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.9	1.9e-27
WP_032126362.1|1672184_1672550_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1672495_1673071_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212185.1|1673164_1674154_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1674487_1674673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1675352_1677308_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016210749.1|1677606_1678068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210752.1|1678237_1679035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210751.1|1679518_1681324_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_129556641.1|1681411_1682674_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_155046731.1|1686548_1687433_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211454.1|1687574_1688045_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_161625471.1|1688807_1690283_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211455.1|1690344_1691802_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_122942091.1|1691907_1692303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211456.1|1692330_1692909_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_054300325.1|1693530_1693803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046732.1|1693996_1694167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274862.1|1694281_1694878_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211726.1|1695049_1695643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211728.1|1696030_1697965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211725.1|1698003_1698918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|1700488_1700755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007023.1|1700831_1701488_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1701662_1702118_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_059372279.1|1702077_1702413_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556531.1|1702378_1702576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211752.1|1702780_1703926_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211748.1|1703941_1705546_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211749.1|1705625_1706819_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_032126540.1|1707027_1707891_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212346.1|1708124_1708271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274864.1|1711111_1712137_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047087.1|1712308_1712527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211462.1|1712687_1713668_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211465.1|1714295_1715279_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_016211464.1|1715429_1715777_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_016211458.1|1715776_1716376_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211466.1|1716463_1717984_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_164997264.1|1718116_1718518_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_032126362.1|1718610_1718976_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1718921_1719497_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212485.1|1720257_1720791_+	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_129556532.1|1721087_1721270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664820.1|1721578_1721749_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	1726755	1775111	3116276	integrase,tRNA,plate,transposase	Acinetobacter_phage(100.0%)	43	1718544:1718603	1763374:1764335
1718544:1718603	attL	TTATAGCGCTGGATTAACAGTTTCTGACATAATATCAGTAGGTTAAAAAATACAATAAGG	NA	NA	NA	NA
WP_016209621.1|1726755_1727760_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209617.1|1727880_1728279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209627.1|1728318_1730142_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_033923701.1|1730138_1733441_+	translocation/assembly module TamB domain-containing protein	NA	NA	NA	NA	NA
WP_016209616.1|1733471_1734386_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016209618.1|1734456_1735086_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_016209632.1|1735130_1735565_-	lipoprotein	NA	NA	NA	NA	NA
WP_016209630.1|1735545_1736286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209625.1|1736299_1737697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209633.1|1737699_1740648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209614.1|1740647_1742369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209636.1|1742383_1742788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209631.1|1742788_1745662_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_075273639.1|1745664_1746381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209626.1|1746748_1748641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209637.1|1748672_1751210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161625456.1|1751241_1752333_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209624.1|1752410_1753022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209623.1|1753043_1754543_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016209615.1|1754559_1755066_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_155046733.1|1756307_1756445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046734.1|1756589_1756727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183174.1|1757382_1758108_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_129556535.1|1758561_1759447_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1759637_1759895_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377871.1|1760099_1760792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556536.1|1760794_1761948_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075274872.1|1761907_1762447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274873.1|1762921_1763419_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1763440_1763806_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1763751_1764327_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274874.1|1764327_1764696_+|transposase	transposase	transposase	NA	NA	NA	NA
1763374:1764335	attR	TTATAGCGCTGGATTAACAGTTTCTGACATAATATCAGTAGGTTAAAAAATACAATAAGGAAAAACGATGCCTTCTCCTTACAGTTATGACTTAAGAATTCGAGCACTAAAAATGATTGATGAAGGGATACCTATTACACAAATTTCCAAGCTCTTAAAAATCAGTCGAGACACTCTGCATCGTTGGAAAAATAGGCGTGATCATACAGGAGACGTCAAAGCAAGGTTTGGCTACCAAACGGGCTATAACCATAAAATCAGTGATATGAAAGAATTTCAAAAATTTATTGATCAGAATCCGGGTAAAACTCATCAACAACTCGCTGATCTTTACCCTGTAGAAATGAGTGCAAAAACCATGGGAGTGTGGATTAAAAAATTAGGCTATACCAGAAAAAAAAGAGCTTCAGATACCAAGAACGTGATGCATTAAAGCGGAAAGCTTTCCTGGAAAAAGTCGAGAAAATCGATAACGACAAAATTGTTTATATGGACGAAGCGGGTATGGATGATACTGAGCGTTACGCTTATGGCCACTCTGCTAAAGGTAAACGGTGCTATGCAGAGAAGCCAGGTAAAAAATCAATACGAATTAACTTTATAGGTGGTTTGCGCGGCAAGCAATTTATCGCACCAATGATGGTTGAAGGTTATTGCAATGCTAACGTTTGTCAGGCTTATATCGATCAGTGCTTAATTCCCTGTTTATCTCCTGGAGAGACTGTAATCATGGATAATGCCTCTTTTCACAAATCAAAAGGGGTTAAGGAAGCGATTGAAGATGCGGGTTGTCACTTATTATTTTTACCCCCTTATTCTCCTGATTTAAACCCGATAGAGCATGTATGGTCACCGCTTAAAAATAGGGTTCGCATGAAGCTTGATCAAGATGAAATAAATTTAGAGACAGCGCTTAGTCAAGTAATGAAGTCAATGTCAGAAACTATTCGTTGAGTGCTATA	NA	NA	NA	NA
WP_032126786.1|1764994_1768075_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016211319.1|1768092_1769145_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211316.1|1769677_1770328_+	porin family protein	NA	NA	NA	NA	NA
WP_016211315.1|1770662_1771307_+	porin family protein	NA	NA	NA	NA	NA
WP_054300314.1|1771494_1771830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273532.1|1771790_1772378_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126997.1|1772595_1772835_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_032126998.1|1773156_1773504_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_036774554.1|1773602_1773881_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1773933_1774221_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|1774224_1775111_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	1795310	1972699	3116276	protease,tRNA,integrase,transposase	Leptospira_phage(15.0%)	164	1854880:1854939	1923417:1924646
WP_054300307.1|1795310_1796039_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_129556539.1|1796107_1796452_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211983.1|1796699_1797359_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556643.1|1797454_1798819_+	histidine kinase	NA	NA	NA	NA	NA
WP_016212551.1|1799276_1799771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|1800112_1800688_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1800633_1800924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1800937_1801513_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1801458_1801824_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211946.1|1803044_1803800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211943.1|1804060_1804414_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211947.1|1804406_1805552_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_075274878.1|1805954_1806830_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212202.1|1807241_1808489_+	glutaminase	NA	NA	NA	NA	NA
WP_016209473.1|1809450_1809834_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_016209489.1|1809830_1810562_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_016209497.1|1810564_1811308_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_016209492.1|1811321_1812221_-	GTPase Era	NA	NA	NA	NA	NA
WP_016209466.1|1812226_1812901_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	34.5	8.9e-27
WP_129556644.1|1813306_1814194_-	signal peptidase I	NA	NA	NA	NA	NA
WP_016209482.1|1814244_1816047_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	39.2	5.1e-21
WP_016209457.1|1816346_1816928_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_016209458.1|1817071_1818646_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_129556541.1|1818653_1818968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209486.1|1819092_1819344_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_016209469.1|1819424_1820423_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_016209471.1|1820569_1820896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209462.1|1820905_1821049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209474.1|1821058_1821469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209468.1|1821610_1821922_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016209494.1|1822627_1824652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046735.1|1824721_1825747_-	FUSC family protein	NA	NA	NA	NA	NA
WP_016209455.1|1825739_1826786_-	membrane protein	NA	NA	NA	NA	NA
WP_075273528.1|1826966_1827932_+	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_016209459.1|1828191_1829358_+	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016209478.1|1829521_1830475_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_129556645.1|1830566_1832516_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_016209490.1|1832606_1832930_-	YqcC family protein	NA	NA	NA	NA	NA
WP_016209463.1|1833356_1833740_-	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_032126730.1|1834094_1834583_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_016209472.1|1834685_1836056_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_016209456.1|1836169_1836901_+	glucosaminidase domain-containing protein	NA	M1IDP9	Pelagibacter_phage	35.8	5.3e-09
WP_016209491.1|1836925_1838023_-	alanine racemase	NA	NA	NA	NA	NA
WP_016209475.1|1838055_1839477_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	1.7e-152
WP_016209484.1|1839686_1840139_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209480.1|1840150_1840378_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_016209481.1|1840427_1840754_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_016209493.1|1840956_1841646_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016209488.1|1841795_1842284_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_129556542.1|1842324_1843428_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_016209460.1|1843471_1844554_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.1	1.0e-72
WP_052133284.1|1844543_1845110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126728.1|1845100_1846405_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209485.1|1846457_1847480_-	chorismate mutase	NA	NA	NA	NA	NA
WP_016209453.1|1848687_1848837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556543.1|1848946_1849429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1849520_1849793_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377873.1|1849804_1850641_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.9	4.6e-41
WP_016212058.1|1851283_1852834_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_075274880.1|1852989_1853955_-|transposase	transposase	transposase	NA	NA	NA	NA
1854880:1854939	attL	GGTAACCCTCCCTTAAAATGAGACAACTCATAACTGGAATCTTCTGTTAACATTTTCAAA	NA	NA	NA	NA
WP_032126239.1|1854950_1855223_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1855234_1856071_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_098082828.1|1856568_1856826_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774189.1|1856825_1857833_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212247.1|1858199_1858955_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_054300271.1|1859582_1860557_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300162.1|1860896_1861979_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212246.1|1862082_1862739_-	AT hook motif family protein	NA	NA	NA	NA	NA
WP_075274882.1|1863674_1864271_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556544.1|1864385_1864742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1864804_1865887_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016210771.1|1865978_1869380_-	UvrD-helicase domain-containing protein	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_016210773.1|1869376_1872070_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_016210769.1|1872373_1873876_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_033923762.1|1874176_1874410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|1874537_1875347_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_016210772.1|1875430_1876984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1877116_1877416_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046696.1|1877405_1877570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|1877626_1877992_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210397.1|1878181_1880356_+	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_016210388.1|1880352_1881027_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210399.1|1881052_1883044_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_162034430.1|1883058_1883361_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_032126670.1|1883404_1883842_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210394.1|1883867_1885253_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_122940572.1|1885363_1885789_-	flagellar protein FlaG	NA	NA	NA	NA	NA
WP_032126669.1|1885907_1887485_-	B-type flagellin	NA	NA	NA	NA	NA
WP_016210398.1|1887709_1889302_-	B-type flagellin	NA	NA	NA	NA	NA
WP_016210393.1|1889502_1891704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210391.1|1891797_1892748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210396.1|1892815_1893004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211164.1|1893141_1893519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|1893561_1894077_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155046736.1|1894076_1895030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211168.1|1895007_1895667_-	WbqC family protein	NA	NA	NA	NA	NA
WP_016211165.1|1895663_1896392_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307350.1|1896381_1897128_-	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_016211166.1|1897111_1898164_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_016211172.1|1898364_1899561_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211167.1|1899610_1900732_-	ThiF family adenylyltransferase	NA	A0A1V0SIK8	Klosneuvirus	28.1	1.5e-10
WP_016211170.1|1901363_1901534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126750.1|1901692_1902490_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_054300295.1|1902770_1902995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556646.1|1903805_1905191_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_016211278.1|1905242_1906502_-	threonine synthase	NA	NA	NA	NA	NA
WP_016211277.1|1906488_1907457_-	homoserine kinase	NA	NA	NA	NA	NA
WP_016211279.1|1907470_1909939_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_075274886.1|1910682_1911744_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274888.1|1912015_1912351_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_173018588.1|1912355_1913105_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046696.1|1913265_1913430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1913419_1913719_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212209.1|1914174_1915176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274890.1|1915976_1916657_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155046760.1|1916740_1916983_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274891.1|1917208_1917619_+|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_129556546.1|1918079_1919265_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	5.9e-58
WP_129556547.1|1919691_1920252_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_054300287.1|1920660_1920990_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1921011_1921377_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1921322_1921898_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274733.1|1921916_1922234_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1922284_1923121_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1923132_1923405_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211421.1|1924263_1924488_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|1924584_1925490_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
1923417:1924646	attR	TTTGAAAATGTTAACAGAAGATTCCAGTTATGAGTTGTCTCATTTTAAGGGAGGGTTACCACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGGTTGAGGCGTTTATTGAGCGATTGACACAACATATACCAGAAAAGTTTTTCAAAATGATACGGTATTACGGCTTTTTAGCGAATCGAGTCAGAAAAACCTTGTTACCAAAAGTCTATGATTTATTAGATCAGACCATTGAAGCTGCTCAGTCTGTTACCTATTCCAGCCTGATGAAAGCCAATTATGCAGTAGATCCTCTCATTTGCATACTTTGTGGCAGTGAAATGAGACTCTCTGGATTCACAAACTCAACCCCTTTATGGCAGTTGCGTCAACATCATGAAAAGCTTGCGAAGATGAAGGAGGTCCGGCTTTAATTCAGCCTGCATAGGATTAATCCGTCCAAAAACGATAAAACGCACCATATGTGATACTTTTTGCCGATAATTAAGAATAGTTTCTGTTCTTCAGGTCAAATCTCTCAAATTTTGCTTCACTAAAAAATGATCCATTAACCCGGCTGAAACTTTCAAATTCTTCAATATTAAATTTTCAACAGAAAAACACTGTTTCTTTATTTAAAATAATAAACAAAACCATAGTGATTTTATGCAGATTAACTAATGACATTTTTTTGATTAAAAGTTTAGCTGATGTAAACTTATTAAAGACTGTTATAGCACTCAACGAATAGTTTCTGACATTGACTTCATTACTTGACTAAGCGCTGTCTCTAAATTTATTTCATCTTGATCAAGCTTCATGCGAACCCTATTTTTAAGCGGTGACCATACATGCTCTATCGGGTTTAAATCAGGAGAATAAGGGGGTAAAAATAATAAGTGACAACCCGCATCTTCAATCGCTTCCTTAACCCCTTTTGATTTGTGAAAAGAGGCATTATCCATGATTACAGTCTCTCCAGGAGATAAACAGGGAATTATGTGAAAGTCTGAACCTAGCTTGACAGTTGGAGTCTACTAACTGTTTGGAGGTAAAGATTAATGAATTTAAAAGCGAAACGCGATATTTCACGAAAATTGAAAGTACTTAACCATGCTTTAGA	NA	NA	NA	NA
WP_016210013.1|1925675_1927343_-	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
WP_017377777.1|1927505_1928483_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_122941592.1|1928577_1929429_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_016210019.1|1929686_1930721_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_032126616.1|1930785_1931145_-	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210007.1|1931200_1931773_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210023.1|1931750_1933808_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210021.1|1933804_1935130_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210004.1|1935390_1936032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|1936231_1936987_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210027.1|1937376_1937973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210005.1|1938052_1940857_+	response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	2.4e-57
WP_016210012.1|1940837_1941509_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210009.1|1941584_1941791_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_016210025.1|1941783_1943154_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210020.1|1943418_1943574_-	putative membrane protein	NA	NA	NA	NA	NA
WP_155047192.1|1944177_1945134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273518.1|1945300_1945594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210017.1|1945669_1946053_-	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_016210010.1|1946228_1946405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046739.1|1948049_1948190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556549.1|1949074_1949961_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210524.1|1950499_1951030_-	7-cyano-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_016210522.1|1951040_1952093_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_016210518.1|1952108_1954148_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.8	3.0e-126
WP_016210525.1|1954134_1954953_-	ZipA protein	NA	NA	NA	NA	NA
WP_032126504.1|1955019_1958559_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_016210517.1|1958672_1959392_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_016210521.1|1960405_1962343_+	CHASE domain-containing protein	NA	NA	NA	NA	NA
WP_016210519.1|1962578_1963346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273512.1|1963335_1963680_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274897.1|1964192_1965059_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300152.1|1965299_1965665_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|1966338_1967313_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209449.1|1967486_1968959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209448.1|1969400_1970732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209432.1|1970989_1972699_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 19
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	1987738	2033891	3116276	protease,tRNA,transposase	Orpheovirus(18.18%)	50	NA	NA
WP_016209434.1|1987738_1989160_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_129556553.1|1989249_1990842_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_016209439.1|1991005_1991632_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_129556647.1|1991712_1994343_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_016209445.1|1994876_1995833_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_016209435.1|1995933_1996305_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.1e-05
WP_016209404.1|1996331_1997195_+	chemotaxis protein CheX	NA	NA	NA	NA	NA
WP_016209416.1|1997184_1997970_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_016209413.1|1998258_1998744_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_016209443.1|1998818_1999340_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016209405.1|1999385_2000279_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016209406.1|2000275_2001097_-	ParA family protein	NA	Q8JL10	Natrialba_phage	32.2	5.0e-16
WP_016209408.1|2001411_2001582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209427.1|2001735_2003139_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_016209446.1|2003232_2004456_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_016209402.1|2004469_2005198_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_016209424.1|2005212_2006490_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
WP_016209433.1|2006589_2006964_-	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209412.1|2007048_2007936_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209436.1|2007993_2008722_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_129556555.1|2008718_2009849_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209444.1|2009979_2010408_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_032126508.1|2010502_2010862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209447.1|2010851_2012063_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016209421.1|2012059_2012848_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_016209411.1|2013010_2013805_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_054300271.1|2014010_2014985_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_059372588.1|2015153_2015585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274901.1|2015729_2016743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2016746_2017046_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046696.1|2017035_2017200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2017256_2017622_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211553.1|2017961_2018702_-	outer-membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_016211549.1|2018705_2021210_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211548.1|2021472_2022429_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211550.1|2022412_2023174_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_075274903.1|2023251_2024127_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2024251_2024497_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_016211262.1|2024556_2026830_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_075273504.1|2026884_2027238_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211261.1|2027427_2027721_+	cold shock domain-containing protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_032126515.1|2027893_2028073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307354.1|2028148_2028724_-	DedA family protein	NA	NA	NA	NA	NA
WP_032126514.1|2029006_2030323_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2030333_2030702_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_016211265.1|2030732_2031395_-	adenylate kinase	NA	NA	NA	NA	NA
WP_032126362.1|2031569_2031935_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556556.1|2031880_2032456_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033923779.1|2032770_2033607_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2033618_2033891_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	2057550	2160460	3116276	tRNA,transposase,protease	Staphylococcus_phage(20.0%)	101	NA	NA
WP_054300173.1|2057550_2058612_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556648.1|2059025_2059997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211446.1|2060180_2061908_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_016211448.1|2061897_2063106_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211450.1|2063204_2064227_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016212394.1|2065248_2065953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556557.1|2066000_2066312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556558.1|2066456_2067350_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126170.1|2067513_2067786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211040.1|2068013_2069225_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211037.1|2069575_2070205_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211042.1|2070253_2071270_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211035.1|2071516_2071732_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211043.1|2071784_2072234_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_155046762.1|2072313_2073423_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	1.7e-46
WP_155046740.1|2073452_2074058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211036.1|2074149_2076021_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_054300271.1|2076368_2077343_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211094.1|2077362_2077686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046741.1|2078750_2080940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046742.1|2080984_2081230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211092.1|2081273_2082566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307348.1|2082801_2085558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211519.1|2086713_2087133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|2087133_2087835_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|2088095_2088302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941967.1|2088531_2088837_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126840.1|2089015_2091013_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2090996_2092043_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016212098.1|2092750_2093602_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016212100.1|2093602_2094523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212654.1|2094933_2095218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377876.1|2095209_2095665_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_059372279.1|2095624_2095960_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212093.1|2096175_2097105_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_129556559.1|2097261_2097690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556560.1|2097770_2098307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2098276_2099182_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|2099372_2099981_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_081007013.1|2100021_2100321_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046696.1|2100310_2100475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274909.1|2100858_2101185_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2101283_2101859_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2101804_2102170_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556561.1|2102340_2103493_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	2.6e-58
WP_016211971.1|2103699_2104311_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032126649.1|2104331_2105528_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_017377024.1|2105624_2105765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211968.1|2105777_2106182_-	SufE family protein	NA	NA	NA	NA	NA
WP_059372279.1|2106310_2106646_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556562.1|2106605_2106908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|2107052_2107238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|2107807_2108389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556649.1|2108416_2109274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211960.1|2109813_2110341_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_075273327.1|2110584_2111160_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2111105_2111471_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209897.1|2111492_2111735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556650.1|2112055_2113030_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209885.1|2113458_2114172_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016209894.1|2114340_2114832_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209887.1|2114975_2115467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209877.1|2115669_2116560_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_080664826.1|2116748_2117348_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016209878.1|2117428_2118367_-	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	29.6	1.9e-14
WP_129556563.1|2118418_2119519_-	FUSC family protein	NA	NA	NA	NA	NA
WP_016209883.1|2119637_2120954_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	9.4e-65
WP_016209893.1|2121008_2125898_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_016209881.1|2125990_2126293_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_016209876.1|2126403_2128326_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_016209888.1|2128347_2129643_+	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_016209898.1|2129639_2131250_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_016209882.1|2131356_2132250_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_016209884.1|2132359_2132983_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036777115.1|2133059_2133260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209891.1|2133401_2134100_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016209896.1|2134246_2134816_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_122940402.1|2135130_2135754_-	porin family protein	NA	NA	NA	NA	NA
WP_032126745.1|2135962_2136565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|2136636_2137002_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046744.1|2137058_2137232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556564.1|2138401_2138731_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212575.1|2139884_2140064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556565.1|2140187_2140583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126686.1|2142052_2142637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274914.1|2143187_2144063_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_059372565.1|2144111_2144483_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_164997247.1|2144430_2144595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210465.1|2145101_2145944_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_016210463.1|2145994_2146342_-	phosphomannose isomerase type II C-terminal cupin domain	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210471.1|2146532_2147420_+	ROK family protein	NA	NA	NA	NA	NA
WP_016210467.1|2147534_2148137_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210468.1|2148133_2148853_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_161625462.1|2148921_2150526_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_016210464.1|2150781_2152719_+	AsmA family protein	NA	NA	NA	NA	NA
WP_032126596.1|2152827_2153880_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_016210461.1|2153879_2154155_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016210458.1|2154235_2154784_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_016210459.1|2157858_2158377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212492.1|2158581_2159436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2159485_2160460_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 21
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	2181130	2224093	3116276	transposase	Staphylococcus_phage(45.45%)	43	NA	NA
WP_036771330.1|2181130_2182105_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016212614.1|2182273_2182480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923739.1|2182624_2184133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211535.1|2184344_2186132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211536.1|2186207_2186441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211538.1|2187135_2188059_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_054300443.1|2188297_2188576_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|2188628_2188877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|2188834_2189896_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212177.1|2190891_2191065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212174.1|2191141_2191399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2192473_2193049_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274918.1|2192994_2193360_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212205.1|2194043_2194223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|2194362_2195808_+	MFS transporter	NA	NA	NA	NA	NA
WP_016212319.1|2196366_2196594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|2196580_2196907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|2196908_2197340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|2197868_2198930_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210831.1|2199024_2199570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|2199839_2200859_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|2200845_2201268_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|2201269_2201743_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_016210834.1|2201858_2202515_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.5e-39
WP_016210836.1|2202511_2203186_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|2203191_2204340_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|2204336_2204798_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210830.1|2204873_2206124_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_016210824.1|2206250_2207930_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|2208038_2208905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274920.1|2210335_2211070_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	4.8e-10
WP_016211000.1|2211165_2211951_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307345.1|2212094_2212781_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211002.1|2212814_2213213_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|2213376_2213682_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210998.1|2213759_2214014_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|2214167_2215829_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|2215888_2216572_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|2216571_2217660_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016211004.1|2217708_2220345_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300237.1|2220757_2221819_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556568.1|2222008_2223490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046745.1|2223526_2224093_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	2303030	2325764	3116276	tRNA,transposase	Planktothrix_phage(28.57%)	29	NA	NA
WP_016209560.1|2303030_2303705_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2303733_2304138_+	RidA family protein	NA	NA	NA	NA	NA
WP_016209567.1|2305253_2305871_-	MFS transporter	NA	NA	NA	NA	NA
WP_155046949.1|2305941_2306112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126712.1|2306305_2306764_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209553.1|2307508_2308519_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	42.2	2.9e-58
WP_016209566.1|2309003_2309915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209545.1|2310240_2313735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209551.1|2313772_2314612_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.0	1.8e-45
WP_016209564.1|2314798_2315014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209547.1|2315062_2315638_-	ribonuclease HI	NA	V9M0C8	Vibrio_phage	46.6	1.3e-29
WP_016209540.1|2315634_2315973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209568.1|2316141_2317131_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.7	1.7e-18
WP_016209572.1|2317131_2318094_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-16
WP_016209559.1|2318103_2319006_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300271.1|2319049_2320024_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212612.1|2320161_2320395_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300455.1|2320488_2320854_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2320910_2321075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2321064_2321364_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212572.1|2321421_2321814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2321943_2322309_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300461.1|2322365_2322674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2322765_2323341_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2323286_2323652_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273331.1|2323777_2324077_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212514.1|2324487_2324625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|2324643_2325480_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2325491_2325764_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	2449663	2534834	3116276	tRNA,transposase	Escherichia_phage(41.18%)	86	NA	NA
WP_033923779.1|2449663_2450500_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2450511_2450784_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211743.1|2450850_2451213_-	ABC transporter membrane domain protein	NA	NA	NA	NA	NA
WP_016211747.1|2451199_2452222_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	4.8e-16
WP_016211744.1|2452205_2452610_-	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_016211742.1|2452840_2454820_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_054300202.1|2455099_2455828_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019244.1|2455917_2456529_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_016210955.1|2456885_2457140_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|2457238_2459023_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_016210956.1|2459111_2459831_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210951.1|2460013_2460220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210948.1|2460219_2460456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|2460468_2460846_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|2461352_2462171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210947.1|2462264_2462462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210946.1|2462556_2463942_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210945.1|2464068_2464659_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_075274930.1|2465469_2465889_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274931.1|2465918_2466647_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_032126570.1|2467404_2467704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211816.1|2467716_2468070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|2468111_2469725_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_075274932.1|2469946_2470168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274933.1|2470476_2471205_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211951.1|2471821_2472919_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|2472952_2474203_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_075274934.1|2474690_2475359_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.0	2.8e-41
WP_016212193.1|2475481_2475820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|2475887_2476274_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|2476270_2476516_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300202.1|2476924_2477653_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211625.1|2478136_2479006_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_016211621.1|2479002_2480352_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	4.6e-75
WP_016211623.1|2480464_2482105_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_016211987.1|2483926_2485663_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_144019359.1|2485824_2486022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556671.1|2486166_2486895_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_098082825.1|2486958_2487267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|2487259_2487592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|2487595_2488165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211655.1|2488293_2488707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211652.1|2488966_2490172_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211653.1|2490279_2491305_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_054300202.1|2491396_2492125_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212214.1|2492283_2492784_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036780855.1|2492758_2493256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|2494021_2494750_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155049878.1|2494792_2495368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211047.1|2495446_2497081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|2497441_2497945_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|2497907_2498615_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|2498683_2499544_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_016211045.1|2499524_2500298_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|2500328_2501582_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|2501581_2502544_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|2502587_2503340_+	ComF family protein	NA	NA	NA	NA	NA
WP_016210615.1|2505715_2506186_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|2506231_2506471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274938.1|2506489_2506996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|2507159_2508584_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_032126482.1|2508648_2509686_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|2509964_2510744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556587.1|2510787_2511690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210625.1|2511748_2512495_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_016210616.1|2512743_2515554_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_129556661.1|2515854_2516418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|2516406_2517135_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_080664881.1|2517224_2517431_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212263.1|2517593_2518187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212264.1|2518232_2518826_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	5.4e-28
WP_016212238.1|2519341_2520631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274939.1|2520660_2521389_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.8e-42
WP_087910645.1|2521501_2522654_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274940.1|2522682_2523363_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	2.0e-42
WP_016211997.1|2523718_2524828_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	24.5	4.4e-07
WP_016211996.1|2524829_2525777_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_075274941.1|2526160_2526889_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.2e-42
WP_075275114.1|2526918_2527281_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212339.1|2527433_2528180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274942.1|2528198_2528927_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.1	2.7e-45
WP_032127022.1|2529603_2531790_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_087910645.1|2531851_2533005_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274943.1|2533290_2533815_+	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_173018589.1|2534005_2534152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274944.1|2534117_2534834_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
>prophage 24
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	2549652	2597254	3116276	tRNA,integrase,transposase	uncultured_Caudovirales_phage(18.18%)	44	2547377:2547436	2597994:2598288
2547377:2547436	attL	CACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAG	NA	NA	NA	NA
WP_081377879.1|2549652_2549877_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_016212230.1|2549932_2551381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|2552914_2553103_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556589.1|2554504_2554780_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|2554782_2555385_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_155046749.1|2555448_2555736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|2556280_2557360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211874.1|2557678_2559397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2559440_2560346_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046750.1|2561590_2561728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210068.1|2562914_2563490_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_016210050.1|2563565_2564441_-	6-carboxytetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_016210054.1|2564505_2565027_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210069.1|2565011_2566094_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.6e-20
WP_016210051.1|2566334_2566739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210073.1|2567163_2567895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210076.1|2568151_2569453_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210066.1|2569594_2570263_+	Bax inhibitor-1 family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_032126425.1|2570706_2571303_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210052.1|2571323_2572520_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
WP_016210064.1|2572644_2574009_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_016210075.1|2574005_2575097_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_016210065.1|2575350_2576010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210057.1|2576150_2576660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126424.1|2576668_2577493_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_016210061.1|2577505_2578150_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.8e-19
WP_016210062.1|2578139_2578979_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.3	1.8e-08
WP_016210074.1|2578984_2579611_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_016210053.1|2579772_2580315_+	septation protein A	NA	NA	NA	NA	NA
WP_016210060.1|2580398_2580701_+	YciI family protein	NA	NA	NA	NA	NA
WP_032126423.1|2580697_2580961_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210070.1|2581054_2581327_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_016210055.1|2581365_2582004_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_032126421.1|2582271_2583363_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032126420.1|2583566_2585327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210679.1|2586002_2588327_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.9	2.0e-17
WP_016210675.1|2588494_2589211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210677.1|2589290_2589905_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_016210672.1|2589897_2591280_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_016210673.1|2591288_2591762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210671.1|2591894_2593154_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_016210676.1|2593609_2595691_+	kinase domain protein	NA	NA	NA	NA	NA
WP_173018590.1|2595994_2596204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2596279_2597254_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
2597994:2598288	attR	CACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTTGGA	NA	NA	NA	NA
>prophage 25
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	2602267	2655859	3116276	protease,tRNA,transposase	Microbacterium_phage(12.5%)	58	NA	NA
WP_075273298.1|2602267_2602843_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377880.1|2602788_2603268_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556590.1|2604125_2604521_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_032126312.1|2604517_2605312_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211756.1|2605490_2606216_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211759.1|2606461_2607649_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_081377344.1|2608003_2609131_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210935.1|2609461_2610004_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|2610000_2610687_-	acireductone synthase	NA	NA	NA	NA	NA
WP_016210942.1|2610690_2611302_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|2611348_2612368_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|2612469_2613264_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|2613301_2614108_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|2614186_2615236_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|2615433_2616693_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|2616739_2617417_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2617502_2617784_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_155046994.1|2617875_2619030_-	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.6	2.1e-20
WP_129556549.1|2619170_2620057_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210820.1|2620258_2621200_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|2621703_2621928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|2622219_2622924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210823.1|2623373_2624012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|2624346_2624877_+|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_016210821.1|2624873_2626406_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2626402_2627353_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2627772_2628405_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2628647_2628845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2629194_2629623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046752.1|2629661_2630399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274949.1|2630376_2631438_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126306.1|2631662_2631959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556591.1|2632063_2632720_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017377817.1|2632943_2633441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164997268.1|2634357_2634480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377882.1|2634531_2634813_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_059372279.1|2634772_2635108_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210986.1|2635168_2636707_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	1.3e-86
WP_098082804.1|2636818_2637917_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_016210987.1|2638154_2639354_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_016210981.1|2639383_2640022_+	ribonuclease T	NA	NA	NA	NA	NA
WP_016210983.1|2640037_2642221_-	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	1.1e-06
WP_032126304.1|2642458_2642803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210984.1|2642816_2643767_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_052104666.1|2643931_2644390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2644793_2645680_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212032.1|2645936_2647064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|2647187_2647850_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|2647941_2648187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211962.1|2648484_2649000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211963.1|2649548_2650208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|2650309_2650960_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211964.1|2651072_2651393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2651451_2652426_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126299.1|2652676_2652898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212027.1|2652920_2654144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212028.1|2654638_2654887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046753.1|2654974_2655859_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	2676613	2780292	3116276	tRNA,transposase,protease	Staphylococcus_phage(12.5%)	104	NA	NA
WP_036771330.1|2676613_2677588_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_075274951.1|2677584_2678469_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211784.1|2679022_2679745_+	aquaporin family protein	NA	M1HH19	Acanthocystis_turfacea_Chlorella_virus	35.8	1.6e-26
WP_016211783.1|2679736_2680102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126294.1|2680382_2681660_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211782.1|2682259_2682442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2682503_2682869_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2682814_2683390_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210759.1|2683434_2684028_+	inositol polyphosphate kinase family protein	NA	NA	NA	NA	NA
WP_016210766.1|2684116_2684560_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_032126291.1|2684563_2685073_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_016210756.1|2685065_2687879_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A167RAL2	Powai_lake_megavirus	26.5	1.3e-76
WP_051307336.1|2688017_2688944_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	9.4e-11
WP_016210758.1|2689101_2690640_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2690813_2691074_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_016210763.1|2691382_2692627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161625465.1|2692769_2693459_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_016210761.1|2693562_2694300_+	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_081377880.1|2694937_2695417_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273298.1|2695362_2695938_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033923659.1|2696075_2696684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307321.1|2696746_2697295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209980.1|2697381_2698548_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.7e-25
WP_032126286.1|2698853_2701652_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	4.9e-180
WP_016209981.1|2701710_2702931_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	8.5e-36
WP_016209998.1|2702960_2703362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210001.1|2703832_2703994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209994.1|2704028_2704316_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_016209985.1|2704472_2704811_+	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_016209995.1|2704845_2706483_-	response regulator	NA	NA	NA	NA	NA
WP_016209992.1|2706584_2707634_+	WD domain, G-beta repeat family protein	NA	NA	NA	NA	NA
WP_016209988.1|2707706_2708351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556662.1|2708347_2709595_-	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_016209986.1|2709600_2710890_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_016209989.1|2710914_2711505_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_016209996.1|2711649_2711874_+	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_016209991.1|2711854_2712184_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_033923658.1|2712409_2712973_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209997.1|2713007_2713469_+	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_016209977.1|2713545_2715231_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_032126288.1|2715280_2716081_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_016210000.1|2716107_2716656_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_016209993.1|2716785_2717178_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016209990.1|2717234_2717639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144019123.1|2717671_2718415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2718904_2719966_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2720056_2720803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274953.1|2720927_2721791_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|2722034_2722397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274954.1|2722541_2723111_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556595.1|2723255_2723672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|2725443_2726355_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|2726406_2727255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|2727699_2728410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210379.1|2728501_2729461_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|2729457_2730105_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_016210370.1|2730133_2730985_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|2730999_2732277_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|2732317_2732833_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210372.1|2732911_2733973_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_016210377.1|2733994_2735131_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_016210378.1|2735127_2736963_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2737005_2737476_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2737512_2737848_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_032126282.1|2737860_2738517_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|2738513_2739530_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|2739526_2740006_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|2740089_2742570_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2742632_2742998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046754.1|2743375_2744089_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2744103_2744394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210570.1|2744459_2746058_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2746188_2746524_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_016210578.1|2746551_2748216_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	7.1e-33
WP_016210581.1|2748212_2748857_-	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210582.1|2748856_2749600_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2749658_2749898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2750048_2751416_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|2751426_2751978_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126278.1|2752058_2753042_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|2753163_2754921_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126277.1|2755143_2755734_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|2755821_2756241_-	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_016210580.1|2756381_2756642_+	methyltransferase	NA	NA	NA	NA	NA
WP_075274955.1|2756717_2757692_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_075274956.1|2757734_2758103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212327.1|2758163_2758949_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_016212084.1|2761589_2762606_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126534.1|2762605_2763121_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212085.1|2763162_2763636_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_075274955.1|2763793_2764768_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212306.1|2764803_2765334_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212310.1|2765363_2765819_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_164997248.1|2767040_2767178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556598.1|2768368_2770882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211935.1|2771816_2774465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274958.1|2774913_2775975_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2776001_2776577_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2776522_2776888_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046755.1|2776959_2777136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556599.1|2777526_2778679_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_164997269.1|2779424_2779571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|2779827_2780007_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300181.1|2780010_2780292_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	2891240	2934638	3116276	protease,transposase	Acanthamoeba_polyphaga_lentillevirus(14.29%)	41	NA	NA
WP_016209259.1|2891240_2892089_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_016209274.1|2892205_2893117_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_075274963.1|2893835_2894897_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212454.1|2895116_2895797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211192.1|2896585_2897944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211189.1|2897988_2898447_-	NfeD family protein	NA	NA	NA	NA	NA
WP_016211187.1|2898471_2899392_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_016211186.1|2899518_2900301_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.3	8.2e-32
WP_016211190.1|2900390_2901890_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_016211188.1|2902211_2904095_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_075273298.1|2904168_2904744_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2904689_2905055_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211157.1|2905619_2906276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211161.1|2906383_2907493_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|2907504_2908149_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|2908167_2909154_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|2909233_2910310_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|2910512_2911337_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|2911653_2912658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|2912866_2913832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274965.1|2913970_2914846_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2915142_2916195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211698.1|2916462_2916891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211697.1|2917116_2917596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2917651_2918902_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2919004_2919223_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_052104629.1|2919665_2920691_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080728341.1|2921140_2921311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212561.1|2921282_2921423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210728.1|2922337_2922808_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2923096_2924476_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2924503_2924962_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2924939_2926157_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2926348_2926585_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2926598_2926754_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2926834_2927797_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2927956_2929273_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2929282_2929951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2930313_2932128_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_129556601.1|2932245_2933022_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_052104629.1|2933612_2934638_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP038811	Piscirickettsia salmonis strain Psal-001 chromosome, complete genome	3116276	2966323	3086228	3116276	tRNA,transposase	Staphylococcus_phage(33.33%)	114	NA	NA
WP_054300271.1|2966323_2967298_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|2967373_2968393_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047000.1|2968440_2968587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047001.1|2968791_2968977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274966.1|2970992_2972054_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211201.1|2972134_2972443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211206.1|2972557_2973874_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211208.1|2974335_2975553_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211205.1|2975694_2976591_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211203.1|2976677_2977676_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032126430.1|2977784_2978309_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_129556668.1|2978556_2979795_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_016211207.1|2980061_2980205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212222.1|2980342_2980816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|2980812_2981208_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2982137_2982713_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2982658_2983024_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211610.1|2983288_2985619_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_129556603.1|2985739_2987755_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075274967.1|2987938_2991331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|2991395_2991701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274968.1|2991870_2992971_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556605.1|2993365_2994475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209721.1|2995413_2996811_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.3e-77
WP_051307313.1|2996930_2997878_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|2997874_2998390_-	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_016209698.1|2998376_2999576_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_016209707.1|2999572_2999896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|2999897_3001127_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|3001126_3002170_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|3002169_3002853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3002849_3005339_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3005355_3005610_-	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_016209715.1|3005610_3005967_-	TrbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_164997270.1|3006926_3007910_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|3007929_3011037_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|3011038_3012544_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3012571_3012853_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3013001_3013343_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3013462_3015343_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_059372650.1|3015427_3017026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3017043_3018159_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|3018286_3019285_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209700.1|3019288_3020047_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3020048_3021248_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3021231_3021903_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3021924_3022701_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3022704_3023703_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3023704_3024283_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3024279_3025749_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3025792_3026080_-	trp operon repressor	NA	NA	NA	NA	NA
WP_016209699.1|3026280_3026877_+	DMT family transporter	NA	NA	NA	NA	NA
WP_173018591.1|3027182_3027557_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|3027613_3027769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274971.1|3027913_3028366_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3028551_3028773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212371.1|3028888_3029521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274972.1|3029498_3030560_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211865.1|3030999_3031539_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|3031623_3032160_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_016211866.1|3032811_3033114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|3033563_3033872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274973.1|3034462_3034930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|3035212_3035923_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|3036149_3036548_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_016211231.1|3037415_3038366_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3038365_3040444_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3040591_3041107_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3041115_3041679_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3041659_3042406_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3042545_3042998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034456.1|3043610_3044258_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3044254_3045151_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3045183_3046251_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3046269_3046638_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3046663_3048112_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3048121_3049501_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3049541_3050873_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|3050844_3051804_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3051896_3052400_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3052534_3053686_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3053682_3054162_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3054308_3056630_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_016210343.1|3056631_3057201_+	Sua5/YciO/YrdC/YwlC family protein	NA	NA	NA	NA	NA
WP_016210344.1|3057205_3058105_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3058177_3058756_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3059056_3059314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556611.1|3059322_3060476_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046759.1|3061888_3062044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212051.1|3062371_3063145_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126148.1|3063686_3063869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3064472_3065447_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3066541_3066880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212337.1|3066896_3067607_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_051307375.1|3067594_3067786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|3067947_3068247_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046696.1|3068236_3068401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274902.1|3068465_3068822_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3070126_3070822_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3070818_3072246_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211791.1|3072271_3072535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3072895_3073870_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556612.1|3073928_3074779_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|3074816_3075161_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3075993_3076335_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3076336_3076942_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_032126720.1|3076938_3078933_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3078952_3079894_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211292.1|3080121_3081546_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|3082058_3083033_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3083091_3083748_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016212448.1|3083794_3084574_-	O-methyltransferase family protein	NA	NA	NA	NA	NA
WP_157883632.1|3085092_3085338_+|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_016211923.1|3085256_3086228_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP038812	Piscirickettsia salmonis strain Psal-001 plasmid unnamed1, complete sequence	150781	2331	101127	150781	head,transposase,protease,integrase,capsid,tail	Streptococcus_phage(21.74%)	114	91366:91425	104700:105562
WP_155046764.1|2331_2823_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	28.0	7.4e-07
WP_036771330.1|2881_3856_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_054300162.1|4368_5451_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212151.1|5815_6778_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|6801_7116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923686.1|7172_8222_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|8330_9371_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|9384_10014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|10104_10404_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211886.1|10400_10829_-	nucleotidyltransferase substrate binding protein	NA	NA	NA	NA	NA
WP_054300202.1|11617_12346_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126832.1|12590_13499_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_054300202.1|13609_14338_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046765.1|14449_14644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|15530_16259_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|16462_19039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046766.1|19263_19401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274822.1|19444_20419_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_075274931.1|20619_21348_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.4e-38
WP_016212137.1|21791_22853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212139.1|22928_23174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307371.1|23145_23760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|24577_25552_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_129556707.1|25911_26931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|27559_28713_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_032126239.1|28857_29130_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|29141_29978_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075275144.1|30010_30742_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212014.1|30839_31253_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_016212017.1|31547_31946_+	hypothetical protein	NA	W8VUR5	Pseudomonas_phage	38.8	2.3e-06
WP_047927838.1|31975_32221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|32217_32517_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_016212019.1|32673_33369_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_081377351.1|34182_34962_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126739.1|35149_35482_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212154.1|35646_36024_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_016212152.1|36330_36714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|37183_37912_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_129556708.1|38027_38363_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A9D9Y1	Lactobacillus_prophage	35.6	2.6e-11
WP_016212365.1|38355_38598_-	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_054300271.1|38806_39781_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_075275142.1|40416_41145_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	1.2e-37
WP_075275141.1|41427_43113_+	protein kinase	NA	NA	NA	NA	NA
WP_016212311.1|43233_43965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275140.1|44118_44853_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.1e-38
WP_075275139.1|45479_45710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212404.1|46324_46558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126756.1|46678_47122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275138.1|47266_47575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047124.1|47779_49441_+	AAA family ATPase	NA	A0A0K2FLP8	Brevibacillus_phage	31.5	9.1e-65
WP_016212457.1|49450_49852_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_016212456.1|49848_50136_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_075275137.1|50179_50593_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126239.1|50648_50921_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|50932_51769_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_016212579.1|52699_52897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|54402_54603_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_075273327.1|54613_55189_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|55134_55500_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212061.1|56331_58374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|59278_59644_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|59589_60165_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075274752.1|60161_60461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|60496_61650_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_052047048.1|61830_62331_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046767.1|62330_62492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211937.1|62761_63151_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_129556711.1|63637_64663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307369.1|65193_65718_+|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_075275133.1|66289_66598_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962623.1|67130_68284_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273327.1|68532_69108_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075275128.1|69053_69419_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556696.1|69518_70535_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.0	3.0e-18
WP_052133287.1|70636_71035_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_129556716.1|71168_71459_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
WP_016210655.1|71472_72069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210656.1|72235_72391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210663.1|72387_72699_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	4.3e-08
WP_016210667.1|72695_73019_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210658.1|73011_73407_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210651.1|73403_73754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210664.1|73753_74176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210669.1|74177_74501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|74557_74824_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075273774.1|77025_78183_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275128.1|78324_78690_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|78635_79211_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126790.1|79681_80587_+|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
WP_129556697.1|80971_81364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211776.1|81846_83184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211775.1|83351_83720_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_016211773.1|83821_84496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|84948_85314_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|85259_85835_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126360.1|86041_86776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211895.1|86898_87957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|88465_89212_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211897.1|89212_89617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|90010_90826_-|transposase	transposase	transposase	NA	NA	NA	NA
91366:91425	attL	GGCACTGTTGCGAAAAATTATAGTGAACTTCAGAAAGGTTATTTTCTTGTGCTCTCTGCT	NA	NA	NA	NA
WP_054300202.1|91430_92159_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212298.1|92600_92927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307374.1|93167_93644_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_075275158.1|93758_94052_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_098082791.1|94897_95200_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.6	8.6e-14
WP_129556698.1|95208_95910_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_016211912.1|95999_96590_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
WP_032126795.1|96862_97123_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_016211910.1|97126_97399_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_016211913.1|97724_98846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273786.1|99278_99677_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081377915.1|99685_100243_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	2.9e-47
WP_081377914.1|100387_100717_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|100833_101127_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
104700:105562	attR	GGCACTGTTGCGAAAAATTATAGTGAACTTCAGAAAGGTTATTTTCTTGTGCTCTCTGCTTAGAATTAAGCAGCTAATCCAAATAATTTATCAATGAGCTGATTTTGGGCACAGATATTCTGTTTTTTAATATAACGTAATTGACCTTTTTGAACCATGCGCATCGCTTCCATTATGTCAATGGTAGGCCGTGCTGTAGAAAGTGATTGGTACCATTGGCGGAAACGGGATTTGCGCTTTACCGCTTTGTGATCATTTTCAATGCAGTTGTTTAAATACTTCACTCGCCTGAGTTTACACTGACTAGAAAAGACACCTTCATCTTTGGCTTTTTGGTGAGCGGGTGGAAATGAAGCGTGCTTGTCGACATTCACAACACGCGGTGATTTCACATAAGGTTGGGCGATTGCCTTTTTGAAAAAGCGCATCGCCGCTTTGGCATTTTGCTGTCGGCTGAGCATCCAGTCCAAAGTATGGCCATATTTATCAATGGCTCGATAAAGGTAATACCAACGACCTTTGATTTTCACCAACGTTTCATCTAACCGCCAAGAGGCACACGTTTGACGAAAGTGGGGCCTCAGCCGTTTGGCGATCTGCGAGCCATACTCGTGCACCCAGCGACAAATGGTTGAACGCTCAATCTCAAGACCTCTTTCAGCTGCTATTTCTTTGAGATCACGGTAAGATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATGATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTCTACCCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCCG	NA	NA	NA	NA
>prophage 1
NZ_CP038813	Piscirickettsia salmonis strain Psal-001 plasmid unnamed2, complete sequence	79942	4824	28863	79942	transposase	Streptococcus_phage(16.67%)	33	NA	NA
WP_075273327.1|4824_5400_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|5345_5711_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212400.1|5761_6361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212399.1|6360_6621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|6750_7903_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212392.1|7931_8939_-	hypothetical protein	NA	W6E8G0	Rhizobium_phage	26.4	1.2e-06
WP_075273802.1|9002_9731_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.5e-37
WP_016212131.1|9914_10262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212135.1|10700_11885_+	3-methylitaconate isomerase	NA	NA	NA	NA	NA
WP_075275202.1|12128_12830_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	6.0e-10
WP_075275201.1|12832_13561_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_016212164.1|13689_14718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211443.1|15741_16428_+	Fic family protein	NA	NA	NA	NA	NA
WP_016211439.1|16431_16986_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	40.6	1.0e-20
WP_016211436.1|17030_17969_+	Fic family protein	NA	S4TP71	Salmonella_phage	37.2	5.2e-25
WP_016211434.1|17941_18133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211445.1|18310_18661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211437.1|18677_19304_-	zinc-ribbon domain-containing protein	NA	A0A1S5XYQ1	Kurlavirus	28.2	4.4e-12
WP_032126541.1|19310_19703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211440.1|19713_20628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211444.1|20897_21404_+	antirestriction protein ArdA	NA	A0A222YZE5	Mycobacterium_phage	33.7	2.8e-17
WP_051307358.1|21552_21936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556729.1|22219_22450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212541.1|22436_22661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212539.1|22720_22870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|22866_23841_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212090.1|23884_24064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212087.1|24063_24492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126714.1|24659_25199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212089.1|25435_25666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126713.1|25764_26802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|27271_28297_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275198.1|28323_28863_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	40.2	8.4e-12
>prophage 2
NZ_CP038813	Piscirickettsia salmonis strain Psal-001 plasmid unnamed2, complete sequence	79942	37205	57886	79942	tail,portal,capsid,protease,head,terminase	Pseudomonas_phage(11.76%)	30	NA	NA
WP_129556725.1|37205_37886_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	39.3	3.3e-37
WP_016210977.1|38064_38358_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_129556724.1|38575_38758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046773.1|38902_39082_-	phosphatase	NA	NA	NA	NA	NA
WP_129556723.1|39176_39494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126134.1|39794_40178_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	5.6e-26
WP_016212234.1|40265_40745_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_016212231.1|40748_40958_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	43.1	1.3e-08
WP_164997282.1|41012_41330_+	hypothetical protein	NA	A0A1P8DTK0	Proteus_phage	56.8	1.1e-19
WP_081377926.1|41348_42431_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	1.2e-89
WP_016211136.1|42427_43669_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	46.0	3.1e-86
WP_016211130.1|43631_44288_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.9	3.9e-43
WP_016211140.1|44345_45539_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_016211133.1|45659_46994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211131.1|47032_47188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211137.1|47184_47496_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_016211132.1|47492_47816_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211139.1|47808_48204_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211129.1|48200_48551_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211141.1|48550_48973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126913.1|48974_49298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|49354_49621_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_032126912.1|49624_51703_+	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	33.0	2.5e-56
WP_016210657.1|51695_52037_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_016210666.1|52033_52705_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|52673_53420_+	C40 family peptidase	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_016210665.1|53409_53967_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_016210662.1|53973_54261_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	2.5e-15
WP_016210670.1|54250_54505_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_016210653.1|54598_57886_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	33.5	5.2e-112
>prophage 1
NZ_CP038814	Piscirickettsia salmonis strain Psal-001 plasmid unnamed3, complete sequence	35123	3171	10881	35123	transposase,integrase	Caulobacter_phage(33.33%)	10	4777:4794	8766:8783
WP_016212329.1|3171_3762_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_032126737.1|3997_4726_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
4777:4794	attL	TTTTCGCAACAGTGCCGC	NA	NA	NA	NA
WP_032126738.1|4852_5125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|5117_5396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212425.1|5599_6190_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	34.4	1.1e-20
WP_032126150.1|6338_6572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|6670_7645_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212315.1|9297_9732_+	DUF29 domain-containing protein	NA	A0JC30	Ralstonia_phage	39.7	9.1e-25
8766:8783	attR	TTTTCGCAACAGTGCCGC	NA	NA	NA	NA
WP_032126346.1|9831_10074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126347.1|10140_10881_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	6.0e-08
>prophage 2
NZ_CP038814	Piscirickettsia salmonis strain Psal-001 plasmid unnamed3, complete sequence	35123	14076	21799	35123	transposase,integrase	unidentified_phage(33.33%)	10	7682:7741	21121:21312
7682:7741	attL	TTATTCCGGTGAGATTATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTA	NA	NA	NA	NA
WP_129556741.1|14076_14748_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.4	3.4e-10
WP_052133268.1|14769_15051_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	38.7	8.3e-11
WP_016212274.1|15123_15588_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_032126154.1|15598_15793_-	type II toxin-antitoxin system HicA family toxin	NA	A0A1X9I5T5	Streptococcus_phage	48.4	2.8e-10
WP_032126152.1|16008_16599_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.8	1.4e-20
WP_129556740.1|16662_17031_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155046774.1|17242_17419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300579.1|17637_18639_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	1.3e-26
WP_016211990.1|18968_21041_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_129556739.1|21070_21799_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
21121:21312	attR	TTATTCCGGTGAGATTATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTACCGTGATCTCAAAGAAATAGCAGCTGAAAGAGGTCTTGAGATTGAGCGTTCAACCATTTGTCGTTGGGTGCACGAGTATGGCTCGCAGATCGCCAAACGGCTGAGGCCCCACTTTCGTCAAACGTGTGCCTC	NA	NA	NA	NA
