The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	45566	89679	3131093	transposase	Moraxella_phage(16.67%)	46	NA	NA
WP_129556427.1|45566_46142_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46087_46453_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211193.1|46651_47413_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_016211195.1|47714_49241_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49612_50452_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50491_51799_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51773_52943_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|52997_53723_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54001_54391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54550_55456_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55531_55675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274979.1|55722_56562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375632.1|56554_56890_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_155046698.1|57068_57230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|57346_57640_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_016210704.1|58534_60481_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|61135_64198_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|64194_65259_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|65614_66568_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|66599_67763_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|67768_68368_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|68555_69056_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|69073_70162_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|70588_71833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|71829_72672_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_016211096.1|72651_73461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|73639_73867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|73867_74818_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|74873_75425_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|75551_75974_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|75966_76713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|76755_77454_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|77464_78289_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|78618_78987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274980.1|78981_80043_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|80092_80323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|80452_81667_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|81967_83029_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_016211249.1|83042_84770_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_016211245.1|84803_85535_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|85534_86323_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211251.1|86427_87051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|87370_87583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273383.1|87738_88311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046699.1|88515_89088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274981.1|89082_89679_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	136473	178470	3131093	transposase	Staphylococcus_phage(50.0%)	46	NA	NA
WP_054300271.1|136473_137448_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|137949_139362_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|139854_140862_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|140881_142402_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_129556430.1|142458_142665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211018.1|143640_144957_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|145060_145444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|145578_148644_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|148712_149816_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|149839_150394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|150508_151078_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211020.1|151197_151953_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_054300545.1|152119_153181_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_098082829.1|153575_153971_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|153992_154358_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|154414_154579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|154568_154868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|155120_155486_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|155431_156007_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212607.1|156007_156364_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|156452_157028_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|156973_157339_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|157818_158385_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|158396_159182_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|159813_160737_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|160788_161784_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|161815_162310_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_032126724.1|162401_162659_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|162748_163171_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|163489_164206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|164249_164501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556431.1|164514_165942_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|165969_167412_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|167499_167838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|167922_168453_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|168513_170706_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|170748_171234_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|171503_171935_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_016210245.1|171952_172783_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|172797_172941_-	lipoprotein	NA	NA	NA	NA	NA
WP_016210239.1|172971_173856_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|173827_174049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|174222_174501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|175471_176377_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016212383.1|176779_177898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|177894_178470_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	182276	239530	3131093	protease,transposase,tail,tRNA	Escherichia_phage(12.5%)	56	NA	NA
WP_075273327.1|182276_182852_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|182797_183163_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728339.1|183226_183499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212441.1|183766_183991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372761.1|185006_185456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|185519_186248_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016210779.1|186290_187220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210775.1|187512_188106_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_017377589.1|188074_188728_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016210784.1|188905_189877_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210782.1|189899_190796_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_016210786.1|190954_191401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210787.1|191397_192039_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016210789.1|192148_192727_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_016210776.1|193202_193640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047085.1|193964_195305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210785.1|195568_196963_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_075274986.1|198411_199479_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209863.1|199531_199954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209853.1|200194_200638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209873.1|200692_200950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209868.1|200927_201554_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_016209871.1|201631_203614_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|203823_205167_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|205433_208103_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|208126_210046_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|210215_211637_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|211782_212757_+	phospholipase A	NA	NA	NA	NA	NA
WP_016209855.1|212788_213184_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209859.1|213186_213408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|213571_215233_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|215305_215596_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_016209861.1|215821_216277_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|216341_216806_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|216898_218245_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|218244_219150_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|219211_220198_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|220190_220433_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|220554_222099_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_032126611.1|222145_223432_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|223474_224869_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|224892_225072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|225068_225644_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|225589_225955_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274988.1|226016_228251_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_016210079.1|228672_229170_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|229340_230036_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|230138_231701_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|232016_233810_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|233895_234168_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|234173_234800_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|234786_236217_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|236549_237605_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|237573_238251_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|238240_239077_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|239236_239530_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
>prophage 4
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	256927	301858	3131093	transposase,tRNA	Acinetobacter_phage(40.0%)	49	NA	NA
WP_075274991.1|256927_257503_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377888.1|257506_258067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556436.1|258122_259009_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046701.1|259035_259185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|259329_259530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|259577_260039_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|260462_261944_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|262006_263116_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|263213_265175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|265704_266109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|266161_267223_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046702.1|267348_267504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|270449_271602_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556437.1|271644_272067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049804.1|272336_273779_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_032126861.1|273982_274297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046703.1|274490_274628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|274631_275518_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212538.1|275689_276130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210630.1|276659_277775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664846.1|277713_278400_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_032126366.1|278393_279371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210638.1|279409_280573_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210640.1|281037_281262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|281647_281935_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_016210633.1|282109_282865_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556439.1|282870_283326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210637.1|283301_283778_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210636.1|283784_285362_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_032126367.1|285365_286130_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016210629.1|286183_286720_+	tim44-like domain protein	NA	NA	NA	NA	NA
WP_016210634.1|286716_287448_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_032126368.1|287556_288711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275120.1|288855_289167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664872.1|289490_290471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556440.1|290712_291321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211899.1|291663_291957_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_105962625.1|292053_292940_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046704.1|293551_293704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212296.1|293719_294448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126374.1|294556_295528_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664866.1|295559_295976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211609.1|296590_296899_+	double zinc ribbon family protein	NA	NA	NA	NA	NA
WP_032126373.1|296931_299118_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.0	2.7e-141
WP_016211605.1|299221_299455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211606.1|299671_300202_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_016211607.1|300230_300455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273369.1|300637_301453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300526.1|301561_301858_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	329433	374988	3131093	transposase	Hokovirus(33.33%)	46	NA	NA
WP_075273298.1|329433_330009_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210127.1|330061_331087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210128.1|331180_331444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|331810_332629_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|332701_335074_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_016210125.1|335786_337214_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|337248_338271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|338287_338665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126491.1|339022_339340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210122.1|339506_340199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|340825_341800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|341789_343562_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|343562_343910_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_032126493.1|344159_345386_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|345475_346774_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664834.1|346807_347167_-	VUT family protein	NA	NA	NA	NA	NA
WP_080664833.1|347212_347557_-	VUT family protein	NA	NA	NA	NA	NA
WP_016210137.1|347537_348089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664832.1|348315_349614_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|349730_350021_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_016212281.1|350332_351787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|351986_352562_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|352507_352873_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212359.1|353608_353827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|354194_355169_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212044.1|355707_355962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|356684_357671_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|357808_358003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664870.1|358685_359333_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_129556444.1|359325_359748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211797.1|359909_361313_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|361363_361939_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|361884_362199_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556445.1|362239_363126_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126227.1|363764_364055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212008.1|364092_364791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212010.1|364807_365104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212007.1|365227_366373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273619.1|366645_367221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211273.1|367278_368112_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	29.0	3.5e-17
WP_016211268.1|368227_369412_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211271.1|369430_370375_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016211269.1|370679_371465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211272.1|371582_371951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211270.1|372178_373756_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_054300173.1|373926_374988_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	447600	560105	3131093	protease,transposase,tRNA	Escherichia_phage(28.57%)	108	NA	NA
WP_075275004.1|447600_448464_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|448680_450240_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|450261_451296_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|451344_451914_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|452049_453021_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|453032_454610_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|454675_455662_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016210646.1|455993_457103_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|457208_458393_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|458470_460459_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|460667_460823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300511.1|461080_461380_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_075275005.1|461538_461874_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|462790_464197_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|464214_465201_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|465203_466358_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|466354_467050_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|467184_468675_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210494.1|468695_469745_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|469811_471206_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210489.1|472084_474016_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_075273353.1|474020_474551_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|474585_474780_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|474822_475182_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|475601_476597_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_032126132.1|476609_478991_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|478996_479284_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|479555_480032_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|480176_480374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|480498_481473_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|483581_483680_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210477.1|484164_485454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126626.1|485690_486383_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|486424_487198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|487199_488141_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|488273_489851_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|490060_491818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|492366_493125_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|493332_493905_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|494008_494557_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|494858_495104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|495132_495429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941726.1|495696_496620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556451.1|497098_497356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275008.1|497419_498148_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	3.3e-43
WP_155062496.1|498136_498304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155062498.1|498228_498699_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_054300500.1|499108_499837_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_054300501.1|500185_500914_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|500925_501318_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|501314_501560_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300307.1|502663_503392_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_054300307.1|503998_504727_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_016212268.1|505371_505956_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_016212269.1|505959_506643_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|506925_507654_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_052104629.1|507990_509016_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212159.1|509159_509357_-	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_016212158.1|509624_510539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275019.1|510648_511353_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	9.2e-43
WP_105962625.1|511316_512203_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211714.1|512577_515922_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_144019196.1|515954_516611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300201.1|516666_517395_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_032126534.1|517909_518425_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212084.1|518424_519441_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_075274955.1|519722_520697_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212327.1|522082_522868_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075274956.1|522928_523297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|523339_524314_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016210580.1|524389_524650_-	methyltransferase	NA	NA	NA	NA	NA
WP_016210574.1|524790_525210_+	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_032126277.1|525297_525888_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210572.1|526110_527868_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126278.1|527989_528973_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_032126275.1|529053_529605_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126276.1|529615_530983_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126279.1|531133_531373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210582.1|531431_532175_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_016210581.1|532174_532819_+	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210578.1|532815_534480_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	7.1e-33
WP_016210576.1|534507_534843_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_016210570.1|534973_536572_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210577.1|536637_536928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|536942_537398_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273456.1|537357_537657_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556663.1|538034_538400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210376.1|538462_540943_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_016210384.1|541026_541506_+	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_129556597.1|541502_542519_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080664840.1|542455_543172_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|543184_543520_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|543556_544027_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210378.1|544069_545905_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_032126285.1|545949_547038_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_016210372.1|547059_548121_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_016210373.1|548199_548715_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210380.1|548755_550033_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210370.1|550047_550899_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_032126283.1|550927_551575_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_129556596.1|551562_552531_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126284.1|552622_553333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212036.1|553777_554626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|554677_555589_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_129556595.1|557360_557777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377902.1|557921_558449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300185.1|558635_558998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274953.1|559241_560105_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	585094	636239	3131093	transposase,tRNA	Staphylococcus_phage(37.5%)	52	NA	NA
WP_075273298.1|585094_585670_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377880.1|585615_586095_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210761.1|586732_587470_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_016210755.1|587573_588302_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_016210763.1|588405_589650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210764.1|589958_590219_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_016210758.1|590392_591931_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_051307336.1|592088_593015_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	9.4e-11
WP_016210756.1|593153_595967_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A167RAL2	Powai_lake_megavirus	26.5	1.3e-76
WP_032126291.1|595959_596469_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_016210766.1|596472_596916_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_129556593.1|597004_597646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|597642_598218_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|598163_598529_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211782.1|598590_598773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126294.1|599372_600650_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211783.1|600930_601296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211784.1|601287_602010_-	aquaporin family protein	NA	M1HH19	Acanthocystis_turfacea_Chlorella_virus	35.8	1.6e-26
WP_075274951.1|602563_603448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|603444_604419_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016210171.1|604976_606536_+	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	50.4	5.8e-37
WP_016210175.1|606849_607179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210177.1|607564_607930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126297.1|608054_608915_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_016210164.1|608901_609681_+	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_016210168.1|609756_610440_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556592.1|610600_611131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210179.1|611421_611925_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_016210161.1|612125_612380_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210178.1|612881_613349_+	DoxX family protein	NA	NA	NA	NA	NA
WP_016210163.1|613438_613969_-	ferric uptake regulator family protein	NA	NA	NA	NA	NA
WP_016210172.1|613968_614493_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	59.6	6.9e-51
WP_016210170.1|614655_615771_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210174.1|616007_617168_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	8.2e-121
WP_016210183.1|617618_619622_+	transketolase	NA	NA	NA	NA	NA
WP_016210176.1|619690_620698_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210181.1|620771_621956_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_032126295.1|621965_623420_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_016210162.1|623450_624488_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_105962625.1|625172_626059_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212028.1|626146_626395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212027.1|626889_628113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126299.1|628135_628357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|628607_629582_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211964.1|629640_629961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|630073_630724_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211963.1|630825_631485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211962.1|632033_632549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212030.1|632846_633092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|633183_633846_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212032.1|633969_635097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|635353_636239_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	644326	678766	3131093	transposase,tRNA	Catovirus(20.0%)	36	NA	NA
WP_016210986.1|644326_645865_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	1.3e-86
WP_075273313.1|645922_646261_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377882.1|646220_646502_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377881.1|646508_646676_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377817.1|647592_648090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556591.1|648313_648970_+	porin family protein	NA	NA	NA	NA	NA
WP_032126306.1|649074_649371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274949.1|649595_650657_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046752.1|650634_651372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|651410_651839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210814.1|652188_652386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210817.1|652628_653261_-	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210815.1|653680_654631_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210821.1|654627_656160_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_017377821.1|656156_656687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210823.1|657021_657660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|658109_658814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210818.1|659105_659330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210820.1|659833_660775_-	DMT family transporter	NA	NA	NA	NA	NA
WP_129556549.1|660976_661862_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210940.1|661970_663158_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	6.4e-20
WP_016210937.1|663249_663531_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126309.1|663616_664294_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_032126310.1|664340_665600_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_016210941.1|665797_666847_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_016210931.1|666925_667732_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210936.1|667769_668564_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210944.1|668665_669685_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210942.1|669731_670343_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210943.1|670346_671033_+	acireductone synthase	NA	NA	NA	NA	NA
WP_016210935.1|671029_671572_+	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016211759.1|673384_674572_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_016211756.1|674817_675543_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_032126312.1|675721_676516_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_129556590.1|676512_676908_-	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_054300282.1|678301_678766_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	707406	821686	3131093	protease,transposase,integrase,tRNA	Escherichia_phage(36.59%)	110	724020:724079	730248:730535
WP_016210052.1|707406_708603_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
WP_032126425.1|708623_709220_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210066.1|709663_710332_-|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_016210076.1|710473_711775_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210073.1|712031_712763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210051.1|713187_713592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210069.1|713832_714915_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.6e-20
WP_016210054.1|714899_715421_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210050.1|715485_716361_+	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_016210068.1|716436_717012_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_155046750.1|718198_718336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|719580_720486_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211874.1|720529_722248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|722566_723646_-	hypothetical protein	NA	NA	NA	NA	NA
724020:724079	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_016212522.1|724190_724445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300489.1|724541_725144_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_129556589.1|725146_725422_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032126389.1|726823_727012_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212230.1|728545_729994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377879.1|730049_730274_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_075274946.1|730495_730939_+	hypothetical protein	NA	NA	NA	NA	NA
730248:730535	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACG	NA	NA	NA	NA
WP_016212294.1|730952_731297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046748.1|731648_731954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212659.1|732041_732287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212568.1|732431_732581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274945.1|732805_733156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211326.1|733300_734041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211324.1|734537_735092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211322.1|735627_736218_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211325.1|736280_737801_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	7.3e-85
WP_016211323.1|737790_738888_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	1.0e-27
WP_016211321.1|739061_740222_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211722.1|740602_743905_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	1.7e-54
WP_032126817.1|743914_744736_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_075274944.1|745092_745809_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
WP_129556588.1|745753_745921_+	phosphatase	NA	NA	NA	NA	NA
WP_075274943.1|746111_746636_-	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_087910645.1|746921_748074_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_032127022.1|748136_750323_-	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_075274942.1|750999_751728_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.1	2.7e-45
WP_016212339.1|751746_752493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275114.1|752645_753008_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274941.1|753037_753766_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.2e-42
WP_016211996.1|754149_755097_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211997.1|755098_756208_-	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	24.5	4.4e-07
WP_075274940.1|756563_757244_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	2.0e-42
WP_087910645.1|757271_758425_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274939.1|758537_759266_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.8e-42
WP_016212238.1|759295_760585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212264.1|761100_761694_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	5.4e-28
WP_016212263.1|761739_762333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664881.1|762495_762702_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300481.1|762791_763520_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_129556661.1|763508_764072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210616.1|764372_767183_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_016210625.1|767431_768178_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_129556587.1|768236_769139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307334.1|769182_769962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210618.1|770228_771278_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_016210617.1|771342_772767_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_075274938.1|772930_773437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210624.1|773455_773695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210615.1|773740_774211_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016211056.1|776586_777339_-	ComF family protein	NA	NA	NA	NA	NA
WP_016211049.1|777382_778345_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211052.1|778344_779598_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211045.1|779628_780402_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211044.1|780382_781243_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_016211050.1|781311_782019_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211051.1|781981_782485_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211047.1|782846_784481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049878.1|784559_785135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|785177_785906_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_036780855.1|786671_787169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049879.1|787143_787545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|787513_788242_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211625.1|788725_789595_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_016211621.1|789591_790941_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	4.6e-75
WP_016211623.1|791053_792694_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_016211987.1|794515_796252_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_129556671.1|796755_797484_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_098082825.1|797547_797856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|797848_798181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|798184_798754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211655.1|798882_799296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211652.1|799555_800761_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211653.1|800868_801894_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_054300202.1|801985_802714_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300202.1|803144_803873_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212196.1|804281_804527_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_016212195.1|804523_804910_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212193.1|804977_805316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274934.1|805438_806107_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.0	2.8e-41
WP_016211949.1|806594_807845_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_016211951.1|807878_808976_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_075274933.1|809592_810321_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_075274932.1|810629_810851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|811072_812686_-	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_016211816.1|812727_813081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126570.1|813093_813393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|814150_814879_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_075274930.1|814908_815328_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210945.1|816138_816729_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_016210946.1|816855_818241_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210947.1|818335_818533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126573.1|818626_819445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|819951_820329_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016210948.1|820341_820578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210951.1|820577_820784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210956.1|820966_821686_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	904100	956160	3131093	transposase,tRNA	Agrobacterium_phage(12.5%)	44	NA	NA
WP_081007050.1|904100_904628_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|904684_905050_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211061.1|905111_905465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211058.1|905585_906119_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_032126660.1|906257_907895_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.2	5.8e-88
WP_016211065.1|907899_908121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211066.1|908218_909232_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_016211063.1|909394_911623_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.0	1.0e-82
WP_032126658.1|911603_912308_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|912542_912872_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_054300173.1|913952_915014_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126663.1|915040_915283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126664.1|916001_916685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212048.1|916878_917436_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_075274927.1|918199_919261_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664847.1|919333_920287_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_016210879.1|923620_923980_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210871.1|923976_924294_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210872.1|924310_925420_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210882.1|925446_926532_-	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210874.1|926654_927695_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210873.1|927709_928360_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210876.1|928427_929270_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016212197.1|929735_930653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|931671_931866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036794860.1|931942_932236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|932503_933421_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_016211373.1|933972_934119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211374.1|934173_935364_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211370.1|935496_935940_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211369.1|935982_937026_-	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211368.1|937072_938464_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211371.1|938660_939584_+	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211372.1|939570_940428_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016212287.1|946524_947670_-|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_054300173.1|947748_948810_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211408.1|949033_950380_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_016211412.1|950494_951487_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_016211411.1|951490_951988_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_016211407.1|951984_952824_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_051307356.1|952856_954389_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_032126774.1|954548_954884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|955039_955312_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|955323_956160_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
>prophage 11
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	1018072	1099680	3131093	transposase,tRNA	Staphylococcus_phage(35.29%)	83	NA	NA
WP_016211428.1|1018072_1020136_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.8	3.8e-36
WP_054300237.1|1020406_1021468_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556651.1|1021709_1022918_+	MFS transporter	NA	NA	NA	NA	NA
WP_075274925.1|1023105_1024167_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212285.1|1024214_1025693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1025742_1026804_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210196.1|1026761_1027115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210185.1|1027468_1029679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210188.1|1029679_1030366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210198.1|1030677_1031229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210195.1|1031245_1031647_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_016210190.1|1031837_1032713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126472.1|1032932_1033583_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_016210202.1|1034045_1036634_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.8	9.7e-122
WP_016210199.1|1036739_1037501_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_016210206.1|1037497_1038034_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	38.4	8.4e-20
WP_016210205.1|1038082_1039039_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.6	5.3e-49
WP_016210187.1|1039119_1042305_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_016210201.1|1042308_1043364_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	3.4e-49
WP_129556570.1|1043575_1044193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210186.1|1044236_1044899_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_016210194.1|1044933_1045281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210193.1|1045337_1045499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126473.1|1045479_1045662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210192.1|1045870_1046389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1046701_1047067_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1047012_1047588_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556569.1|1047577_1047787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211502.1|1048201_1049245_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_016211508.1|1049274_1049619_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211503.1|1049673_1050129_+	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_075274922.1|1050139_1050436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274921.1|1050413_1050512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211506.1|1050504_1051146_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|1051142_1051859_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211507.1|1051862_1053182_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_054300271.1|1053495_1054470_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212450.1|1054513_1055416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1055571_1055937_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1055882_1056458_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1056471_1056762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1056707_1057283_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556568.1|1057319_1058801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|1058990_1060052_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211004.1|1060464_1063101_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_080664849.1|1063149_1064238_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016210997.1|1064237_1064921_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_016210998.1|1066795_1067050_+	LapA family protein	NA	NA	NA	NA	NA
WP_016211001.1|1067127_1067433_+	competence protein ComEA	NA	NA	NA	NA	NA
WP_016211002.1|1067596_1067995_+	VOC family protein	NA	NA	NA	NA	NA
WP_051307345.1|1068028_1068715_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211000.1|1068858_1069644_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_075274920.1|1069739_1070474_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	4.8e-10
WP_016210826.1|1071904_1072771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210824.1|1072880_1074560_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210830.1|1074686_1075937_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_032126465.1|1076012_1076474_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210835.1|1076470_1077619_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_016210836.1|1077624_1078299_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_052133275.1|1078328_1078952_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210828.1|1079067_1079541_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_016210832.1|1079542_1079965_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210829.1|1079951_1080971_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210831.1|1081240_1081786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|1081880_1082942_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212318.1|1083470_1083902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|1083903_1084230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212319.1|1084216_1084444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|1085002_1086448_-	MFS transporter	NA	NA	NA	NA	NA
WP_016212205.1|1086587_1086767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274918.1|1087450_1087816_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1087761_1088337_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212174.1|1089411_1089669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212177.1|1089745_1089919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|1090914_1091976_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|1091933_1092182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300443.1|1092234_1092513_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211538.1|1092751_1093675_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_016211536.1|1094369_1094603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211535.1|1094678_1096466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923739.1|1096677_1098186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212614.1|1098330_1098537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1098705_1099680_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 12
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	1120350	1247699	3131093	protease,transposase,tRNA	Staphylococcus_phage(17.65%)	119	NA	NA
WP_054300271.1|1120350_1121325_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212492.1|1121374_1122229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210459.1|1122433_1122952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210458.1|1126026_1126575_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_016210461.1|1126655_1126931_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_032126596.1|1126930_1127983_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_016210464.1|1128091_1130029_-	AsmA family protein	NA	NA	NA	NA	NA
WP_075275113.1|1130179_1131889_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_016210468.1|1131957_1132677_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_016210467.1|1132673_1133276_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210471.1|1133390_1134278_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|1134468_1134816_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210465.1|1134866_1135709_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_129556566.1|1136216_1136420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372565.1|1136328_1136700_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274914.1|1136748_1137624_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032126686.1|1138174_1138759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556565.1|1140228_1140624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273603.1|1140747_1140924_-	phosphatase	NA	NA	NA	NA	NA
WP_129556564.1|1142080_1142410_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046744.1|1143579_1143753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|1143809_1144175_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126745.1|1144246_1144849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122940402.1|1145057_1145681_+	porin family protein	NA	NA	NA	NA	NA
WP_016209896.1|1145995_1146565_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016209891.1|1146711_1147410_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_036777115.1|1147551_1147752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209884.1|1147828_1148452_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_016209882.1|1148561_1149455_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_016209898.1|1149561_1151172_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_016209888.1|1151168_1152464_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_016209876.1|1152485_1154408_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_016209881.1|1154518_1154821_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_016209893.1|1154913_1159803_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_016209883.1|1159857_1161174_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	9.4e-65
WP_129556563.1|1161292_1162393_+	FUSC family protein	NA	NA	NA	NA	NA
WP_016209878.1|1162444_1163383_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	29.6	1.9e-14
WP_080664826.1|1163463_1164063_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016209877.1|1164251_1165142_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_016209887.1|1165344_1165836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209894.1|1165979_1166471_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1166639_1167353_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556650.1|1167781_1168756_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209897.1|1169076_1169319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1169340_1169706_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1169651_1170227_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211960.1|1170470_1170998_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_129556649.1|1171537_1172395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|1172422_1173004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|1173573_1173759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556562.1|1173903_1174206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1174165_1174504_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211968.1|1174629_1175034_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1175046_1175187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126649.1|1175283_1176480_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_016211971.1|1176500_1177112_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_129556561.1|1177317_1178471_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	2.6e-58
WP_032126362.1|1178641_1179007_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1178952_1179528_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274909.1|1179626_1179953_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1180336_1180501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1180490_1180790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728345.1|1180830_1181439_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032126790.1|1181629_1182535_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_129556560.1|1182504_1183041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556559.1|1183121_1183550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212093.1|1183706_1184636_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_075273313.1|1184848_1185187_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377876.1|1185146_1185602_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212654.1|1185593_1185878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212100.1|1186288_1187209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212098.1|1187209_1188061_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1188768_1189815_+	glutathione synthase	NA	NA	NA	NA	NA
WP_032126840.1|1189798_1191796_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_122941967.1|1191974_1192280_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|1192509_1192716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|1192976_1193678_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211519.1|1193678_1194098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307348.1|1195253_1198010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211092.1|1198245_1199538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211091.1|1199581_1202062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211094.1|1203126_1203450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1203469_1204444_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211036.1|1204791_1206663_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_016211039.1|1206754_1208500_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211043.1|1208579_1209029_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211035.1|1209081_1209297_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211042.1|1209543_1210560_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211037.1|1210608_1211238_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211040.1|1211588_1212800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126170.1|1213027_1213300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556558.1|1213463_1214357_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556557.1|1214501_1214813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212394.1|1214860_1215565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211450.1|1216586_1217609_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211448.1|1217707_1218916_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211446.1|1218905_1220633_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_129556648.1|1220816_1221788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1222201_1223263_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126397.1|1223611_1224202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210561.1|1224316_1225651_-	dihydroorotase	NA	NA	NA	NA	NA
WP_016210568.1|1225778_1226420_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_016210566.1|1226725_1227148_+	universal stress protein	NA	NA	NA	NA	NA
WP_016210559.1|1227508_1228471_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_016210564.1|1228467_1228929_+	amidohydrolase	NA	NA	NA	NA	NA
WP_016210557.1|1228931_1229684_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_016210560.1|1229772_1231473_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_016210562.1|1233040_1234693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210558.1|1234766_1235522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|1237158_1237524_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211932.1|1237934_1239224_-	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_016211931.1|1239419_1240607_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211476.1|1240924_1241134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211473.1|1241117_1241717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211474.1|1241791_1243141_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_032126518.1|1243223_1245425_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211478.1|1245441_1246257_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126519.1|1246236_1246956_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_129556556.1|1247123_1247699_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	1290419	1418685	3131093	protease,transposase,integrase,tRNA	Bacillus_phage(12.5%)	118	1356104:1356163	1424642:1425871
WP_016209434.1|1290419_1291841_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016209437.1|1291871_1292393_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	2.0e-10
WP_016209438.1|1292389_1292989_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_016209440.1|1293066_1294077_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.9	1.5e-06
WP_016209415.1|1294189_1294894_+	protein TolQ	NA	NA	NA	NA	NA
WP_016209407.1|1294930_1295362_+	protein TolR	NA	NA	NA	NA	NA
WP_016209428.1|1295364_1296459_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_129556552.1|1296494_1297862_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_016209425.1|1297897_1298539_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032126507.1|1298581_1299511_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_016209451.1|1299513_1300161_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	37.9	1.2e-36
WP_032126506.1|1300211_1301015_-	AAA family ATPase	NA	A0A0E3G5H5	Synechococcus_phage	43.1	8.9e-42
WP_016209417.1|1301196_1301409_+	SlyX family protein	NA	NA	NA	NA	NA
WP_016209423.1|1301412_1301646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209422.1|1301707_1303288_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_016209426.1|1303489_1304419_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.3	1.6e-13
WP_016209420.1|1304420_1305188_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_032126509.1|1305592_1306309_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_016209442.1|1306346_1306709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209432.1|1306880_1308590_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016209448.1|1308847_1310179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209449.1|1310620_1312093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1312266_1313241_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300152.1|1313914_1314280_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274897.1|1314520_1315387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273512.1|1315899_1316244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210519.1|1316233_1317001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210521.1|1317236_1319174_-	his Kinase A domain protein	NA	NA	NA	NA	NA
WP_016210517.1|1320187_1320907_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_032126504.1|1321020_1324560_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_016210525.1|1324626_1325445_+	ZipA protein	NA	NA	NA	NA	NA
WP_016210518.1|1325431_1327471_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.8	3.0e-126
WP_016210522.1|1327486_1328539_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_016210524.1|1328549_1329080_+	exsB family protein	NA	NA	NA	NA	NA
WP_129556549.1|1329618_1330504_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210010.1|1333174_1333351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210017.1|1333526_1333910_+	hpt domain protein	NA	NA	NA	NA	NA
WP_075273518.1|1333985_1334279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210016.1|1334445_1335405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210020.1|1336005_1336161_+	putative membrane protein	NA	NA	NA	NA	NA
WP_016210025.1|1336425_1337796_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210009.1|1337788_1337995_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016210012.1|1338070_1338742_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210005.1|1338722_1341527_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	2.4e-57
WP_016210027.1|1341606_1342203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|1342592_1343348_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210004.1|1343547_1344189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210021.1|1344449_1345775_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210023.1|1345771_1347829_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210007.1|1347806_1348379_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126616.1|1348434_1348794_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210019.1|1348858_1349893_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_122941592.1|1350150_1351002_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|1351096_1352080_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_016210013.1|1352236_1353904_+	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
WP_032126790.1|1354089_1354995_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211421.1|1355091_1355316_+	hypothetical protein	NA	NA	NA	NA	NA
1356104:1356163	attL	GGTAACCCTCCCTTAAAATGAGACAACTCATAACTGGAATCTTCTGTTAACATTTTCAAA	NA	NA	NA	NA
WP_032126239.1|1356174_1356447_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1356458_1357295_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075274733.1|1357345_1357663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1357681_1358257_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1358202_1358568_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300287.1|1358589_1358919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556547.1|1359327_1359888_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_129556546.1|1360313_1361500_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	5.9e-58
WP_081377874.1|1361960_1362428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1362596_1362854_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274890.1|1362923_1363604_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_129556545.1|1363808_1364150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212209.1|1364404_1365406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1365861_1366161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|1366150_1366315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1366472_1366811_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1366770_1367226_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075274888.1|1367230_1367566_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274886.1|1367837_1368899_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211279.1|1369642_1372111_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_016211277.1|1372124_1373093_+	homoserine kinase	NA	NA	NA	NA	NA
WP_016211278.1|1373079_1374339_+	threonine synthase	NA	NA	NA	NA	NA
WP_129556646.1|1374390_1375776_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300295.1|1376586_1376811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126750.1|1377091_1377889_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016211170.1|1378047_1378218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211167.1|1378849_1379971_+	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	1.5e-10
WP_016211172.1|1380020_1381217_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_080664856.1|1381405_1382470_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_051307350.1|1382453_1383200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211165.1|1383189_1383918_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211168.1|1383914_1384574_+	wbqC-like family protein	NA	NA	NA	NA	NA
WP_016211169.1|1384557_1385505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|1385504_1386020_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211164.1|1386062_1386440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210396.1|1386577_1386766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210391.1|1386833_1387784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210393.1|1387877_1390079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210398.1|1390279_1391872_+	B-type flagellin	NA	NA	NA	NA	NA
WP_032126669.1|1392096_1393674_+	B-type flagellin	NA	NA	NA	NA	NA
WP_122940572.1|1393792_1394218_+	flaG family protein	NA	NA	NA	NA	NA
WP_016210394.1|1394328_1395714_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_032126670.1|1395739_1396177_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210390.1|1396181_1396523_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_016210399.1|1396537_1398529_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210388.1|1398554_1399229_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210397.1|1399225_1401400_-	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_054300550.1|1401589_1401955_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1402011_1402176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1402165_1402465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210772.1|1402597_1404151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|1404234_1405044_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_033923762.1|1405171_1405405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210769.1|1405705_1407208_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_016210773.1|1407511_1410205_+	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210771.1|1410201_1413603_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_054300162.1|1413694_1414777_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_129556544.1|1414839_1415196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274882.1|1415310_1415907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212246.1|1416842_1417499_+	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300162.1|1417602_1418685_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
1424642:1425871	attR	TTTGAAAATGTTAACAGAAGATTCCAGTTATGAGTTGTCTCATTTTAAGGGAGGGTTACCTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCGAAGTATCAGCCATGATAAAGTCACACGCTTTTTAAATAAAAACCACTTTGGATCAAAAGAGCTCTGGAGCTATGTTAAAAAGCATGTTCGTCAGTATGAAGAAGAAGTTGGAGGCGTTTTAAGTCTGGATGATACCGTGGAAGAAAAGCCTTATACAGATGAGAATGATGTGGTTTGTTGGCATTATTCACACAGCAAAAGCGCTCATGTAAAGGGAATTAATATTTTGACAAGTATGGTGACTTACAAG	NA	NA	NA	NA
>prophage 14
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	1421747	1522198	3131093	transposase,integrase	Leptospira_phage(15.38%)	104	1493193:1493252	1522965:1523255
WP_036779544.1|1421747_1422755_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1422754_1423012_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1423509_1424346_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1424357_1424630_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274880.1|1425625_1426591_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212058.1|1426746_1428297_+	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_081377873.1|1428939_1429776_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.9	4.6e-41
WP_032126239.1|1429787_1430060_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556543.1|1430151_1430634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209453.1|1430743_1430893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209496.1|1431060_1431273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664817.1|1431302_1432076_+	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209485.1|1432100_1433123_+	chorismate mutase	NA	NA	NA	NA	NA
WP_032126728.1|1433175_1434480_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_052133284.1|1434470_1435037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209460.1|1435026_1436109_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.1	1.0e-72
WP_016209465.1|1436155_1437256_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_016209488.1|1437296_1437785_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_052047096.1|1437934_1438624_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016209481.1|1438826_1439153_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_016209480.1|1439202_1439430_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_016209484.1|1439441_1439894_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209475.1|1440103_1441525_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	1.7e-152
WP_016209491.1|1441557_1442655_+	alanine racemase	NA	NA	NA	NA	NA
WP_016209456.1|1442679_1443411_-	mannosyl-glycoendo-beta-N-acetylglucosaminidase family protein	NA	M1IDP9	Pelagibacter_phage	35.8	5.3e-09
WP_016209472.1|1443524_1444895_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_032126730.1|1444997_1445486_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_016209463.1|1445840_1446224_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_016209490.1|1446650_1446974_+	YqcC family protein	NA	NA	NA	NA	NA
WP_129556645.1|1447064_1449014_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_016209478.1|1449105_1450059_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209459.1|1450222_1451389_-	rasGEF domain protein	NA	NA	NA	NA	NA
WP_075273528.1|1451648_1452614_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_016209455.1|1452794_1453841_+	membrane protein	NA	NA	NA	NA	NA
WP_016209467.1|1453833_1454859_+	FUSC family protein	NA	NA	NA	NA	NA
WP_016209494.1|1454928_1456953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664818.1|1457634_1457970_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016209474.1|1458111_1458522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209462.1|1458531_1458675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209471.1|1458684_1459011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664819.1|1459157_1460195_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_016209486.1|1460236_1460488_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_129556541.1|1460612_1460927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209458.1|1460934_1462509_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_016209457.1|1462652_1463234_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_016209482.1|1463533_1465336_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	39.2	5.1e-21
WP_129556644.1|1465386_1466274_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209466.1|1466679_1467354_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	34.5	8.9e-27
WP_016209492.1|1467359_1468259_+	GTPase Era	NA	NA	NA	NA	NA
WP_016209497.1|1468272_1469016_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_016209489.1|1469018_1469750_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_016209473.1|1469746_1470130_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_016212202.1|1471091_1472339_-	glutaminase	NA	NA	NA	NA	NA
WP_075274878.1|1472750_1473626_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211947.1|1474028_1475174_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_129556540.1|1475166_1475562_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211946.1|1475780_1476536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1477756_1478122_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1478067_1478643_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1478656_1478947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|1478892_1479468_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212551.1|1479809_1480304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556643.1|1480761_1482126_-	histidine kinase	NA	NA	NA	NA	NA
WP_016211983.1|1482221_1482881_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556539.1|1483128_1483473_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300307.1|1483541_1484270_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_075274875.1|1484316_1484619_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211212.1|1484901_1486461_-	APC family permease	NA	NA	NA	NA	NA
WP_016211215.1|1486821_1488792_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211211.1|1488983_1490063_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211213.1|1490111_1490318_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211210.1|1490324_1491806_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016211214.1|1491908_1492472_-	hypothetical protein	NA	NA	NA	NA	NA
1493193:1493252	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_016211942.1|1494234_1495494_+	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211940.1|1495614_1495947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1496060_1497035_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016211341.1|1497179_1497350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211343.1|1497548_1498571_+	YHYH protein	NA	NA	NA	NA	NA
WP_016211342.1|1498578_1500261_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.1e-32
WP_016211344.1|1500421_1501240_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211347.1|1501453_1502437_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211340.1|1502429_1502651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211346.1|1502678_1503320_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_105962625.1|1504469_1505355_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1505359_1505647_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_036774554.1|1505699_1505978_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126998.1|1506076_1506424_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_032126997.1|1506745_1506985_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075273532.1|1507202_1507790_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300314.1|1507750_1508086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211315.1|1508273_1508918_-	porin family protein	NA	NA	NA	NA	NA
WP_016211316.1|1509252_1509903_-	porin family protein	NA	NA	NA	NA	NA
WP_016211319.1|1510435_1511488_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032126786.1|1511505_1514586_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_075274874.1|1514884_1515253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1515253_1515829_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1515774_1516140_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274873.1|1516161_1516659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274872.1|1517133_1517673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556536.1|1517632_1518785_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_081377871.1|1518788_1519481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1519685_1519943_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556535.1|1520132_1521019_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377829.1|1521463_1522198_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
1522965:1523255	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTTT	NA	NA	NA	NA
>prophage 15
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	1551820	1614512	3131093	transposase,tRNA	Bacillus_thuringiensis_phage(14.29%)	55	NA	NA
WP_016209621.1|1551820_1552825_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209619.1|1553257_1554706_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209620.1|1554792_1557849_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_080664820.1|1557831_1558002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556532.1|1558310_1558493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212485.1|1558789_1559323_-	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_075273327.1|1560075_1560651_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1560596_1560962_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126753.1|1561054_1561519_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_016211466.1|1561588_1563109_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126752.1|1563196_1563799_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211464.1|1563795_1564143_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_016211465.1|1564293_1565277_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_016211462.1|1565904_1566885_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_052047087.1|1567045_1567264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274864.1|1567435_1568461_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212346.1|1571301_1571448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1571681_1572545_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211749.1|1572753_1573947_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211748.1|1574026_1575631_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211752.1|1575646_1576792_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_129556531.1|1576996_1577194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1577156_1577495_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1577454_1577910_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_081007023.1|1578084_1578741_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016212534.1|1578817_1579084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211725.1|1580654_1581569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211728.1|1581607_1583542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211726.1|1583929_1584523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274862.1|1584694_1585291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046732.1|1585405_1585576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300325.1|1585769_1586042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211456.1|1586663_1587242_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_122942091.1|1587269_1587665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211455.1|1587770_1589228_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_016211452.1|1589289_1590777_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211454.1|1591527_1591998_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1592138_1592714_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1592659_1593025_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556641.1|1596899_1598162_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_016210751.1|1598249_1600055_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_016210752.1|1600538_1601336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210749.1|1601505_1601967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1602265_1604221_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1604900_1605086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212185.1|1605419_1606409_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_075273327.1|1606502_1607078_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1607023_1607389_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080664871.1|1607820_1609443_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.9	1.9e-27
WP_016211834.1|1609533_1609848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307365.1|1610104_1610365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211836.1|1610384_1610873_+	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_129556528.1|1612396_1612825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1613246_1613504_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047040.1|1613573_1614512_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	1624820	1669039	3131093	transposase	Staphylococcus_phage(42.86%)	45	NA	NA
WP_081007004.1|1624820_1625276_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1625235_1625574_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211352.1|1625747_1626188_-	universal stress protein	NA	NA	NA	NA	NA
WP_016211350.1|1626866_1627805_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211349.1|1627868_1629863_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_032127067.1|1629859_1630462_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211351.1|1630458_1630797_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_129556640.1|1630872_1632099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1632365_1633340_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211856.1|1633555_1633741_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_016211855.1|1633867_1634335_+	bacterioferritin	NA	NA	NA	NA	NA
WP_016211857.1|1634331_1635210_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_032126602.1|1635460_1636768_+	MFS transporter	NA	NA	NA	NA	NA
WP_081007004.1|1636920_1637376_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1637335_1637674_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|1638635_1639541_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211738.1|1639611_1640256_+	membrane protein	NA	NA	NA	NA	NA
WP_016211741.1|1640732_1641509_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126783.1|1641654_1642896_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_155046971.1|1643006_1643552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211736.1|1643629_1643830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274822.1|1643853_1644828_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_129556526.1|1644886_1645672_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.8	1.3e-45
WP_016212445.1|1645668_1645935_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016211177.1|1646149_1647370_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126450.1|1647737_1649732_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211185.1|1649844_1650453_-	smr domain protein	NA	NA	NA	NA	NA
WP_032126449.1|1650519_1651443_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016211180.1|1651463_1651928_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_016211178.1|1651990_1653019_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_032126448.1|1653109_1653490_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_016211182.1|1653521_1653851_+	DUF4404 family protein	NA	NA	NA	NA	NA
WP_016212475.1|1654835_1655042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1655239_1656214_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556525.1|1656289_1657110_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210855.1|1657263_1658241_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016210849.1|1658358_1659807_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210847.1|1659835_1660840_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210851.1|1660862_1661534_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210850.1|1661518_1662772_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1663020_1663575_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210848.1|1663870_1665055_+	MFS transporter	NA	NA	NA	NA	NA
WP_051307341.1|1665221_1666820_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_081007030.1|1667513_1668485_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377870.1|1668520_1669039_+|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	31.0	1.6e-07
>prophage 17
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	1697065	1735907	3131093	transposase,tRNA	Staphylococcus_phage(20.0%)	31	NA	NA
WP_129556523.1|1697065_1697952_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274822.1|1698287_1699262_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_054300148.1|1699359_1700421_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1700975_1701950_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273327.1|1702640_1703216_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1703161_1703527_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274858.1|1703663_1704749_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274857.1|1706328_1707204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126678.1|1707214_1708225_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_016211554.1|1708551_1709178_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_016211557.1|1709223_1710453_+	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_032126677.1|1710647_1711211_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211555.1|1711285_1712644_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_016211664.1|1713180_1713909_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211666.1|1714281_1717101_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211669.1|1717255_1717606_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556522.1|1720714_1721947_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211405.1|1722153_1723926_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_016211403.1|1724061_1725105_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_016211399.1|1725118_1725862_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016211398.1|1726008_1726296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|1726900_1727599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211734.1|1728020_1728290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211731.1|1728305_1729412_+	protein kinase	NA	NA	NA	NA	NA
WP_016211733.1|1729467_1730292_-	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_075274856.1|1732047_1733073_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046730.1|1733291_1733432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1733699_1734347_-	LysE family translocator	NA	NA	NA	NA	NA
WP_016212267.1|1734627_1734987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|1735153_1735609_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273804.1|1735568_1735907_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	1746172	1846068	3131093	protease,transposase,integrase,tRNA	Staphylococcus_phage(20.0%)	97	1816584:1816643	1851068:1851148
WP_105962625.1|1746172_1747058_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556521.1|1747592_1747781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556520.1|1747731_1748628_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	1.8e-54
WP_032126362.1|1748588_1748954_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1748899_1749475_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|1749550_1749844_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556519.1|1749929_1751108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211631.1|1751366_1752173_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_016211634.1|1752428_1753250_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211632.1|1753285_1754140_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016211627.1|1754365_1754530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377868.1|1754835_1755492_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016210103.1|1755567_1756926_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_016210117.1|1757207_1757567_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210111.1|1757987_1759622_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_017377579.1|1759628_1760465_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210099.1|1760486_1761764_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_016210105.1|1761847_1762168_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210106.1|1762187_1763279_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_016210102.1|1763461_1765051_+	APC family permease	NA	NA	NA	NA	NA
WP_016210110.1|1765111_1765867_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	5.4e-65
WP_016210113.1|1766054_1767104_+	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.5	7.9e-30
WP_016210101.1|1767526_1769023_+	flagellin domain protein	NA	NA	NA	NA	NA
WP_016210107.1|1769312_1769585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210114.1|1769656_1770916_-	calcineurin-like phosphoesterase	NA	NA	NA	NA	NA
WP_016210108.1|1771008_1772274_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	9.1e-49
WP_122943012.1|1772459_1772915_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_016210112.1|1773031_1774459_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.0	2.5e-55
WP_032126690.1|1775152_1775635_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_052047138.1|1781682_1781916_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046728.1|1782178_1783153_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	6.8e-28
WP_155049900.1|1783281_1783587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211563.1|1783935_1784097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211564.1|1784129_1785005_-	ParA family protein	NA	NA	NA	NA	NA
WP_016211561.1|1785170_1789037_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_080728343.1|1789118_1789259_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_081007034.1|1789240_1789525_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_032126538.1|1789789_1791208_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_016211991.1|1792116_1793022_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126537.1|1793262_1793448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211994.1|1793484_1794021_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_016212348.1|1795439_1796669_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_075274849.1|1796663_1797407_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126239.1|1797532_1797805_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1797816_1798653_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_129556517.1|1798671_1798959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1799356_1800331_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300271.1|1800978_1801953_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212012.1|1802189_1802867_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016212013.1|1802882_1803266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212011.1|1803487_1804609_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_075274847.1|1804842_1805718_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211974.1|1806000_1807122_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075273551.1|1807221_1807524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556638.1|1807523_1808204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377865.1|1809548_1809833_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664876.1|1810191_1812054_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_033923779.1|1812366_1813203_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1813214_1813487_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212529.1|1813527_1814085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275108.1|1814443_1815049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1815025_1816000_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046727.1|1816243_1816588_+	hypothetical protein	NA	NA	NA	NA	NA
1816584:1816643	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_016212558.1|1817139_1817436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556515.1|1817413_1817773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1817791_1818064_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1818075_1818912_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075274844.1|1818920_1819172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|1819352_1820327_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016211144.1|1820883_1821513_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_016211152.1|1821496_1821919_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211145.1|1821925_1823665_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211153.1|1823665_1824730_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1824733_1825087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1825199_1826156_+	ferrochelatase	NA	NA	NA	NA	NA
WP_016211151.1|1826165_1826477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1826492_1827062_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211148.1|1827325_1828654_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_081377864.1|1828735_1828975_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1828988_1829825_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1829836_1830109_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1830193_1831168_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210841.1|1831381_1831753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210839.1|1831811_1832585_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_129556514.1|1832736_1835193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126340.1|1835472_1836234_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_122941824.1|1836314_1838051_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016210844.1|1838235_1839363_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.2	5.7e-10
WP_016210843.1|1839449_1839680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556637.1|1840294_1841074_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016212589.1|1841548_1841986_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300363.1|1842409_1842757_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556512.1|1842702_1843278_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212275.1|1843267_1844251_-	MFS transporter	NA	NA	NA	NA	NA
WP_051307372.1|1844366_1844756_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036774189.1|1844803_1845811_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1845810_1846068_-|transposase	transposase	transposase	NA	NA	NA	NA
1851068:1851148	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCC	NA	NA	NA	NA
>prophage 19
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	1872918	1932028	3131093	transposase,tRNA	uncultured_Mediterranean_phage(30.77%)	55	NA	NA
WP_016211804.1|1872918_1874304_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
WP_016211805.1|1874310_1875849_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211806.1|1875891_1876617_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_032126239.1|1877406_1877679_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1877690_1878527_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_129556510.1|1879050_1880154_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	7.3e-10
WP_054300405.1|1880255_1880756_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016209947.1|1881277_1881940_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_016209946.1|1881966_1883196_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209940.1|1883352_1886124_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_016209937.1|1886199_1886643_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209931.1|1886795_1888268_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_016209926.1|1888379_1889441_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209945.1|1889437_1890472_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209932.1|1890474_1891515_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209936.1|1891697_1892813_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.6	1.4e-93
WP_016209930.1|1892851_1893205_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_032126634.1|1893225_1895094_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209935.1|1895115_1896060_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_016209925.1|1896293_1896572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1896781_1897420_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209944.1|1897394_1898822_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209927.1|1899022_1899700_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209939.1|1899834_1901109_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209943.1|1901176_1901932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209948.1|1901983_1902901_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_016209929.1|1903009_1903903_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075274822.1|1905361_1906336_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016211771.1|1906628_1906817_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_016211770.1|1906830_1907964_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_075274823.1|1908163_1912174_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211823.1|1912208_1912397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211827.1|1912437_1913058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1913389_1913743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1913956_1914151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|1914816_1915344_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300400.1|1915400_1915643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300399.1|1915787_1916054_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210885.1|1916395_1917277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|1917334_1917931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|1917963_1918737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|1919270_1919567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210888.1|1919589_1919841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155053505.1|1919786_1920509_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210886.1|1920577_1921357_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_016210887.1|1921439_1922390_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210889.1|1922899_1925746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556636.1|1925763_1926072_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016212002.1|1927025_1927304_-	DNA-J related family protein	NA	NA	NA	NA	NA
WP_016212000.1|1927423_1928152_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016211998.1|1928282_1928846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211999.1|1928835_1929189_-	ras family protein	NA	NA	NA	NA	NA
WP_033923779.1|1929568_1930405_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1930416_1930689_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274825.1|1930966_1932028_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	1968842	2055265	3131093	transposase,tRNA	Bacillus_phage(15.0%)	84	NA	NA
WP_075274826.1|1968842_1969748_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1970004_1971276_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_016211218.1|1971300_1972038_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1972290_1973433_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1973449_1975051_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1975562_1975700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1975696_1976974_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|1977323_1977506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126600.1|1977777_1978299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212250.1|1978421_1979072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212251.1|1979233_1979770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300384.1|1979931_1980747_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075274828.1|1981155_1982478_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	1.2e-11
WP_052133287.1|1982579_1982978_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212039.1|1983166_1983724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212040.1|1983900_1985250_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_054300162.1|1985453_1986536_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016210803.1|1986610_1987909_-	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_016210808.1|1988086_1988938_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_016210805.1|1988946_1989618_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_032126141.1|1990027_1991302_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016210804.1|1991366_1993286_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.0	4.5e-84
WP_032126139.1|1993292_1994222_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_033923779.1|1996890_1997727_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075274829.1|1997738_1998011_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1998034_1999009_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300382.1|1999409_1999832_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377858.1|2000050_2000761_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2000964_2001330_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2001344_2001851_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211414.1|2002066_2002885_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|2002992_2003454_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211415.1|2003470_2004394_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211417.1|2004417_2005467_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_051307357.1|2005603_2006197_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211422.1|2006219_2006690_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_032126143.1|2006778_2008050_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_075274832.1|2008149_2009124_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_016211838.1|2009435_2009609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211840.1|2010079_2010544_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211839.1|2010702_2012175_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211841.1|2012292_2012745_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|2013604_2014666_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|2014968_2016051_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212483.1|2016061_2016859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2016855_2017431_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2017376_2017742_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300380.1|2017843_2018500_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556508.1|2018770_2019214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|2019275_2019569_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556507.1|2019685_2020372_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	48.3	5.5e-48
WP_075273327.1|2020361_2020937_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2020882_2021248_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212421.1|2021739_2021922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2022672_2023647_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556505.1|2023687_2024653_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211470.1|2025419_2026073_+	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_016211471.1|2026132_2028118_-	sodium/hydrogen exchanger family protein	NA	NA	NA	NA	NA
WP_032126343.1|2028248_2029061_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_032126344.1|2029181_2030270_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_016211467.1|2030272_2030839_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_075273298.1|2030913_2031489_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|2031434_2031800_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052047029.1|2031967_2032309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2032381_2033443_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032127044.1|2033646_2033847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212482.1|2034061_2034205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|2034748_2035042_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556503.1|2036103_2036970_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	5.6e-58
WP_016210508.1|2036978_2038676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210507.1|2038996_2039545_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_075273576.1|2039672_2040401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|2040460_2043958_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_016210514.1|2044015_2045269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210515.1|2045377_2046280_-	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210512.1|2046333_2047371_-	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210506.1|2047506_2048745_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210510.1|2048737_2049466_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_081007040.1|2049496_2050153_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211831.1|2050290_2052018_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016211829.1|2052318_2052672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|2053087_2053588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047133.1|2054239_2054686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2054689_2055265_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	2069436	2108329	3131093	protease,transposase,tRNA	Klosneuvirus(28.57%)	36	NA	NA
WP_105962625.1|2069436_2070322_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210927.1|2070842_2071793_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016210917.1|2071917_2073360_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.5	5.4e-21
WP_032126561.1|2073573_2074758_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210925.1|2074881_2075568_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.5	9.7e-29
WP_016210921.1|2075659_2076244_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_155046724.1|2076468_2076636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210929.1|2076632_2076989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210928.1|2077023_2077329_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_054300375.1|2077543_2077744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728346.1|2078550_2078883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372539.1|2078900_2079764_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556501.1|2079796_2080372_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2080317_2080683_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211651.1|2080916_2082452_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016211650.1|2082576_2084061_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211648.1|2084720_2085260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126643.1|2086463_2086670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126642.1|2086739_2087201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126641.1|2087236_2089807_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_016209840.1|2089914_2090400_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_016209844.1|2090572_2091613_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209835.1|2091590_2092073_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209848.1|2092069_2094664_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209832.1|2094970_2095234_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209831.1|2095512_2096211_-	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209841.1|2096430_2096625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209827.1|2096700_2098260_-	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_129556633.1|2098578_2099475_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209845.1|2099691_2101167_-	APC family permease	NA	NA	NA	NA	NA
WP_016209826.1|2101689_2102712_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_016209830.1|2103042_2104410_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209846.1|2104645_2104900_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126639.1|2104915_2106202_+	GTPase HflX	NA	NA	NA	NA	NA
WP_016209836.1|2106221_2107436_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_016209838.1|2107435_2108329_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 22
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	2145401	2195022	3131093	transposase,tRNA	Vibrio_phage(14.29%)	42	NA	NA
WP_016211285.1|2145401_2146181_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_016211286.1|2146198_2146546_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_016211289.1|2146657_2146930_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211767.1|2148258_2149068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211764.1|2149618_2150440_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126803.1|2150640_2151873_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_081377862.1|2152359_2153196_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2153207_2153480_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046719.1|2153498_2153657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|2155875_2156691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211525.1|2158990_2161726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275102.1|2162314_2162773_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377901.1|2162953_2163664_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126856.1|2163724_2164066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|2164370_2165524_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016212005.1|2166424_2168185_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_016210592.1|2168574_2169231_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016210586.1|2169243_2170749_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210593.1|2170770_2171301_-	colicin V production protein	NA	NA	NA	NA	NA
WP_016210590.1|2171380_2172643_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210587.1|2172817_2173678_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_032126176.1|2173779_2174562_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210588.1|2174652_2175978_-	fimV domain protein	NA	NA	NA	NA	NA
WP_016210595.1|2176345_2177524_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210594.1|2177700_2178354_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_016210596.1|2178489_2180430_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	3.1e-72
WP_129556498.1|2180426_2181035_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075275098.1|2181547_2182477_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.1e-24
WP_080728317.1|2182667_2186033_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211391.1|2186099_2186675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211393.1|2186686_2188243_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_016211396.1|2188262_2188613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211395.1|2188609_2188945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372269.1|2189301_2189673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212466.1|2189877_2190603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212252.1|2190917_2191076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212254.1|2191113_2192556_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_075273327.1|2192545_2193121_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|2193066_2193357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2193370_2193946_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2193891_2194257_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274672.1|2194428_2195022_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	2203780	2252436	3131093	transposase	Bacillus_phage(33.33%)	45	NA	NA
WP_054300408.1|2203780_2204437_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_032126362.1|2204487_2204853_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275097.1|2204798_2205374_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275095.1|2205775_2206552_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209823.1|2206596_2207040_-	response regulator	NA	NA	NA	NA	NA
WP_016209809.1|2207464_2207953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209817.1|2208059_2209028_+	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_016209820.1|2209729_2213029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209803.1|2213087_2214125_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209810.1|2214329_2216243_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	6.9e-117
WP_016209822.1|2216304_2216952_-	methyltransferase domain protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_016209802.1|2217087_2218212_-	D-isomer specific 2-hydroxyacid dehydrogenase catalytic domain protein	NA	NA	NA	NA	NA
WP_016209800.1|2218208_2218805_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_016209821.1|2218835_2219168_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016209812.1|2219257_2221081_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	9.7e-44
WP_032126326.1|2221533_2222796_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	3.1e-25
WP_016209815.1|2223563_2224103_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_016209799.1|2224488_2224905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209818.1|2225000_2225816_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_016209805.1|2225948_2227442_+	neurotransmitter symporter family protein	NA	NA	NA	NA	NA
WP_032126324.1|2227620_2228043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209801.1|2228042_2230097_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016209813.1|2230381_2231197_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_016209824.1|2231297_2232116_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_016209808.1|2232112_2232481_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_016209806.1|2232823_2232973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212343.1|2233785_2234592_+	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_105962623.1|2234830_2235984_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016211588.1|2236151_2236853_-	cyclase family protein	NA	NA	NA	NA	NA
WP_032126329.1|2236928_2237558_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_129556496.1|2237743_2238982_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_016211592.1|2239256_2239919_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_016211589.1|2239908_2241141_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_129556495.1|2241263_2241521_+	VOC family protein	NA	NA	NA	NA	NA
WP_032126637.1|2242501_2242795_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_032126540.1|2243025_2243889_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2244022_2244388_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2244333_2244909_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126332.1|2245555_2246755_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_016211366.1|2247007_2247295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126331.1|2247350_2249360_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_032126330.1|2249414_2250374_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_016211367.1|2250521_2251304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664860.1|2251459_2251897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2251860_2252436_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	2268563	2368119	3131093	transposase,tRNA	Armadillidium_vulgare_iridescent_virus(12.5%)	99	NA	NA
WP_016210280.1|2268563_2269658_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_054300412.1|2269894_2270209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273307.1|2270353_2270764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275091.1|2271034_2271520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556631.1|2272528_2272696_+	phosphatase	NA	NA	NA	NA	NA
WP_075275089.1|2272840_2273173_+	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	37.3	8.0e-05
WP_032126500.1|2273306_2274023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211118.1|2274159_2275407_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126499.1|2275785_2276397_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211122.1|2276493_2277360_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|2277363_2278125_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_016211128.1|2278288_2279194_+	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211125.1|2279416_2280247_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211126.1|2280416_2280806_+	lipoprotein	NA	NA	NA	NA	NA
WP_032126498.1|2280938_2281499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2281560_2281926_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2281871_2282447_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212621.1|2282443_2282848_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_016212585.1|2283142_2283463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274822.1|2283574_2284549_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_075273327.1|2284918_2285494_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2285439_2285805_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275086.1|2285765_2286764_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212356.1|2286741_2287587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047081.1|2287637_2288075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212519.1|2288345_2288726_-	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_075275084.1|2288800_2289862_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212611.1|2289909_2290230_-	histidine kinase	NA	NA	NA	NA	NA
WP_081377357.1|2290713_2291115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285940.1|2291199_2292021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126778.1|2292235_2292430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211088.1|2292608_2293571_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211087.1|2293790_2294786_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_016211081.1|2294813_2295749_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|2295789_2296251_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080664852.1|2296229_2297273_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016211090.1|2297285_2298920_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_080664853.1|2298879_2300622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|2301345_2303382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211709.1|2305641_2305788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274676.1|2305946_2306144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212323.1|2306218_2306491_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_122941816.1|2306567_2306876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212326.1|2306962_2307160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|2307385_2308271_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212290.1|2308275_2309601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2309717_2310779_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126869.1|2310756_2310996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2311516_2312092_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2312037_2312403_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2312633_2313209_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2313154_2313520_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|2314400_2315264_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556488.1|2316412_2317263_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275079.1|2317411_2318473_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126801.1|2318520_2319030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2319700_2320783_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300173.1|2320908_2321970_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212218.1|2323419_2323770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275077.1|2323914_2324751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2324835_2325741_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016210899.1|2326240_2328124_-	APC family permease	NA	NA	NA	NA	NA
WP_016210896.1|2328177_2329260_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210904.1|2329302_2329953_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210903.1|2330173_2330545_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_129556487.1|2330663_2332001_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210897.1|2332079_2333060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210894.1|2333400_2333703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|2334177_2334468_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210898.1|2334556_2334907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300269.1|2335818_2336187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2336208_2336574_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2336630_2336795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007012.1|2336784_2336955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275075.1|2336949_2338011_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273492.1|2338119_2338239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556486.1|2338329_2338677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556630.1|2338762_2340112_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211781.1|2340421_2341669_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_081377899.1|2342083_2342947_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210418.1|2343259_2343895_-	peroxiredoxin C	NA	NA	NA	NA	NA
WP_016210422.1|2344445_2345948_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_016210425.1|2345934_2349783_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_016210420.1|2349931_2351110_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.1	2.0e-50
WP_016210416.1|2351180_2351711_-	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_016210423.1|2351800_2352685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210417.1|2352681_2353119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126554.1|2353560_2354646_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_129556485.1|2354665_2357224_-	HAD-IC family P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	30.6	6.3e-73
WP_054300148.1|2357376_2358438_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273490.1|2358678_2359971_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_016211426.1|2360953_2362396_-	MFS transporter	NA	NA	NA	NA	NA
WP_129556484.1|2362739_2364200_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_129556469.1|2364701_2365010_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300265.1|2364969_2365230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300264.1|2365374_2365713_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_075275071.1|2365815_2366790_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212461.1|2367165_2367540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|2367543_2368119_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	2383957	2445821	3131093	protease,transposase,integrase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(11.76%)	56	2394174:2394233	2422356:2423459
WP_052047108.1|2383957_2384356_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275068.1|2384457_2385048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2385132_2385498_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2385443_2386019_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211578.1|2386376_2386721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|2386736_2386931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|2386997_2387351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211582.1|2387448_2388228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211585.1|2388289_2388847_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016211581.1|2388965_2389736_-	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.9	8.9e-31
WP_016211583.1|2390012_2390921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211579.1|2390988_2391474_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054300162.1|2391697_2392780_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_129556481.1|2393037_2393469_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_016212302.1|2393653_2393953_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
2394174:2394233	attL	ACGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAAC	NA	NA	NA	NA
WP_054300271.1|2394266_2395241_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556480.1|2395264_2400754_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_016211300.1|2401265_2402306_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_054300162.1|2402356_2403439_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036781387.1|2403583_2403856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|2403848_2404127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126152.1|2404329_2404920_+|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016211531.1|2404983_2405664_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016211530.1|2406017_2406914_+	Abi family protein	NA	A3QSC6	Clostridium_virus	32.0	5.3e-35
WP_016211534.1|2406919_2407429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211532.1|2407415_2408366_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	35.8	1.8e-09
WP_016211528.1|2409012_2409318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664862.1|2409298_2409997_-	P-loop NTPase	NA	NA	NA	NA	NA
WP_075273327.1|2411170_2411746_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274918.1|2411691_2412057_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556479.1|2412544_2412727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212436.1|2412940_2413351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|2413689_2414575_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033923634.1|2414565_2415114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126157.1|2415318_2415723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|2416009_2417902_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_016211512.1|2418244_2419051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307360.1|2420142_2421072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2421911_2422277_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|2422448_2423423_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273512.1|2423559_2423904_+	hypothetical protein	NA	NA	NA	NA	NA
2422356:2423459	attR	ACGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTCTCTAGTTCGCCTTTTGACTTAGAGGGTAGAGATGGTTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGGTTATCAGAGGGAGACTCGCTCAGATCAATTGCTAGAGCACTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
WP_075275067.1|2424659_2425727_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_059372266.1|2426059_2426545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556477.1|2426634_2428116_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_016209659.1|2428275_2429304_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_016209654.1|2429368_2430511_+	galactokinase	NA	NA	NA	NA	NA
WP_016209656.1|2430629_2432333_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209642.1|2432329_2434450_+	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209652.1|2434446_2435796_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209662.1|2435767_2437915_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209657.1|2438342_2438738_+	CrcB family protein	NA	NA	NA	NA	NA
WP_016209643.1|2438746_2439631_-	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_032126162.1|2439662_2441540_-	SurA domain-containing protein	NA	NA	NA	NA	NA
WP_016209655.1|2441643_2441916_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_032126161.1|2442019_2444452_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209663.1|2444519_2445821_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
>prophage 26
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	2458787	2512400	3131093	transposase,tRNA	unidentified_phage(20.0%)	50	NA	NA
WP_075273474.1|2458787_2459762_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_129556476.1|2459857_2460868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211684.1|2461412_2461988_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016211685.1|2462011_2463817_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211687.1|2463847_2464492_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_033923708.1|2464747_2465623_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556628.1|2465827_2466643_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.5e-32
WP_016210297.1|2466728_2468108_-	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_032126463.1|2468164_2469421_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_032126458.1|2469501_2471028_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_129556475.1|2471033_2472056_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_016210290.1|2472278_2473073_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210287.1|2473161_2474025_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_016210293.1|2474145_2475426_-	outer membrane beta-barrel domain protein	NA	NA	NA	NA	NA
WP_032126457.1|2476470_2476890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126460.1|2477797_2478235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210301.1|2478411_2479239_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_075273633.1|2479288_2479915_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_016210294.1|2480052_2480397_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_051307327.1|2480714_2481746_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.7e-35
WP_016210303.1|2482021_2482261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2482310_2483372_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210741.1|2484057_2484381_+	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_016210746.1|2484387_2488284_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210744.1|2488380_2488866_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210743.1|2488906_2490487_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_016210739.1|2490555_2492013_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210737.1|2492168_2494145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|2494463_2495084_-	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_016210742.1|2495249_2495525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2495675_2496650_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212172.1|2496669_2498142_-	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_075275065.1|2499032_2499707_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.9e-10
WP_054300173.1|2500006_2501068_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211822.1|2501377_2501791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211818.1|2502147_2503404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|2503606_2504107_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211819.1|2504403_2504634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556627.1|2504852_2505458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2505510_2506572_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2506598_2507174_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2507119_2507485_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052047106.1|2508200_2508677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2508750_2509326_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2509271_2509637_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212417.1|2509687_2509933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212416.1|2510056_2510587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|2510588_2511044_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273456.1|2511003_2511303_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274832.1|2511425_2512400_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
>prophage 27
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	2564408	2665037	3131093	protease,transposase,plate,tRNA	Prochlorococcus_phage(17.65%)	104	NA	NA
WP_075273327.1|2564408_2564984_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2564929_2565295_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275125.1|2567431_2568475_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210612.1|2570066_2571317_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016210605.1|2571305_2572187_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210611.1|2572179_2573265_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210607.1|2573261_2574521_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210598.1|2574689_2575349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556471.1|2575490_2576162_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210609.1|2576521_2577457_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_016210606.1|2577553_2578180_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210603.1|2578185_2578767_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210601.1|2578838_2579930_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210599.1|2580012_2580726_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_122940948.1|2580819_2581524_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300148.1|2581846_2582908_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126800.1|2583032_2583767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046715.1|2584315_2584561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556470.1|2584860_2585746_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209916.1|2585983_2586955_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	3.7e-34
WP_016209900.1|2587146_2588616_-	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_016209924.1|2588609_2589986_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209906.1|2589997_2590390_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209919.1|2590386_2591490_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_032126654.1|2591668_2592970_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209907.1|2592977_2593925_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_016209913.1|2593936_2594755_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_032126655.1|2594757_2595558_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209910.1|2595551_2596610_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_016209903.1|2596606_2597617_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209904.1|2597623_2597821_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209914.1|2597881_2600788_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209918.1|2600829_2601684_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_032126652.1|2601716_2602283_-	chorismate lyase	NA	NA	NA	NA	NA
WP_016209915.1|2602365_2603226_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016209922.1|2603317_2603734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209912.1|2603793_2604291_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209920.1|2604336_2607291_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_016209901.1|2607320_2607653_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_016209923.1|2607770_2608289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209908.1|2608763_2609474_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209899.1|2609470_2610505_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_032126651.1|2610608_2610794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275054.1|2610914_2611280_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2611225_2611801_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212369.1|2611804_2612251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212599.1|2613485_2613695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275052.1|2613744_2614254_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275050.1|2614398_2615094_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|2615169_2616075_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_129556469.1|2616868_2617177_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080743011.1|2617136_2617592_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210407.1|2617702_2618689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126181.1|2618704_2619325_-	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_016210401.1|2619445_2620498_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_016210400.1|2620494_2621343_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210403.1|2621374_2622598_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210413.1|2622672_2622915_-	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210415.1|2623003_2623741_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210406.1|2623768_2624713_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210405.1|2624766_2625717_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210402.1|2625723_2626773_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210404.1|2626831_2627005_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_075273448.1|2627022_2627553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210411.1|2627794_2628436_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_016210409.1|2628599_2630429_-	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210408.1|2630596_2631469_+	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_075275046.1|2631460_2633674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273445.1|2633946_2634204_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_016209511.1|2634289_2634973_-	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_016209508.1|2635023_2635914_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016209527.1|2635975_2636734_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209518.1|2636736_2638005_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209505.1|2638079_2638331_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209517.1|2638364_2638712_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209507.1|2638715_2639369_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209535.1|2639391_2639856_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_098082797.1|2639852_2640620_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209539.1|2640623_2641424_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_016209498.1|2641563_2642544_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209499.1|2642549_2643107_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_129556465.1|2643093_2643666_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209538.1|2643662_2644394_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_016209519.1|2644549_2645941_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209537.1|2645965_2646277_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209512.1|2646633_2647488_+	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209502.1|2647488_2648091_-	signal peptidase I	NA	NA	NA	NA	NA
WP_016209504.1|2648166_2649006_-	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_016209530.1|2649186_2649831_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209534.1|2649847_2650234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|2650453_2651386_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209515.1|2651490_2652006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209506.1|2652048_2653005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209524.1|2652986_2654675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126187.1|2654671_2655070_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_051307310.1|2655069_2656542_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_129556464.1|2656547_2657039_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_016209516.1|2657028_2658498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|2658502_2659195_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|2659172_2660201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126188.1|2660194_2661421_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209501.1|2661426_2662938_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_016209510.1|2663199_2663637_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209523.1|2663687_2665037_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 28
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	2685358	2717153	3131093	transposase,tRNA	Enterobacteria_phage(33.33%)	35	NA	NA
WP_129556462.1|2685358_2686204_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.8	1.4e-24
WP_105962625.1|2686200_2687087_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007066.1|2687466_2687805_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275039.1|2687799_2688294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|2689097_2689388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007010.1|2689437_2690058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210530.1|2690898_2691579_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_016210535.1|2691575_2692388_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210534.1|2692461_2696142_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_016210531.1|2696151_2697639_-	ribonuclease G	NA	NA	NA	NA	NA
WP_016210527.1|2697648_2698266_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016210528.1|2698335_2698854_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210536.1|2698850_2699750_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2699765_2700809_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210537.1|2700998_2701286_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210532.1|2701397_2702849_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_032126195.1|2702890_2704327_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_155046713.1|2704621_2704786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275038.1|2704923_2705514_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2705459_2705825_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212074.1|2705851_2706073_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212072.1|2706159_2706357_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047032.1|2706386_2706620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212075.1|2706832_2707030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126197.1|2707143_2708097_+	DMT family transporter	NA	NA	NA	NA	NA
WP_054300271.1|2708237_2709212_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|2709322_2710384_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126201.1|2710405_2711152_-	lipoprotein	NA	NA	NA	NA	NA
WP_032126199.1|2711281_2711593_+	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_016211487.1|2711940_2712264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211494.1|2712288_2712744_-	arginine repressor	NA	NA	NA	NA	NA
WP_016211489.1|2712733_2713786_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_016211493.1|2713788_2715252_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211491.1|2715534_2715831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275036.1|2716091_2717153_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	2728190	2778470	3131093	transposase,integrase	Escherichia_phage(47.37%)	57	2744171:2744230	2766875:2767738
WP_054300173.1|2728190_2729252_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212580.1|2729987_2730338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2730425_2730791_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2730736_2731312_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211662.1|2731916_2733029_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_032126810.1|2733071_2733770_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211661.1|2734028_2734985_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_016211663.1|2735049_2735715_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_036776715.1|2735808_2736537_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211244.1|2736938_2737634_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_016211242.1|2737587_2738556_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_129556456.1|2738599_2739349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211238.1|2739550_2741044_-	amino acid permease	NA	NA	NA	NA	NA
WP_129556626.1|2741486_2742875_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211235.1|2743304_2743742_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
2744171:2744230	attL	CGGCACTGTTGCGAAAAATTATAGTGAACTTCAGAAAGGTTATTTTCTTGTGCTCTCTGC	NA	NA	NA	NA
WP_054300202.1|2744236_2744965_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211644.1|2745106_2745373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211639.1|2745487_2745790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126808.1|2745797_2746007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211640.1|2746169_2746772_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211645.1|2746803_2747553_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	28.2	2.4e-09
WP_016211641.1|2747575_2748031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556455.1|2748035_2748638_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211642.1|2748938_2749292_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_016211646.1|2749284_2749524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|2749893_2750730_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2750741_2751014_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275032.1|2751064_2751874_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	1.1e-15
WP_075275029.1|2752617_2753346_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	9.6e-43
WP_129556454.1|2753514_2755527_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_080728351.1|2755790_2755949_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211807.1|2755836_2756058_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275025.1|2756307_2758323_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771330.1|2759838_2760813_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_032126150.1|2760911_2761145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212425.1|2761293_2761884_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	34.4	1.1e-20
WP_016212424.1|2762087_2762366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126738.1|2762358_2762631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126737.1|2762757_2763486_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211918.1|2764034_2765003_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_051307368.1|2765002_2766283_-	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_054300202.1|2766940_2767669_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_052047116.1|2768370_2768550_+	hypothetical protein	NA	NA	NA	NA	NA
2766875:2767738	attR	CGGCACTGTTGCGAAAAATTATAGTGAACTTCAGAAAGGTTATTTTCTTGTGCTCTCTGCTTAGAATTAAGCAGCTAATCCAAATAATTTATCAATGAGCTGATTTTGGGCACAGATATTCTGTTTTTTAATATAACGTAATTGACCTTTTTGAACCATGCGCATCGCTTCCATTATGTCAATGGTAGGCCGTGCTGTAGAAAGTGATTGGTACCATTGGCGGAAACGGGATTTGCGCTTTACCGCTTTGTGATCATTTTCAATGCAGTTGTTTAAATACTTCACTCGCCTGAGTTTACACTGACTAGAAAAGACACCTTCATCTTTGGCTTTTTGGTGAGCGGGTGGAAATGAAGCGTGCTTGTCGACATTCACAACACGCGGTGATTTCACATAAGGTTGGGCGATTGCCTTTTTGAAAAAGCGCATCGCCGCTTTGGCATTTTGCTGTCGGCTGAGCATCCAGTCCAAAGTATGGCCATATTTATCAATGGCTCGATAAAGGTAATACCAACGACCTTTGATTTTCACCAACGTTTCATCTAACCGCCAAGAGGCACACGTTTGACGAAAGTGGGGCCTCAGCCGTTTGGCGATCTGCGAGCCATACTCGTGCACCCAGCGACAAATGGTTGAACGCTCAATCTCAAGACCTCTTTCAGCTGCTATTTCTTTGAGATCACGGTAAGATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATGATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTCTACCCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCCC	NA	NA	NA	NA
WP_129556453.1|2768694_2769126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273432.1|2769545_2770280_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_016212023.1|2770276_2771269_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_016212022.1|2771755_2771974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212021.1|2771973_2772573_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212024.1|2772569_2772818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300201.1|2773213_2773942_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_016212110.1|2774588_2775059_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	62.5	7.6e-33
WP_016212114.1|2775062_2775293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126479.1|2775289_2775643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126478.1|2775629_2775968_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.7e-24
WP_129556625.1|2775960_2776518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275021.1|2776732_2777674_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300201.1|2777741_2778470_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
>prophage 30
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	2906217	2949615	3131093	protease,transposase	Acanthamoeba_polyphaga_lentillevirus(14.29%)	41	NA	NA
WP_016209259.1|2906217_2907066_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_016209274.1|2907182_2908094_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_075274963.1|2908812_2909874_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212454.1|2910093_2910774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211192.1|2911562_2912921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211189.1|2912965_2913424_-	NfeD family protein	NA	NA	NA	NA	NA
WP_016211187.1|2913448_2914369_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_016211186.1|2914495_2915278_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.3	8.2e-32
WP_016211190.1|2915367_2916867_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_016211188.1|2917188_2919072_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_075273298.1|2919145_2919721_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2919666_2920032_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211157.1|2920596_2921253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211161.1|2921360_2922470_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|2922481_2923126_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|2923144_2924131_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|2924210_2925287_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|2925489_2926314_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|2926630_2927635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|2927843_2928809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274965.1|2928947_2929823_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2930119_2931172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211698.1|2931439_2931868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2932081_2932573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2932628_2933879_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2933981_2934200_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_052104629.1|2934642_2935668_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080728341.1|2936117_2936288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212561.1|2936259_2936400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210728.1|2937314_2937785_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2938073_2939453_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2939480_2939939_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2939916_2941134_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2941325_2941562_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2941575_2941731_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2941811_2942774_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2942933_2944250_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2944259_2944928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2945290_2947105_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_129556601.1|2947222_2947999_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_052104629.1|2948589_2949615_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP038881	Piscirickettsia salmonis strain Psal-003 chromosome, complete genome	3131093	2981300	3098565	3131093	transposase,tRNA	Staphylococcus_phage(33.33%)	113	NA	NA
WP_054300271.1|2981300_2982275_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|2982350_2983370_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047000.1|2983417_2983564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047001.1|2983768_2983954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274966.1|2985969_2987031_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211201.1|2987111_2987420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211206.1|2987534_2988851_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664857.1|2989312_2990599_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211205.1|2990671_2991568_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211203.1|2991654_2992653_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032126430.1|2992761_2993286_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_129556668.1|2993533_2994772_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_016212222.1|2995319_2995793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|2995789_2996185_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2997114_2997690_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2997635_2998001_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211610.1|2998265_3000596_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_129556603.1|3000716_3002732_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155062497.1|3002915_3006146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|3006210_3006516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274968.1|3006685_3007786_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049897.1|3008033_3009290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209721.1|3010228_3011626_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.3e-77
WP_051307313.1|3011745_3012693_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|3012689_3013205_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|3013191_3014391_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|3014387_3014711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|3014712_3015942_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|3015941_3016985_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|3016984_3017668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3017664_3020154_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3020170_3020425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3020425_3020782_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|3021561_3022725_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|3022744_3025852_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|3025853_3027359_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3027386_3027668_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3027816_3028158_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3028277_3030158_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_059372650.1|3030242_3031841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3031858_3032974_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|3033101_3034100_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209700.1|3034103_3034862_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3034863_3036063_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3036046_3036718_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3036739_3037516_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3037519_3038518_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3038519_3039098_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3039094_3040564_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3040607_3040895_-	trp operon repressor	NA	NA	NA	NA	NA
WP_016209699.1|3041095_3041692_+	DMT family transporter	NA	NA	NA	NA	NA
WP_075274970.1|3041901_3042372_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|3042428_3042584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274971.1|3042728_3043181_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3043366_3043588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212371.1|3043703_3044336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274972.1|3044313_3045375_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211865.1|3045814_3046354_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|3046438_3046975_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|3047626_3047929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|3048378_3048687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556607.1|3049295_3049745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|3050027_3050738_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|3050964_3051363_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_016211231.1|3052230_3053181_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3053180_3055259_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3055406_3055922_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3055930_3056494_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3056474_3057221_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3057360_3057813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|3058236_3059073_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3059069_3059966_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3059998_3061066_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3061084_3061453_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3061478_3062927_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3062936_3064316_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3064356_3065688_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|3065659_3066619_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3066711_3067215_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3067349_3068501_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3068497_3068977_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3069123_3071445_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3071389_3072016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3072020_3072920_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3072992_3073571_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3073871_3074129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556611.1|3074137_3075291_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155049899.1|3075975_3076119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046758.1|3076427_3076559_+	phosphatase	NA	NA	NA	NA	NA
WP_155046759.1|3076703_3076859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212051.1|3077186_3077960_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126148.1|3078501_3078684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3079287_3080262_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3081356_3081695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212337.1|3081711_3082422_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_051307375.1|3082409_3082601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|3082762_3083062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|3083051_3083216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|3083272_3083638_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3084942_3085638_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3085634_3087062_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3087087_3087351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3087711_3088686_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556612.1|3088744_3089595_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|3089632_3089977_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3089973_3090810_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3090810_3091152_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3091153_3091759_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3091755_3093750_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3093769_3094711_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211292.1|3094938_3096363_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|3096875_3097850_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3097908_3098565_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP038882	Piscirickettsia salmonis strain Psal-003 plasmid unnamed1, complete sequence	109807	2323	52565	109807	transposase,protease,integrase	Streptococcus_phage(30.77%)	57	NA	NA
WP_129556705.1|2323_2824_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	28.0	9.9e-07
WP_036771330.1|2882_3857_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_054300162.1|4369_5452_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212151.1|5816_6779_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|6802_7117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923686.1|7173_8223_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|8331_9372_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|9385_10015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|10105_10405_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211886.1|10401_10830_-	nucleotidyltransferase substrate-binding, HI0074 family protein	NA	NA	NA	NA	NA
WP_054300202.1|11618_12347_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126832.1|12591_13500_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_054300202.1|13610_14339_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046765.1|14450_14645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|15531_16260_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|16463_19040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|19445_20420_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_075274931.1|20620_21349_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.4e-38
WP_016212137.1|21792_22854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212139.1|22929_23175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307371.1|23146_23761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|24578_25553_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_129556707.1|25912_26932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|27560_28714_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_032126239.1|28858_29131_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|29142_29979_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075275144.1|30011_30743_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212014.1|30840_31254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155062499.1|31548_31797_+	hypothetical protein	NA	W8VUR5	Pseudomonas_phage	38.8	1.4e-06
WP_129556549.1|31786_32673_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.7	4.5e-10
WP_047927838.1|32935_33181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|33177_33477_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_016212019.1|33633_34329_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_081377351.1|35142_35922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|36005_36158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126739.1|36110_36443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|36607_36985_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_016212152.1|37291_37675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|38144_38873_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_098082839.1|38958_39159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211775.1|39326_39695_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_016211773.1|39796_40471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|40923_41289_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|41234_41810_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126360.1|42016_42751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211895.1|42873_43932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|44440_45187_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211897.1|45187_45592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|45985_46801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|47405_48134_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212298.1|48575_48902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307374.1|49142_49619_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_075275158.1|49733_50027_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377916.1|50143_50668_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.4	2.5e-29
WP_098082791.1|50872_51175_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.6	8.6e-14
WP_129556698.1|51183_51885_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_016211912.1|51974_52565_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
>prophage 2
NZ_CP038882	Piscirickettsia salmonis strain Psal-003 plasmid unnamed1, complete sequence	109807	55660	102311	109807	transposase,integrase	Streptococcus_phage(22.22%)	55	81607:81666	108085:109193
WP_081377915.1|55660_56218_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	2.9e-47
WP_081377914.1|56362_56692_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|56808_57102_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_016212499.1|58100_58475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|58679_58853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|59100_59550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212412.1|59542_59707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372613.1|60007_60634_+	hypothetical protein	NA	A0A222ZGQ4	Arthrobacter_phage	33.7	1.8e-21
WP_054300202.1|60739_61468_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_054300590.1|61497_61722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556699.1|62029_62230_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211871.1|62223_62559_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_032126138.1|63124_63388_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_016211872.1|63942_64746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307367.1|64866_65391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273798.1|65499_65724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126346.1|65815_66058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923775.1|66124_66865_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	4.6e-08
WP_016212413.1|66912_67341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|67674_68403_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_129556700.1|68579_68825_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|68784_69240_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_054300148.1|69345_70407_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728342.1|70446_70950_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032126739.1|71264_71597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556701.1|71843_72368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275159.1|72776_73484_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	32.0	3.8e-12
WP_129556702.1|73504_74657_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273327.1|75641_76217_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|76162_76528_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212398.1|77875_78337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|78599_79436_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_129556717.1|79761_80988_+	hypothetical protein	NA	NA	NA	NA	NA
81607:81666	attL	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAA	NA	NA	NA	NA
WP_075274955.1|81642_82617_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_016212260.1|82774_83047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212257.1|83066_83291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126838.1|83627_83831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212255.1|83827_83998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273820.1|84184_85267_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.8	1.2e-142
WP_075273822.1|85423_85924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274741.1|86025_86283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556718.1|86351_87538_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_155046769.1|88787_88958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377350.1|89287_90103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372616.1|90348_90939_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	38.8	6.8e-23
WP_016211879.1|91904_92924_+	ParA family protein	NA	NA	NA	NA	NA
WP_016211878.1|92936_94277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046770.1|94573_94741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|94796_95525_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212168.1|95493_97182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275149.1|97525_98500_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.9e-25
WP_129556703.1|98725_99214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211956.1|99271_100000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211955.1|100456_101437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|101582_102311_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
108085:109193	attR	TTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCGAAGGTCGTTGGTATTACCTTTATCGAGCCATTGATAAATATGGCCATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCGATGCGCTTTTTCAAAAAGGCAATCGCCCAACCTTATGTGAAATCACCGCGTGTTGTGAATGTCGACAAGCACGCTTCATTTCCACCCGCTCACCAAAAAGCCAAAGATGAAGGTGTCTTTTCTAGTCAGTGTAAACTCAGGCGAGTGAAGTATTTAAACAACTGCATTGAAAATGATCACAAAGCGGTAAAGCGCAAATCCCGTTTCCGCCAATGGTACCAATCACTTTCTACAGCACGGCCTACCATTGACATAATGGAAGCGATGCGCATGGTTCAAAAAGGTCAATTACGTTATATTAAAAAACAGAATATCTGTGCCCAAAATCAGCTCATTGATAAATTATTTGGATTAGCTGCTTAATTCTAAGCAGAGAGCACAAGAAAATAACCTTTCTGAAGTTCACTATAATTTTTCGCAACAGTGCCCTTATAATAACAATTGCTGCGATTAAAATTTATTAATTCACATTGCCTTGTAACTGGAATATTTTTCGGCTCAGACTCAATAAGGCACTTTCTTTTTTCATAGTCCAAGCTCTTTAACTTTTTTGCAGCCCACTCCAACTCTGCTGTGCGTTTGCCCAGTTGACGGTGAAGTTCATTCACTTCTTTTTCTTTGGTTTTAATTTCATCCTTAAACTCCGCCACAGCACTATCGATATTGAAAGCTAGGCTTGCATTCGCTAAAAACACTTTTTTCCAGTTTTGAACAGTTTTAGGGACTAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCATTCGATGACCTCTAAGACAACTTTGGTTTTAAATTCAGCGCTTGGCTTCTTTCTTTTTTGACTCATATCATAGCTCCTAAAATGTTAAGCATCATTTTAACCTTTCAGGAATAAATCGTTAAACTATTCTGTCTGAAAACTCGGGAGCATTATACCGGTGGAAATGAAGCGTGTTTATCGACATTCACAA	NA	NA	NA	NA
>prophage 1
NZ_CP038883	Piscirickettsia salmonis strain Psal-003 plasmid unnamed2, complete sequence	79943	4824	28863	79943	transposase	Streptococcus_phage(16.67%)	33	NA	NA
WP_075273327.1|4824_5400_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|5345_5711_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212400.1|5761_6361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212399.1|6360_6621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|6750_7903_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212392.1|7931_8939_-	hypothetical protein	NA	W6E8G0	Rhizobium_phage	26.4	1.2e-06
WP_075273802.1|9002_9731_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.5e-37
WP_016212131.1|9914_10262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212135.1|10700_11885_+	3-methylitaconate isomerase	NA	NA	NA	NA	NA
WP_075275202.1|12128_12830_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	6.0e-10
WP_075275201.1|12832_13561_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_016212164.1|13689_14718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211443.1|15741_16428_+	Fic family protein	NA	NA	NA	NA	NA
WP_016211439.1|16431_16986_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	40.6	1.0e-20
WP_016211436.1|17030_17969_+	fic/DOC family protein	NA	S4TP71	Salmonella_phage	37.2	5.2e-25
WP_016211434.1|17941_18133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211445.1|18310_18661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211437.1|18677_19304_-	zinc-ribbon domain-containing protein	NA	A0A1S5XYQ1	Kurlavirus	28.2	4.4e-12
WP_032126541.1|19310_19703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211440.1|19713_20628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211444.1|20897_21404_+	antirestriction protein ArdA	NA	A0A222YZE5	Mycobacterium_phage	33.7	2.8e-17
WP_051307358.1|21552_21936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556729.1|22219_22450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212541.1|22436_22661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212539.1|22720_22870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|22866_23841_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212090.1|23884_24064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212087.1|24063_24492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126714.1|24659_25199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212089.1|25435_25666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126713.1|25764_26802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|27271_28297_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275198.1|28323_28863_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	40.2	8.4e-12
>prophage 2
NZ_CP038883	Piscirickettsia salmonis strain Psal-003 plasmid unnamed2, complete sequence	79943	37206	57887	79943	portal,protease,capsid,terminase,tail,head	Pseudomonas_phage(11.76%)	29	NA	NA
WP_129556725.1|37206_37887_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	39.3	3.3e-37
WP_016210977.1|38065_38359_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_129556724.1|38576_38759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046773.1|38903_39083_-	phosphatase	NA	NA	NA	NA	NA
WP_016212235.1|39129_39495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126134.1|39795_40179_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	5.6e-26
WP_016212234.1|40266_40746_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_016212231.1|40749_40959_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	43.1	1.3e-08
WP_080743047.1|40974_41331_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	61.3	5.4e-23
WP_081377926.1|41349_42432_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	1.2e-89
WP_016211136.1|42428_43670_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	46.0	3.1e-86
WP_080664855.1|43617_44289_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.8	3.0e-43
WP_016211140.1|44346_45540_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_016211133.1|45660_46995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211137.1|47185_47497_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_016211132.1|47493_47817_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211139.1|47809_48205_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211129.1|48201_48552_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211141.1|48551_48974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126913.1|48975_49299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|49355_49622_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_032126912.1|49625_51704_+	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	33.0	2.5e-56
WP_016210657.1|51696_52038_+|tail	phage minor tail family protein	tail	NA	NA	NA	NA
WP_016210666.1|52034_52706_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|52674_53421_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_016210665.1|53410_53968_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_016210662.1|53974_54262_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	2.5e-15
WP_016210670.1|54251_54506_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_016210653.1|54599_57887_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	33.5	5.2e-112
>prophage 1
NZ_CP038884	Piscirickettsia salmonis strain Psal-003 plasmid unnamed3, complete sequence	35469	14422	22145	35469	integrase,transposase	unidentified_phage(33.33%)	10	8028:8087	21467:21658
8028:8087	attL	TTATTCCGGTGAGATTATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTA	NA	NA	NA	NA
WP_129556741.1|14422_15094_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.4	3.4e-10
WP_052133268.1|15115_15397_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	38.7	8.3e-11
WP_016212274.1|15469_15934_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_032126154.1|15944_16139_-	addiction module toxin, HicA family	NA	A0A1X9I5T5	Streptococcus_phage	48.4	2.8e-10
WP_032126152.1|16354_16945_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.8	1.4e-20
WP_129556740.1|17008_17377_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155046774.1|17588_17765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300579.1|17983_18985_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	1.3e-26
WP_016211990.1|19314_21387_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_129556739.1|21416_22145_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
21467:21658	attR	TTATTCCGGTGAGATTATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTACCGTGATCTCAAAGAAATAGCAGCTGAAAGAGGTCTTGAGATTGAGCGTTCAACCATTTGTCGTTGGGTGCACGAGTATGGCTCGCAGATCGCCAAACGGCTGAGGCCCCACTTTCGTCAAACGTGTGCCTC	NA	NA	NA	NA
