The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	45566	89679	3130307	transposase	Moraxella_phage(16.67%)	46	NA	NA
WP_129556427.1|45566_46142_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46087_46453_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211193.1|46651_47413_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_016211195.1|47714_49241_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49612_50452_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50491_51799_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51773_52943_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|52997_53723_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54001_54391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54550_55456_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55531_55675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274979.1|55722_56562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375632.1|56554_56890_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_155046698.1|57068_57230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|57346_57640_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_016210704.1|58534_60481_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|61135_64198_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|64194_65259_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|65614_66568_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|66599_67763_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|67768_68368_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|68555_69056_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|69073_70162_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|70588_71833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|71829_72672_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_016211096.1|72651_73461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|73639_73867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|73867_74818_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|74873_75425_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|75551_75974_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|75966_76713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|76755_77454_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|77464_78289_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|78618_78987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274980.1|78981_80043_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|80092_80323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|80452_81667_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|81967_83029_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_016211249.1|83042_84770_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_016211245.1|84803_85535_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|85534_86323_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211251.1|86427_87051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|87370_87583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273383.1|87738_88311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046699.1|88515_89088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274981.1|89082_89679_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	136473	178470	3130307	transposase	Staphylococcus_phage(50.0%)	46	NA	NA
WP_054300271.1|136473_137448_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|137949_139362_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|139854_140862_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|140881_142402_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_129556430.1|142458_142665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211018.1|143640_144957_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|145060_145444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|145578_148644_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|148712_149816_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|149839_150394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|150508_151078_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211020.1|151197_151953_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_054300545.1|152119_153181_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_098082829.1|153575_153971_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|153992_154358_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|154414_154579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|154568_154868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|155120_155486_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|155431_156007_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212607.1|156007_156364_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|156452_157028_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|156973_157339_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|157818_158385_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|158396_159182_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|159813_160737_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|160788_161784_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|161815_162310_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_032126724.1|162401_162659_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|162748_163171_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|163489_164206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|164249_164501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556431.1|164514_165942_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|165969_167412_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|167499_167838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|167922_168453_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|168513_170706_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|170748_171234_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|171503_171935_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_016210245.1|171952_172783_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|172797_172941_-	lipoprotein	NA	NA	NA	NA	NA
WP_016210239.1|172971_173856_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|173827_174049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|174222_174501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|175471_176377_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016212383.1|176779_177898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|177894_178470_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	182276	239530	3130307	tRNA,transposase,tail,protease	Escherichia_phage(12.5%)	56	NA	NA
WP_075273327.1|182276_182852_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|182797_183163_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728339.1|183226_183499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212441.1|183766_183991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372761.1|185006_185456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|185519_186248_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016210779.1|186290_187220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210775.1|187512_188106_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_017377589.1|188074_188728_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016210784.1|188905_189877_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210782.1|189899_190796_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_016210786.1|190954_191401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210787.1|191397_192039_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016210789.1|192148_192727_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_016210776.1|193202_193640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047085.1|193964_195305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210785.1|195568_196963_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_075274986.1|198411_199479_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209863.1|199531_199954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209853.1|200194_200638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209873.1|200692_200950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209868.1|200927_201554_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_016209871.1|201631_203614_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|203823_205167_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|205433_208103_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|208126_210046_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|210215_211637_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|211782_212757_+	phospholipase A	NA	NA	NA	NA	NA
WP_016209855.1|212788_213184_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209859.1|213186_213408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|213571_215233_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|215305_215596_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_016209861.1|215821_216277_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|216341_216806_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|216898_218245_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|218244_219150_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|219211_220198_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|220190_220433_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|220554_222099_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_032126611.1|222145_223432_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|223474_224869_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|224892_225072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|225068_225644_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|225589_225955_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274988.1|226016_228251_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_016210079.1|228672_229170_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|229340_230036_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|230138_231701_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|232016_233810_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|233895_234168_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|234173_234800_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|234786_236217_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|236549_237605_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|237573_238251_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|238240_239077_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|239236_239530_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
>prophage 4
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	256927	301882	3130307	tRNA,transposase	Acinetobacter_phage(40.0%)	48	NA	NA
WP_075274991.1|256927_257503_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377888.1|257506_258067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556436.1|258122_259009_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046701.1|259035_259185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|259329_259530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|259577_260039_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|260462_261944_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|262006_263116_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|263213_265175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|265704_266109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|266161_267223_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046702.1|267348_267504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|270449_271602_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556437.1|271644_272067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556438.1|272336_273803_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_032126861.1|274006_274321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|274655_275542_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212538.1|275713_276154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210630.1|276683_277799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664846.1|277737_278424_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_032126366.1|278417_279395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210638.1|279433_280597_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210640.1|281061_281286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|281671_281959_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_016210633.1|282133_282889_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556439.1|282894_283350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210637.1|283325_283802_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210636.1|283808_285386_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_032126367.1|285389_286154_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016210629.1|286207_286744_+	tim44-like domain protein	NA	NA	NA	NA	NA
WP_016210634.1|286740_287472_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_032126368.1|287580_288735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275120.1|288879_289191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664872.1|289514_290495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211898.1|290736_291360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211899.1|291687_291981_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_105962625.1|292077_292964_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046704.1|293575_293728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212296.1|293743_294472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126374.1|294580_295552_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664866.1|295583_296000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211609.1|296614_296923_+	double zinc ribbon family protein	NA	NA	NA	NA	NA
WP_032126373.1|296955_299142_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.0	2.7e-141
WP_016211605.1|299245_299479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211606.1|299695_300226_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_016211607.1|300254_300479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273369.1|300661_301477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300526.1|301585_301882_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	329457	375012	3130307	transposase	Hokovirus(33.33%)	46	NA	NA
WP_075273298.1|329457_330033_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210127.1|330085_331111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210128.1|331204_331468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|331834_332653_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|332725_335098_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_016210125.1|335810_337238_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|337272_338295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|338311_338689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126491.1|339046_339364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210122.1|339530_340223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|340849_341824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|341813_343586_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|343586_343934_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_032126493.1|344183_345410_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|345499_346798_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664834.1|346831_347191_-	VUT family protein	NA	NA	NA	NA	NA
WP_080664833.1|347236_347581_-	VUT family protein	NA	NA	NA	NA	NA
WP_016210137.1|347561_348113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664832.1|348339_349638_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|349754_350045_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_016212281.1|350356_351811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|352010_352586_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|352531_352897_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212359.1|353632_353851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|354218_355193_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212044.1|355731_355986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|356708_357695_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|357832_358027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664870.1|358709_359357_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_129556444.1|359349_359772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211797.1|359933_361337_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|361387_361963_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|361908_362223_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556445.1|362263_363150_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126227.1|363788_364079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212008.1|364116_364815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212010.1|364831_365128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556446.1|365245_366397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273619.1|366669_367245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211273.1|367302_368136_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	29.0	3.5e-17
WP_016211268.1|368251_369436_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211271.1|369454_370399_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016211269.1|370703_371489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211272.1|371606_371975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211270.1|372202_373780_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_054300173.1|373950_375012_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	447624	560127	3130307	tRNA,transposase,protease	Escherichia_phage(28.57%)	108	NA	NA
WP_075275004.1|447624_448488_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|448704_450264_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|450285_451320_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|451368_451938_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|452073_453045_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|453056_454634_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|454699_455686_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016210646.1|456017_457127_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|457232_458417_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|458494_460483_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|460691_460847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300511.1|461104_461404_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_075275005.1|461562_461898_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|462814_464221_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|464238_465225_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|465227_466382_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|466378_467074_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|467208_468699_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210494.1|468719_469769_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|469835_471230_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210489.1|472108_474040_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_075273353.1|474044_474575_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|474609_474804_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|474846_475206_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|475625_476621_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_032126132.1|476633_479015_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|479020_479308_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|479579_480056_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|480200_480398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|480522_481497_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|483605_483704_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210477.1|484188_485478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126626.1|485714_486407_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|486448_487222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|487223_488165_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|488297_489875_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|490084_491842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|492390_493149_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|493356_493929_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|494032_494581_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|494882_495128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|495156_495453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941726.1|495720_496644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556451.1|497122_497380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275008.1|497443_498172_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	3.3e-43
WP_155062496.1|498160_498328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066180.1|498252_498663_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_054300500.1|499130_499859_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_054300501.1|500207_500936_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|500947_501340_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|501336_501582_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300307.1|502685_503414_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_054300307.1|504020_504749_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_016212268.1|505393_505978_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_016212269.1|505981_506665_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|506947_507676_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_052104629.1|508012_509038_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212159.1|509181_509379_-	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_016212158.1|509646_510561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275019.1|510670_511375_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	9.2e-43
WP_105962625.1|511338_512225_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211714.1|512599_515944_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_144019196.1|515976_516633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300201.1|516688_517417_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_032126534.1|517931_518447_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212084.1|518446_519463_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_075274955.1|519744_520719_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212327.1|522104_522890_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075274956.1|522950_523319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|523361_524336_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016210580.1|524411_524672_-	methyltransferase	NA	NA	NA	NA	NA
WP_016210574.1|524812_525232_+	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_032126277.1|525319_525910_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210572.1|526132_527890_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126278.1|528011_528995_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_032126275.1|529075_529627_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126276.1|529637_531005_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126279.1|531155_531395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210582.1|531453_532197_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_016210581.1|532196_532841_+	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210578.1|532837_534502_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	7.1e-33
WP_016210576.1|534529_534865_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_016210570.1|534995_536594_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210577.1|536659_536950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|536964_537420_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273456.1|537379_537679_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556663.1|538056_538422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210376.1|538484_540965_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_016210384.1|541048_541528_+	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_129556597.1|541524_542541_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080664840.1|542477_543194_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|543206_543542_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|543578_544049_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210378.1|544091_545927_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_032126285.1|545971_547060_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_016210372.1|547081_548143_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_016210373.1|548221_548737_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210380.1|548777_550055_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210370.1|550069_550921_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_032126283.1|550949_551597_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_129556596.1|551584_552553_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126284.1|552644_553355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212036.1|553799_554648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|554699_555611_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_129556595.1|557382_557799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377902.1|557943_558471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300185.1|558657_559020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274953.1|559263_560127_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	585116	636261	3130307	tRNA,transposase	Staphylococcus_phage(37.5%)	52	NA	NA
WP_075273298.1|585116_585692_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377880.1|585637_586117_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210761.1|586754_587492_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_016210755.1|587595_588324_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_016210763.1|588427_589672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210764.1|589980_590241_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_016210758.1|590414_591953_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_051307336.1|592110_593037_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	9.4e-11
WP_016210756.1|593175_595989_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A167RAL2	Powai_lake_megavirus	26.5	1.3e-76
WP_032126291.1|595981_596491_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_016210766.1|596494_596938_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_129556593.1|597026_597668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|597664_598240_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|598185_598551_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211782.1|598612_598795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126294.1|599394_600672_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211783.1|600952_601318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211784.1|601309_602032_-	aquaporin family protein	NA	M1HH19	Acanthocystis_turfacea_Chlorella_virus	35.8	1.6e-26
WP_075274951.1|602585_603470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|603466_604441_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016210171.1|604998_606558_+	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	50.4	5.8e-37
WP_016210175.1|606871_607201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210177.1|607586_607952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126297.1|608076_608937_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_016210164.1|608923_609703_+	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_016210168.1|609778_610462_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556592.1|610622_611153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210179.1|611443_611947_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_016210161.1|612147_612402_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210178.1|612903_613371_+	DoxX family protein	NA	NA	NA	NA	NA
WP_016210163.1|613460_613991_-	ferric uptake regulator family protein	NA	NA	NA	NA	NA
WP_016210172.1|613990_614515_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	59.6	6.9e-51
WP_016210170.1|614677_615793_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210174.1|616029_617190_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	8.2e-121
WP_016210183.1|617640_619644_+	transketolase	NA	NA	NA	NA	NA
WP_016210176.1|619712_620720_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210181.1|620793_621978_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_032126295.1|621987_623442_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_016210162.1|623472_624510_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_105962625.1|625194_626081_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212028.1|626168_626417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212027.1|626911_628135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126299.1|628157_628379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|628629_629604_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211964.1|629662_629983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|630095_630746_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211963.1|630847_631507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211962.1|632055_632571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212030.1|632868_633114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|633205_633868_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212032.1|633991_635119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|635375_636261_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	644348	678788	3130307	tRNA,transposase	Catovirus(20.0%)	36	NA	NA
WP_016210986.1|644348_645887_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	1.3e-86
WP_075273313.1|645944_646283_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377882.1|646242_646524_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377881.1|646530_646698_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377817.1|647614_648112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556591.1|648335_648992_+	porin family protein	NA	NA	NA	NA	NA
WP_032126306.1|649096_649393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274949.1|649617_650679_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046752.1|650656_651394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|651432_651861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210814.1|652210_652408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210817.1|652650_653283_-	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210815.1|653702_654653_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210821.1|654649_656182_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_017377821.1|656178_656709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210823.1|657043_657682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|658131_658836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210818.1|659127_659352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210820.1|659855_660797_-	DMT family transporter	NA	NA	NA	NA	NA
WP_129556549.1|660998_661884_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210940.1|661992_663180_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	6.4e-20
WP_016210937.1|663271_663553_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126309.1|663638_664316_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_032126310.1|664362_665622_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_016210941.1|665819_666869_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_016210931.1|666947_667754_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210936.1|667791_668586_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210944.1|668687_669707_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210942.1|669753_670365_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210943.1|670368_671055_+	acireductone synthase	NA	NA	NA	NA	NA
WP_016210935.1|671051_671594_+	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016211759.1|673406_674594_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_016211756.1|674839_675565_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_032126312.1|675743_676538_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_129556590.1|676534_676930_-	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_054300282.1|678323_678788_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	707428	821708	3130307	tRNA,transposase,integrase,protease	Escherichia_phage(36.59%)	110	724042:724101	730270:730557
WP_016210052.1|707428_708625_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
WP_032126425.1|708645_709242_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210066.1|709685_710354_-|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_016210076.1|710495_711797_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210073.1|712053_712785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210051.1|713209_713614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210069.1|713854_714937_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.6e-20
WP_016210054.1|714921_715443_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210050.1|715507_716383_+	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_016210068.1|716458_717034_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_155046750.1|718220_718358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|719602_720508_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211874.1|720551_722270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|722588_723668_-	hypothetical protein	NA	NA	NA	NA	NA
724042:724101	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_016212522.1|724212_724467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300489.1|724563_725166_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_129556589.1|725168_725444_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032126389.1|726845_727034_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212230.1|728567_730016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377879.1|730071_730296_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_075274946.1|730517_730961_+	hypothetical protein	NA	NA	NA	NA	NA
730270:730557	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACG	NA	NA	NA	NA
WP_016212294.1|730974_731319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046748.1|731670_731976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212659.1|732063_732309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212568.1|732453_732603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274945.1|732827_733178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211326.1|733322_734063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211324.1|734559_735114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211322.1|735649_736240_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211325.1|736302_737823_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	7.3e-85
WP_016211323.1|737812_738910_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	1.0e-27
WP_016211321.1|739083_740244_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211722.1|740624_743927_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	1.7e-54
WP_032126817.1|743936_744758_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_075274944.1|745114_745831_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
WP_129556588.1|745775_745943_+	phosphatase	NA	NA	NA	NA	NA
WP_075274943.1|746133_746658_-	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_087910645.1|746943_748096_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_032127022.1|748158_750345_-	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_075274942.1|751021_751750_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.1	2.7e-45
WP_016212339.1|751768_752515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275114.1|752667_753030_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274941.1|753059_753788_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.2e-42
WP_016211996.1|754171_755119_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211997.1|755120_756230_-	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	24.5	4.4e-07
WP_075274940.1|756585_757266_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	2.0e-42
WP_087910645.1|757293_758447_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274939.1|758559_759288_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.8e-42
WP_016212238.1|759317_760607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212264.1|761122_761716_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	5.4e-28
WP_016212263.1|761761_762355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664881.1|762517_762724_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300481.1|762813_763542_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_129556661.1|763530_764094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210616.1|764394_767205_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_016210625.1|767453_768200_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_129556587.1|768258_769161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307334.1|769204_769984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210618.1|770250_771300_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_016210617.1|771364_772789_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_075274938.1|772952_773459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210624.1|773477_773717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210615.1|773762_774233_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016211056.1|776608_777361_-	ComF family protein	NA	NA	NA	NA	NA
WP_016211049.1|777404_778367_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211052.1|778366_779620_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211045.1|779650_780424_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211044.1|780404_781265_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_016211050.1|781333_782041_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211051.1|782003_782507_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211047.1|782868_784503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211053.1|784590_785157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|785199_785928_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_036780855.1|786693_787191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049879.1|787165_787567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|787535_788264_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211625.1|788747_789617_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_016211621.1|789613_790963_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	4.6e-75
WP_016211623.1|791075_792716_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_016211987.1|794537_796274_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_144019359.1|796435_796633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556671.1|796777_797506_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_098082825.1|797569_797878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|797870_798203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|798206_798776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211655.1|798904_799318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211652.1|799577_800783_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211653.1|800890_801916_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_054300202.1|802007_802736_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300202.1|803166_803895_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212196.1|804303_804549_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_016212195.1|804545_804932_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212193.1|804999_805338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274934.1|805460_806129_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.0	2.8e-41
WP_016211949.1|806616_807867_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_016211951.1|807900_808998_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_075274933.1|809614_810343_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_075274932.1|810651_810873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|811094_812708_-	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_016211816.1|812749_813103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|814172_814901_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_075274930.1|814930_815350_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210945.1|816160_816751_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_016210946.1|816877_818263_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210947.1|818357_818555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126573.1|818648_819467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|819973_820351_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016210948.1|820363_820600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210951.1|820599_820806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210956.1|820988_821708_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	904114	956173	3130307	tRNA,transposase	Agrobacterium_phage(12.5%)	45	NA	NA
WP_081007050.1|904114_904642_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|904698_905064_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211061.1|905125_905479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211058.1|905599_906133_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_032126660.1|906271_907909_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.2	5.8e-88
WP_016211065.1|907913_908135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211066.1|908232_909246_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_016211063.1|909408_911637_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.0	1.0e-82
WP_032126658.1|911617_912322_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|912556_912886_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_054300173.1|913966_915028_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126663.1|915054_915297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126664.1|916015_916699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212048.1|916892_917450_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_075274927.1|918213_919275_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664847.1|919347_920301_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_016210878.1|920801_923531_+	kinase	NA	NA	NA	NA	NA
WP_016210879.1|923633_923993_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210871.1|923989_924307_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210872.1|924323_925433_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210882.1|925459_926545_-	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210874.1|926667_927708_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210873.1|927722_928373_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210876.1|928440_929283_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016212197.1|929748_930666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|931684_931879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036794860.1|931955_932249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|932516_933434_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_016211373.1|933985_934132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211374.1|934186_935377_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211370.1|935509_935953_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211369.1|935995_937039_-	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211368.1|937085_938477_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211371.1|938673_939597_+	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211372.1|939583_940441_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016212287.1|946537_947683_-|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_054300173.1|947761_948823_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211408.1|949046_950393_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_016211412.1|950507_951500_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_016211411.1|951503_952001_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_016211407.1|951997_952837_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_051307356.1|952869_954402_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_032126774.1|954561_954897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|955052_955325_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|955336_956173_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
>prophage 11
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	1018084	1099692	3130307	tRNA,transposase	Staphylococcus_phage(35.29%)	82	NA	NA
WP_016211428.1|1018084_1020148_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.8	3.8e-36
WP_054300237.1|1020418_1021480_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556651.1|1021721_1022930_+	MFS transporter	NA	NA	NA	NA	NA
WP_075274925.1|1023117_1024179_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212285.1|1024226_1025705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1025754_1026816_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210196.1|1026773_1027127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210185.1|1027480_1029691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210188.1|1029691_1030378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210198.1|1030689_1031241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210195.1|1031257_1031659_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_016210190.1|1031849_1032725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126472.1|1032944_1033595_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_016210202.1|1034057_1036646_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.8	9.7e-122
WP_016210199.1|1036751_1037513_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_016210206.1|1037509_1038046_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	38.4	8.4e-20
WP_016210205.1|1038094_1039051_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.6	5.3e-49
WP_016210187.1|1039131_1042317_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_016210201.1|1042320_1043376_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	3.4e-49
WP_129556570.1|1043587_1044205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210186.1|1044248_1044911_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_016210194.1|1044945_1045293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210193.1|1045349_1045511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210192.1|1045882_1046401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1046713_1047079_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1047024_1047600_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556569.1|1047589_1047799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211502.1|1048213_1049257_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_016211508.1|1049286_1049631_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211503.1|1049685_1050141_+	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_075274922.1|1050151_1050448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274921.1|1050425_1050524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211506.1|1050516_1051158_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|1051154_1051871_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211507.1|1051874_1053194_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_054300271.1|1053507_1054482_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212450.1|1054525_1055428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1055583_1055949_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1055894_1056470_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1056483_1056774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1056719_1057295_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556568.1|1057331_1058813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|1059002_1060064_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211004.1|1060476_1063113_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_080664849.1|1063161_1064250_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016210997.1|1064249_1064933_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_016210998.1|1066807_1067062_+	LapA family protein	NA	NA	NA	NA	NA
WP_016211001.1|1067139_1067445_+	competence protein ComEA	NA	NA	NA	NA	NA
WP_016211002.1|1067608_1068007_+	VOC family protein	NA	NA	NA	NA	NA
WP_051307345.1|1068040_1068727_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211000.1|1068870_1069656_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_075274920.1|1069751_1070486_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	4.8e-10
WP_016210826.1|1071916_1072783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210824.1|1072892_1074572_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210830.1|1074698_1075949_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_032126465.1|1076024_1076486_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210835.1|1076482_1077631_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_016210836.1|1077636_1078311_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_052133275.1|1078340_1078964_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210828.1|1079079_1079553_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_016210832.1|1079554_1079977_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210829.1|1079963_1080983_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210831.1|1081252_1081798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|1081892_1082954_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212318.1|1083482_1083914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|1083915_1084242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212319.1|1084228_1084456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|1085014_1086460_-	MFS transporter	NA	NA	NA	NA	NA
WP_016212205.1|1086599_1086779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274918.1|1087462_1087828_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1087773_1088349_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212174.1|1089423_1089681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212177.1|1089757_1089931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|1090926_1091988_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|1091945_1092194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300443.1|1092246_1092525_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211538.1|1092763_1093687_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_016211536.1|1094381_1094615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211535.1|1094690_1096478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923739.1|1096689_1098198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212614.1|1098342_1098549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1098717_1099692_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 12
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	1120362	1247711	3130307	tRNA,transposase,protease	Staphylococcus_phage(17.65%)	119	NA	NA
WP_054300271.1|1120362_1121337_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212492.1|1121386_1122241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210459.1|1122445_1122964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210458.1|1126038_1126587_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_016210461.1|1126667_1126943_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_032126596.1|1126942_1127995_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_016210464.1|1128103_1130041_-	AsmA family protein	NA	NA	NA	NA	NA
WP_075275113.1|1130191_1131901_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_016210468.1|1131969_1132689_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_016210467.1|1132685_1133288_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210471.1|1133402_1134290_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|1134480_1134828_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210465.1|1134878_1135721_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_129556566.1|1136228_1136432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372565.1|1136340_1136712_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274914.1|1136760_1137636_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032126686.1|1138186_1138771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556565.1|1140240_1140636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273603.1|1140759_1140936_-	phosphatase	NA	NA	NA	NA	NA
WP_129556564.1|1142092_1142422_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046744.1|1143591_1143765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|1143821_1144187_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126745.1|1144258_1144861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122940402.1|1145069_1145693_+	porin family protein	NA	NA	NA	NA	NA
WP_016209896.1|1146007_1146577_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016209891.1|1146723_1147422_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_036777115.1|1147563_1147764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209884.1|1147840_1148464_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_016209882.1|1148573_1149467_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_016209898.1|1149573_1151184_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_016209888.1|1151180_1152476_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_016209876.1|1152497_1154420_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_016209881.1|1154530_1154833_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_016209893.1|1154925_1159815_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_016209883.1|1159869_1161186_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	9.4e-65
WP_129556563.1|1161304_1162405_+	FUSC family protein	NA	NA	NA	NA	NA
WP_016209878.1|1162456_1163395_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	29.6	1.9e-14
WP_080664826.1|1163475_1164075_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016209877.1|1164263_1165154_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_016209887.1|1165356_1165848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209894.1|1165991_1166483_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1166651_1167365_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556650.1|1167793_1168768_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209897.1|1169088_1169331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1169352_1169718_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1169663_1170239_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211960.1|1170482_1171010_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_129556649.1|1171549_1172407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|1172434_1173016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|1173585_1173771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556562.1|1173915_1174218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1174177_1174516_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211968.1|1174641_1175046_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1175058_1175199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126649.1|1175295_1176492_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_016211971.1|1176512_1177124_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_129556561.1|1177329_1178483_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	2.6e-58
WP_032126362.1|1178653_1179019_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1178964_1179540_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274909.1|1179638_1179965_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1180348_1180513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1180502_1180802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728345.1|1180842_1181451_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032126790.1|1181641_1182547_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_129556560.1|1182516_1183053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556559.1|1183133_1183562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212093.1|1183718_1184648_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_075273313.1|1184860_1185199_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377876.1|1185158_1185614_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212654.1|1185605_1185890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212100.1|1186300_1187221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212098.1|1187221_1188073_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1188780_1189827_+	glutathione synthase	NA	NA	NA	NA	NA
WP_032126840.1|1189810_1191808_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_122941967.1|1191986_1192292_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|1192521_1192728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|1192988_1193690_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211519.1|1193690_1194110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307348.1|1195265_1198022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211092.1|1198257_1199550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211091.1|1199593_1202074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211094.1|1203138_1203462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1203481_1204456_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211036.1|1204803_1206675_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_016211039.1|1206766_1208512_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211043.1|1208591_1209041_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211035.1|1209093_1209309_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211042.1|1209555_1210572_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211037.1|1210620_1211250_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211040.1|1211600_1212812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126170.1|1213039_1213312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556558.1|1213475_1214369_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556557.1|1214513_1214825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212394.1|1214872_1215577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211450.1|1216598_1217621_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211448.1|1217719_1218928_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211446.1|1218917_1220645_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_129556648.1|1220828_1221800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1222213_1223275_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126397.1|1223623_1224214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210561.1|1224328_1225663_-	dihydroorotase	NA	NA	NA	NA	NA
WP_016210568.1|1225790_1226432_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_016210566.1|1226737_1227160_+	universal stress protein	NA	NA	NA	NA	NA
WP_016210559.1|1227520_1228483_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_016210564.1|1228479_1228941_+	amidohydrolase	NA	NA	NA	NA	NA
WP_016210557.1|1228943_1229696_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_016210560.1|1229784_1231485_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_016210562.1|1233052_1234705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210558.1|1234778_1235534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|1237170_1237536_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211932.1|1237946_1239236_-	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_016211931.1|1239431_1240619_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211476.1|1240936_1241146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211473.1|1241129_1241729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211474.1|1241803_1243153_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_032126518.1|1243235_1245437_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211478.1|1245453_1246269_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126519.1|1246248_1246968_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_129556556.1|1247135_1247711_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	1290431	1473639	3130307	tRNA,transposase,integrase,protease	Leptospira_phage(12.5%)	176	1356116:1356175	1424655:1425884
WP_016209434.1|1290431_1291853_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016209437.1|1291883_1292405_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	2.0e-10
WP_016209438.1|1292401_1293001_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_016209440.1|1293078_1294089_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.9	1.5e-06
WP_016209415.1|1294201_1294906_+	protein TolQ	NA	NA	NA	NA	NA
WP_016209407.1|1294942_1295374_+	protein TolR	NA	NA	NA	NA	NA
WP_016209428.1|1295376_1296471_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_129556552.1|1296506_1297874_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_016209425.1|1297909_1298551_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032126507.1|1298593_1299523_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_016209451.1|1299525_1300173_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	37.9	1.2e-36
WP_032126506.1|1300223_1301027_-	AAA family ATPase	NA	A0A0E3G5H5	Synechococcus_phage	43.1	8.9e-42
WP_016209417.1|1301208_1301421_+	SlyX family protein	NA	NA	NA	NA	NA
WP_016209423.1|1301424_1301658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209422.1|1301719_1303300_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_016209426.1|1303501_1304431_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.3	1.6e-13
WP_016209420.1|1304432_1305200_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_032126509.1|1305604_1306321_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_016209442.1|1306358_1306721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209432.1|1306892_1308602_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016209448.1|1308859_1310191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209449.1|1310632_1312105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1312278_1313253_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300152.1|1313926_1314292_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274897.1|1314532_1315399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273512.1|1315911_1316256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210519.1|1316245_1317013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210521.1|1317248_1319186_-	his Kinase A domain protein	NA	NA	NA	NA	NA
WP_016210517.1|1320199_1320919_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_032126504.1|1321032_1324572_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_016210525.1|1324638_1325457_+	ZipA protein	NA	NA	NA	NA	NA
WP_016210518.1|1325443_1327483_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.8	3.0e-126
WP_016210522.1|1327498_1328551_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_016210524.1|1328561_1329092_+	exsB family protein	NA	NA	NA	NA	NA
WP_129556549.1|1329630_1330516_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046739.1|1331401_1331542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210010.1|1333186_1333363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210017.1|1333538_1333922_+	hpt domain protein	NA	NA	NA	NA	NA
WP_075273518.1|1333997_1334291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210016.1|1334457_1335417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210020.1|1336017_1336173_+	putative membrane protein	NA	NA	NA	NA	NA
WP_016210025.1|1336437_1337808_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210009.1|1337800_1338007_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016210012.1|1338082_1338754_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210005.1|1338734_1341539_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	2.4e-57
WP_016210027.1|1341618_1342215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|1342604_1343360_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210004.1|1343559_1344201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210021.1|1344461_1345787_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210023.1|1345783_1347841_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210007.1|1347818_1348391_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126616.1|1348446_1348806_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210019.1|1348870_1349905_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_122941592.1|1350162_1351014_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|1351108_1352092_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_016210013.1|1352248_1353916_+	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
WP_032126790.1|1354101_1355007_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211421.1|1355103_1355328_+	hypothetical protein	NA	NA	NA	NA	NA
1356116:1356175	attL	GGTAACCCTCCCTTAAAATGAGACAACTCATAACTGGAATCTTCTGTTAACATTTTCAAA	NA	NA	NA	NA
WP_032126239.1|1356186_1356459_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1356470_1357307_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075274733.1|1357357_1357675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1357693_1358269_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1358214_1358580_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300287.1|1358601_1358931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556547.1|1359339_1359900_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_155046738.1|1360176_1360317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556546.1|1360325_1361512_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	5.9e-58
WP_081377874.1|1361972_1362440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1362608_1362866_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274890.1|1362935_1363616_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_129556545.1|1363820_1364162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212209.1|1364416_1365418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1365873_1366173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|1366162_1366327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1366484_1366823_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1366782_1367238_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075274888.1|1367242_1367578_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274886.1|1367849_1368911_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211279.1|1369654_1372123_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_016211277.1|1372136_1373105_+	homoserine kinase	NA	NA	NA	NA	NA
WP_016211278.1|1373091_1374351_+	threonine synthase	NA	NA	NA	NA	NA
WP_129556646.1|1374402_1375788_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300295.1|1376598_1376823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126750.1|1377103_1377901_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016211170.1|1378059_1378230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211167.1|1378861_1379983_+	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	1.5e-10
WP_016211172.1|1380032_1381229_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_080664856.1|1381417_1382482_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_051307350.1|1382465_1383212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211165.1|1383201_1383930_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211168.1|1383926_1384586_+	wbqC-like family protein	NA	NA	NA	NA	NA
WP_016211169.1|1384569_1385517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|1385516_1386032_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211164.1|1386074_1386452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210396.1|1386589_1386778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210391.1|1386845_1387796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210393.1|1387889_1390091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210398.1|1390291_1391884_+	B-type flagellin	NA	NA	NA	NA	NA
WP_032126669.1|1392108_1393686_+	B-type flagellin	NA	NA	NA	NA	NA
WP_122940572.1|1393804_1394230_+	flaG family protein	NA	NA	NA	NA	NA
WP_016210394.1|1394340_1395726_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_032126670.1|1395751_1396189_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210390.1|1396193_1396535_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_016210399.1|1396549_1398541_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210388.1|1398566_1399241_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210397.1|1399237_1401412_-	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_054300550.1|1401601_1401967_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1402023_1402188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1402177_1402477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210772.1|1402609_1404163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|1404246_1405056_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_033923762.1|1405183_1405417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210769.1|1405717_1407220_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_016210773.1|1407523_1410217_+	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210771.1|1410213_1413615_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_054300162.1|1413706_1414789_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_129556544.1|1414851_1415208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274882.1|1415322_1415919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212246.1|1416854_1417511_+	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300162.1|1417614_1418697_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300271.1|1419036_1420011_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212247.1|1420638_1421394_-	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_036779544.1|1421760_1422768_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1422767_1423025_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1423522_1424359_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1424370_1424643_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274880.1|1425638_1426604_+|transposase	transposase	transposase	NA	NA	NA	NA
1424655:1425884	attR	TTTGAAAATGTTAACAGAAGATTCCAGTTATGAGTTGTCTCATTTTAAGGGAGGGTTACCTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCGAAGTATCAGCCATGATAAAGTCACACGCTTTTTAAATAAAAACCACTTTGGATCAAAAGAGCTCTGGAGCTATGTTAAAAAGCATGTTCGTCAGTATGAAGAAGAAGTTGGAGGCGTTTTAAGTCTGGATGATACCGTGGAAGAAAAGCCTTATACAGATGAGAATGATGTGGTTTGTTGGCATTATTCACACAGCAAAAGCGCTCATGTAAAGGGAATTAATATTTTGACAAGTATGGTGACTTACAAG	NA	NA	NA	NA
WP_016212058.1|1426759_1428310_+	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_081377873.1|1428952_1429789_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.9	4.6e-41
WP_032126239.1|1429800_1430073_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556543.1|1430164_1430647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209453.1|1430756_1430906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209496.1|1431073_1431286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664817.1|1431315_1432089_+	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209485.1|1432113_1433136_+	chorismate mutase	NA	NA	NA	NA	NA
WP_032126728.1|1433188_1434493_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_052133284.1|1434483_1435050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209460.1|1435039_1436122_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.1	1.0e-72
WP_016209465.1|1436168_1437269_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_016209488.1|1437309_1437798_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_052047096.1|1437947_1438637_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016209481.1|1438839_1439166_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_016209480.1|1439215_1439443_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_016209484.1|1439454_1439907_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209475.1|1440116_1441538_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	1.7e-152
WP_016209491.1|1441570_1442668_+	alanine racemase	NA	NA	NA	NA	NA
WP_016209456.1|1442692_1443424_-	mannosyl-glycoendo-beta-N-acetylglucosaminidase family protein	NA	M1IDP9	Pelagibacter_phage	35.8	5.3e-09
WP_016209472.1|1443537_1444908_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_032126730.1|1445010_1445499_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_016209463.1|1445853_1446237_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_016209490.1|1446663_1446987_+	YqcC family protein	NA	NA	NA	NA	NA
WP_129556645.1|1447077_1449027_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_016209478.1|1449118_1450072_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209459.1|1450235_1451402_-	rasGEF domain protein	NA	NA	NA	NA	NA
WP_075273528.1|1451661_1452627_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_016209455.1|1452807_1453854_+	membrane protein	NA	NA	NA	NA	NA
WP_016209467.1|1453846_1454872_+	FUSC family protein	NA	NA	NA	NA	NA
WP_016209494.1|1454941_1456966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664818.1|1457647_1457983_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016209474.1|1458124_1458535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209462.1|1458544_1458688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209471.1|1458697_1459024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664819.1|1459170_1460208_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_016209486.1|1460249_1460501_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_129556541.1|1460625_1460940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209458.1|1460947_1462522_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_016209457.1|1462665_1463247_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_016209482.1|1463546_1465349_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	39.2	5.1e-21
WP_129556644.1|1465399_1466287_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209466.1|1466692_1467367_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	34.5	8.9e-27
WP_016209492.1|1467372_1468272_+	GTPase Era	NA	NA	NA	NA	NA
WP_016209497.1|1468285_1469029_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_016209489.1|1469031_1469763_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_016209473.1|1469759_1470143_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_016212202.1|1471104_1472352_-	glutaminase	NA	NA	NA	NA	NA
WP_075274878.1|1472763_1473639_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	1478080	1522211	3130307	transposase,integrase	Escherichia_phage(16.67%)	46	1493206:1493265	1522978:1523268
WP_075273327.1|1478080_1478656_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1478669_1478960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|1478905_1479481_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212551.1|1479822_1480317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556643.1|1480774_1482139_-	histidine kinase	NA	NA	NA	NA	NA
WP_016211983.1|1482234_1482894_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556539.1|1483141_1483486_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300307.1|1483554_1484283_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_075274875.1|1484329_1484632_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211212.1|1484914_1486474_-	APC family permease	NA	NA	NA	NA	NA
WP_016211215.1|1486834_1488805_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211211.1|1488996_1490076_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211213.1|1490124_1490331_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211210.1|1490337_1491819_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016211214.1|1491921_1492485_-	hypothetical protein	NA	NA	NA	NA	NA
1493206:1493265	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_016211942.1|1494247_1495507_+	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211940.1|1495627_1495960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1496073_1497048_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016211341.1|1497192_1497363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211343.1|1497561_1498584_+	YHYH protein	NA	NA	NA	NA	NA
WP_016211342.1|1498591_1500274_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.1e-32
WP_016211344.1|1500434_1501253_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211347.1|1501466_1502450_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211340.1|1502442_1502664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211346.1|1502691_1503333_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_105962625.1|1504482_1505368_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1505372_1505660_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_036774554.1|1505712_1505991_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126998.1|1506089_1506437_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_032126997.1|1506758_1506998_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075273532.1|1507215_1507803_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300314.1|1507763_1508099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211315.1|1508286_1508931_-	porin family protein	NA	NA	NA	NA	NA
WP_016211316.1|1509265_1509916_-	porin family protein	NA	NA	NA	NA	NA
WP_016211319.1|1510448_1511501_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032126786.1|1511518_1514599_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_075274874.1|1514897_1515266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1515266_1515842_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1515787_1516153_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274873.1|1516174_1516672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274872.1|1517146_1517686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556536.1|1517645_1518798_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_081377871.1|1518801_1519494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1519698_1519956_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556535.1|1520145_1521032_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377829.1|1521476_1522211_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
1522978:1523268	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTTT	NA	NA	NA	NA
>prophage 15
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	1551833	1607091	3130307	tRNA,transposase	Bacillus_thuringiensis_phage(20.0%)	47	NA	NA
WP_016209621.1|1551833_1552838_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209619.1|1553270_1554719_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209620.1|1554805_1557862_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_080664820.1|1557844_1558015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556532.1|1558323_1558506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212485.1|1558802_1559336_-	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_075273327.1|1560088_1560664_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1560609_1560975_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126753.1|1561067_1561532_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_016211466.1|1561601_1563122_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126752.1|1563209_1563812_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211464.1|1563808_1564156_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_016211465.1|1564306_1565290_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_016211462.1|1565917_1566898_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_052047087.1|1567058_1567277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274864.1|1567448_1568474_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212346.1|1571314_1571461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1571694_1572558_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211749.1|1572766_1573960_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211748.1|1574039_1575644_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211752.1|1575659_1576805_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_129556531.1|1577009_1577207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1577169_1577508_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1577467_1577923_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_081007023.1|1578097_1578754_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016212534.1|1578830_1579097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211725.1|1580667_1581582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211728.1|1581620_1583555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211726.1|1583942_1584536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274862.1|1584707_1585304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046732.1|1585418_1585589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300325.1|1585782_1586055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211456.1|1586676_1587255_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_122942091.1|1587282_1587678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211455.1|1587783_1589241_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_016211452.1|1589302_1590790_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211454.1|1591540_1592011_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1592151_1592727_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1592672_1593038_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556641.1|1596912_1598175_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_016210751.1|1598262_1600068_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_016210752.1|1600551_1601349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210749.1|1601518_1601980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1602278_1604234_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1604913_1605099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212185.1|1605432_1606422_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_075273327.1|1606515_1607091_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	1613259	1669052	3130307	transposase	Staphylococcus_phage(42.86%)	57	NA	NA
WP_098082828.1|1613259_1613517_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047040.1|1613586_1614525_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_051307338.1|1614550_1616116_-	APC family permease	NA	NA	NA	NA	NA
WP_016210800.1|1616325_1617153_-	DsbA family protein	NA	NA	NA	NA	NA
WP_075273540.1|1617519_1618131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556527.1|1618315_1618576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210799.1|1619037_1619991_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_016210791.1|1620417_1620618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307339.1|1620992_1621799_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210795.1|1621904_1622876_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210801.1|1622857_1623829_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210793.1|1624151_1624832_-	OmpW family protein	NA	NA	NA	NA	NA
WP_081007004.1|1624833_1625289_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1625248_1625587_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211352.1|1625760_1626201_-	universal stress protein	NA	NA	NA	NA	NA
WP_016211350.1|1626879_1627818_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211349.1|1627881_1629876_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_032127067.1|1629872_1630475_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211351.1|1630471_1630810_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_129556640.1|1630885_1632112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1632378_1633353_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211856.1|1633568_1633754_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_016211855.1|1633880_1634348_+	bacterioferritin	NA	NA	NA	NA	NA
WP_016211857.1|1634344_1635223_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_032126602.1|1635473_1636781_+	MFS transporter	NA	NA	NA	NA	NA
WP_081007004.1|1636933_1637389_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1637348_1637687_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|1638648_1639554_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211738.1|1639624_1640269_+	membrane protein	NA	NA	NA	NA	NA
WP_016211741.1|1640745_1641522_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126783.1|1641667_1642909_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211739.1|1643019_1643526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211736.1|1643642_1643843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274822.1|1643866_1644841_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_129556526.1|1644899_1645685_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.8	1.3e-45
WP_016212445.1|1645681_1645948_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016211177.1|1646162_1647383_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126450.1|1647750_1649745_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211185.1|1649857_1650466_-	smr domain protein	NA	NA	NA	NA	NA
WP_032126449.1|1650532_1651456_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016211180.1|1651476_1651941_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_016211178.1|1652003_1653032_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_032126448.1|1653122_1653503_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_016211182.1|1653534_1653864_+	DUF4404 family protein	NA	NA	NA	NA	NA
WP_016212475.1|1654848_1655055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1655252_1656227_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556525.1|1656302_1657123_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210855.1|1657276_1658254_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016210849.1|1658371_1659820_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210847.1|1659848_1660853_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210851.1|1660875_1661547_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210850.1|1661531_1662785_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1663033_1663588_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210848.1|1663883_1665068_+	MFS transporter	NA	NA	NA	NA	NA
WP_051307341.1|1665234_1666833_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_081007030.1|1667526_1668498_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377870.1|1668533_1669052_+|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	31.0	1.6e-07
>prophage 17
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	1697078	1735920	3130307	tRNA,transposase	Staphylococcus_phage(20.0%)	31	NA	NA
WP_129556523.1|1697078_1697965_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274822.1|1698300_1699275_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_054300148.1|1699372_1700434_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1700988_1701963_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273327.1|1702653_1703229_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1703174_1703540_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274858.1|1703676_1704762_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274857.1|1706341_1707217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126678.1|1707227_1708238_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_016211554.1|1708564_1709191_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_016211557.1|1709236_1710466_+	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_032126677.1|1710660_1711224_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211555.1|1711298_1712657_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_016211664.1|1713193_1713922_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211666.1|1714294_1717114_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211669.1|1717268_1717619_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556522.1|1720727_1721960_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211405.1|1722166_1723939_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_016211403.1|1724074_1725118_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_016211399.1|1725131_1725875_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016211398.1|1726021_1726309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|1726913_1727612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211734.1|1728033_1728303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211731.1|1728318_1729425_+	protein kinase	NA	NA	NA	NA	NA
WP_016211733.1|1729480_1730305_-	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_075274856.1|1732060_1733086_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046730.1|1733304_1733445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1733712_1734360_-	LysE family translocator	NA	NA	NA	NA	NA
WP_016212267.1|1734640_1735000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|1735166_1735622_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273804.1|1735581_1735920_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	1746185	1846080	3130307	tRNA,transposase,integrase,protease	Staphylococcus_phage(20.0%)	96	1816596:1816655	1851080:1851160
WP_105962625.1|1746185_1747071_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556521.1|1747605_1747794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556520.1|1747744_1748641_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	1.8e-54
WP_032126362.1|1748601_1748967_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1748912_1749488_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|1749563_1749857_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_155046729.1|1750074_1751121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211631.1|1751379_1752186_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_016211634.1|1752441_1753263_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211632.1|1753298_1754153_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016211627.1|1754378_1754543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377868.1|1754848_1755505_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016210103.1|1755580_1756939_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_016210117.1|1757220_1757580_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210111.1|1758000_1759635_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_017377579.1|1759641_1760478_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210099.1|1760499_1761777_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_016210105.1|1761860_1762181_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210106.1|1762200_1763292_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_016210102.1|1763474_1765064_+	APC family permease	NA	NA	NA	NA	NA
WP_016210110.1|1765124_1765880_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	5.4e-65
WP_016210113.1|1766067_1767117_+	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.5	7.9e-30
WP_016210101.1|1767539_1769036_+	flagellin domain protein	NA	NA	NA	NA	NA
WP_016210107.1|1769325_1769598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210114.1|1769669_1770929_-	calcineurin-like phosphoesterase	NA	NA	NA	NA	NA
WP_016210108.1|1771021_1772287_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	9.1e-49
WP_122943012.1|1772472_1772928_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_016210112.1|1773044_1774472_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.0	2.5e-55
WP_032126690.1|1775165_1775648_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_052047138.1|1781694_1781928_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046728.1|1782190_1783165_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	6.8e-28
WP_155049900.1|1783293_1783599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211563.1|1783947_1784109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211564.1|1784141_1785017_-	ParA family protein	NA	NA	NA	NA	NA
WP_016211561.1|1785182_1789049_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_080728343.1|1789130_1789271_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_081007034.1|1789252_1789537_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_032126538.1|1789801_1791220_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_016211991.1|1792128_1793034_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126537.1|1793274_1793460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211994.1|1793496_1794033_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_016212348.1|1795451_1796681_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_075274849.1|1796675_1797419_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126239.1|1797544_1797817_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1797828_1798665_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_129556517.1|1798683_1798971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1799368_1800343_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300271.1|1800990_1801965_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212012.1|1802201_1802879_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016212013.1|1802894_1803278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212011.1|1803499_1804621_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_075274847.1|1804854_1805730_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211974.1|1806012_1807134_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075273551.1|1807233_1807536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556638.1|1807535_1808216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377865.1|1809560_1809845_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664876.1|1810203_1812066_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_033923779.1|1812378_1813215_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1813226_1813499_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556516.1|1813593_1814097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275108.1|1814455_1815061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1815037_1816012_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046727.1|1816255_1816600_+	hypothetical protein	NA	NA	NA	NA	NA
1816596:1816655	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_129556515.1|1817425_1817785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1817803_1818076_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1818087_1818924_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075274844.1|1818932_1819184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|1819364_1820339_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016211144.1|1820895_1821525_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_016211152.1|1821508_1821931_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211145.1|1821937_1823677_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211153.1|1823677_1824742_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1824745_1825099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1825211_1826168_+	ferrochelatase	NA	NA	NA	NA	NA
WP_016211151.1|1826177_1826489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1826504_1827074_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211148.1|1827337_1828666_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_081377864.1|1828747_1828987_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1829000_1829837_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1829848_1830121_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1830205_1831180_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210841.1|1831393_1831765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210839.1|1831823_1832597_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_129556514.1|1832748_1835205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126340.1|1835484_1836246_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556513.1|1836326_1838072_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016210844.1|1838247_1839375_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.2	5.7e-10
WP_016210843.1|1839461_1839692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556637.1|1840306_1841086_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016212589.1|1841560_1841998_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300363.1|1842421_1842769_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556512.1|1842714_1843290_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212275.1|1843279_1844263_-	MFS transporter	NA	NA	NA	NA	NA
WP_051307372.1|1844378_1844768_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036774189.1|1844815_1845823_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1845822_1846080_-|transposase	transposase	transposase	NA	NA	NA	NA
1851080:1851160	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCC	NA	NA	NA	NA
>prophage 19
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	1872930	1932040	3130307	tRNA,transposase	uncultured_Mediterranean_phage(30.77%)	55	NA	NA
WP_016211804.1|1872930_1874316_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
WP_016211805.1|1874322_1875861_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211806.1|1875903_1876629_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_032126239.1|1877418_1877691_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1877702_1878539_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_129556510.1|1879062_1880166_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	7.3e-10
WP_054300405.1|1880267_1880768_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016209947.1|1881289_1881952_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_016209946.1|1881978_1883208_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209940.1|1883364_1886136_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_016209937.1|1886211_1886655_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209931.1|1886807_1888280_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_016209926.1|1888391_1889453_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209945.1|1889449_1890484_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209932.1|1890486_1891527_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209936.1|1891709_1892825_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.6	1.4e-93
WP_016209930.1|1892863_1893217_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_032126634.1|1893237_1895106_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209935.1|1895127_1896072_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_016209925.1|1896305_1896584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1896793_1897432_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209944.1|1897406_1898834_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209927.1|1899034_1899712_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209939.1|1899846_1901121_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209943.1|1901188_1901944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209948.1|1901995_1902913_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_016209929.1|1903021_1903915_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075274822.1|1905373_1906348_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016211771.1|1906640_1906829_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_016211770.1|1906842_1907976_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_075274823.1|1908175_1912186_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211823.1|1912220_1912409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211827.1|1912449_1913070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1913401_1913755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1913968_1914163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|1914828_1915356_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300400.1|1915412_1915655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300399.1|1915799_1916066_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210885.1|1916407_1917289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|1917346_1917943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|1917975_1918749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|1919282_1919579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210888.1|1919601_1919853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155053505.1|1919798_1920521_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210886.1|1920589_1921369_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_016210887.1|1921451_1922402_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210889.1|1922911_1925758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556636.1|1925775_1926084_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016212002.1|1927037_1927316_-	DNA-J related family protein	NA	NA	NA	NA	NA
WP_016212000.1|1927435_1928164_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016211998.1|1928294_1928858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211999.1|1928847_1929201_-	ras family protein	NA	NA	NA	NA	NA
WP_033923779.1|1929580_1930417_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1930428_1930701_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274825.1|1930978_1932040_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	1968854	2055276	3130307	tRNA,transposase	Bacillus_phage(15.0%)	83	NA	NA
WP_075274826.1|1968854_1969760_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1970016_1971288_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_016211218.1|1971312_1972050_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1972302_1973445_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1973461_1975063_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1975574_1975712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1975708_1976986_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|1977335_1977518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126600.1|1977789_1978311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212250.1|1978433_1979084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212251.1|1979245_1979782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300384.1|1979943_1980759_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075274828.1|1981167_1982490_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	1.2e-11
WP_052133287.1|1982591_1982990_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212039.1|1983178_1983736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212040.1|1983912_1985262_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_054300162.1|1985465_1986548_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016210803.1|1986622_1987921_-	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_016210808.1|1988098_1988950_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_016210805.1|1988958_1989630_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_032126141.1|1990039_1991314_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016210804.1|1991378_1993298_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.0	4.5e-84
WP_032126139.1|1993304_1994234_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_033923779.1|1996902_1997739_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075274829.1|1997750_1998023_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1998046_1999021_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046725.1|1999064_1999205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300382.1|1999421_1999844_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377858.1|2000062_2000773_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2000976_2001342_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2001356_2001863_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211414.1|2002078_2002897_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|2003004_2003466_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211415.1|2003482_2004406_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211417.1|2004429_2005479_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_051307357.1|2005615_2006209_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211422.1|2006231_2006702_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_032126143.1|2006790_2008062_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_075274832.1|2008161_2009136_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_016211838.1|2009447_2009621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211840.1|2010091_2010556_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211839.1|2010714_2012187_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211841.1|2012304_2012757_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|2013616_2014678_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|2014980_2016063_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212483.1|2016073_2016871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2016867_2017443_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2017388_2017754_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300380.1|2017855_2018512_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556508.1|2018782_2019226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|2019287_2019581_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556507.1|2019697_2020384_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	48.3	5.5e-48
WP_075273327.1|2020373_2020949_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2020894_2021260_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212421.1|2021751_2021934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2022684_2023659_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556505.1|2023699_2024665_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211470.1|2025431_2026085_+	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_016211471.1|2026144_2028130_-	sodium/hydrogen exchanger family protein	NA	NA	NA	NA	NA
WP_032126343.1|2028260_2029073_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_032126344.1|2029193_2030282_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_016211467.1|2030284_2030851_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_155066179.1|2030925_2031811_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052047029.1|2031978_2032320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2032392_2033454_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032127044.1|2033657_2033858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|2034759_2035053_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556503.1|2036114_2036981_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	5.6e-58
WP_016210508.1|2036989_2038687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210507.1|2039007_2039556_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_075273576.1|2039683_2040412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|2040471_2043969_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_016210514.1|2044026_2045280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210515.1|2045388_2046291_-	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210512.1|2046344_2047382_-	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210506.1|2047517_2048756_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210510.1|2048748_2049477_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_081007040.1|2049507_2050164_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211831.1|2050301_2052029_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016211829.1|2052329_2052683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|2053098_2053599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047133.1|2054250_2054697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2054700_2055276_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	2091121	2204426	3130307	tRNA,transposase,protease	Vibrio_phage(13.33%)	94	NA	NA
WP_016209848.1|2091121_2093716_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209832.1|2094022_2094286_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209831.1|2094564_2095263_-	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209841.1|2095482_2095677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209827.1|2095752_2097312_-	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_129556633.1|2097630_2098527_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209845.1|2098743_2100219_-	APC family permease	NA	NA	NA	NA	NA
WP_016209826.1|2100741_2101764_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_016209830.1|2102094_2103462_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209846.1|2103697_2103952_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126639.1|2103967_2105254_+	GTPase HflX	NA	NA	NA	NA	NA
WP_016209836.1|2105273_2106488_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_016209838.1|2106487_2107381_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209839.1|2107578_2108877_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209829.1|2110256_2112656_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209834.1|2112652_2113411_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209842.1|2113587_2113977_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016212367.1|2114704_2115562_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_155046721.1|2116703_2116871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274836.1|2117051_2117942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046720.1|2118079_2118253_-	phosphatase	NA	NA	NA	NA	NA
WP_129556500.1|2118707_2119094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210154.1|2119215_2119908_+	haloacid dehalogenase	NA	NA	NA	NA	NA
WP_016210155.1|2119946_2120756_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.9	3.8e-16
WP_016210149.1|2120761_2122006_-	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210156.1|2122039_2123908_-	ferric iron reductase FhuF-like transporter family protein	NA	NA	NA	NA	NA
WP_080664835.1|2123900_2125127_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664836.1|2125114_2126965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210150.1|2126949_2128155_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_016210144.1|2128166_2130356_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_016210157.1|2130898_2131528_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075273564.1|2131550_2131970_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016210153.1|2131962_2132367_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_032126761.1|2132420_2133242_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_016210142.1|2133301_2134282_+	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210160.1|2134262_2136260_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_016210147.1|2136272_2137445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210148.1|2138305_2138524_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_032126762.1|2139359_2141387_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_016211282.1|2141468_2142719_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211281.1|2143013_2143349_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_016211283.1|2143660_2143909_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_016211280.1|2143944_2144454_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211285.1|2144453_2145233_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_016211286.1|2145250_2145598_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_016211289.1|2145709_2145982_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211767.1|2147310_2148120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211764.1|2148670_2149492_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126803.1|2149692_2150925_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_081377862.1|2151411_2152248_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2152259_2152532_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046719.1|2152550_2152709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|2154927_2155743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211525.1|2158042_2160778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275102.1|2161366_2161825_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377901.1|2162005_2162716_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126856.1|2162776_2163118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|2163422_2164576_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016212005.1|2165476_2167237_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_016210592.1|2167626_2168283_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016210586.1|2168295_2169801_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210593.1|2169822_2170353_-	colicin V production protein	NA	NA	NA	NA	NA
WP_016210590.1|2170432_2171695_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210587.1|2171869_2172730_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_032126176.1|2172831_2173614_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210588.1|2173704_2175030_-	fimV domain protein	NA	NA	NA	NA	NA
WP_016210595.1|2175397_2176576_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210594.1|2176752_2177406_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_016210596.1|2177541_2179482_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	3.1e-72
WP_129556498.1|2179478_2180087_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075275098.1|2180599_2181529_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.1e-24
WP_080728317.1|2181719_2185085_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211391.1|2185151_2185727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211393.1|2185738_2187295_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_016211396.1|2187314_2187665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211395.1|2187661_2187997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372269.1|2188353_2188725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212466.1|2188929_2189655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212252.1|2189969_2190128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212254.1|2190165_2191608_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_075273327.1|2191597_2192173_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|2192118_2192409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2192422_2192998_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2192943_2193309_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274672.1|2193480_2194074_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211114.1|2194439_2197370_-	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_016211115.1|2197502_2199455_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211112.1|2199647_2200295_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211113.1|2200350_2201676_+	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_032126179.1|2201705_2201957_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_080664854.1|2201914_2202496_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_054300408.1|2202832_2203489_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_032126362.1|2203539_2203905_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275097.1|2203850_2204426_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	2233882	2341999	3130307	tRNA,transposase	Acinetobacter_phage(11.11%)	115	NA	NA
WP_105962623.1|2233882_2235036_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016211588.1|2235203_2235905_-	cyclase family protein	NA	NA	NA	NA	NA
WP_032126329.1|2235980_2236610_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_129556496.1|2236795_2238034_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_016211592.1|2238308_2238971_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_016211589.1|2238960_2240193_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_129556495.1|2240315_2240573_+	VOC family protein	NA	NA	NA	NA	NA
WP_032126637.1|2241553_2241847_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_032126540.1|2242077_2242941_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2243074_2243440_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2243385_2243961_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126332.1|2244607_2245807_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_016211366.1|2246059_2246347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126331.1|2246402_2248412_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_032126330.1|2248466_2249426_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_016211367.1|2249573_2250356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664860.1|2250511_2250949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2250912_2251488_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2251433_2251799_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210269.1|2251836_2252187_+	L,D-transpeptidase catalytic domain protein	NA	NA	NA	NA	NA
WP_016210281.1|2252200_2253592_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_016210270.1|2253633_2256621_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210277.1|2256690_2257524_-	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210279.1|2257577_2258744_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210272.1|2258731_2259442_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210283.1|2259481_2260267_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_129556492.1|2260294_2261038_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|2261135_2263331_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_016210271.1|2263415_2264099_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_032126334.1|2264109_2264541_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_016210274.1|2264580_2264979_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_016210273.1|2265351_2266059_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210275.1|2266123_2266426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210276.1|2266481_2266958_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210284.1|2267012_2267534_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210280.1|2267615_2268710_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_054300412.1|2268946_2269261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273307.1|2269405_2269816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275091.1|2270086_2270572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556631.1|2271580_2271748_+	phosphatase	NA	NA	NA	NA	NA
WP_075275089.1|2271892_2272225_+	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	37.3	8.0e-05
WP_032126500.1|2272358_2273075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211118.1|2273211_2274459_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126499.1|2274837_2275449_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211122.1|2275545_2276412_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|2276415_2277177_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_016211128.1|2277340_2278246_+	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211125.1|2278468_2279299_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211126.1|2279468_2279858_+	lipoprotein	NA	NA	NA	NA	NA
WP_032126498.1|2279990_2280551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2280612_2280978_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2280923_2281499_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212621.1|2281495_2281900_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_016212585.1|2282194_2282515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274822.1|2282626_2283601_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_075273327.1|2283970_2284546_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2284491_2284857_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275086.1|2284817_2285816_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212356.1|2285793_2286639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047081.1|2286689_2287127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212519.1|2287397_2287778_-	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_075275084.1|2287852_2288914_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212611.1|2288961_2289282_-	histidine kinase	NA	NA	NA	NA	NA
WP_081377357.1|2289765_2290167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285940.1|2290251_2291073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126778.1|2291287_2291482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211088.1|2291660_2292623_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211087.1|2292842_2293838_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_016211081.1|2293865_2294801_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|2294841_2295303_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080664852.1|2295281_2296325_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016211090.1|2296337_2297972_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_080664853.1|2297931_2299674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|2300397_2302434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046717.1|2304690_2304840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274676.1|2304998_2305196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212323.1|2305270_2305543_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_122941816.1|2305619_2305928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212326.1|2306014_2306212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|2306437_2307323_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556489.1|2307327_2308524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2308769_2309831_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126869.1|2309808_2310048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2310568_2311144_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2311089_2311455_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2311685_2312261_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2312206_2312572_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|2313452_2314316_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556488.1|2315464_2316315_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275079.1|2316463_2317525_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126801.1|2317572_2318082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2318752_2319835_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300173.1|2319960_2321022_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212218.1|2322471_2322822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275077.1|2322966_2323803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2323887_2324793_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016210899.1|2325292_2327176_-	APC family permease	NA	NA	NA	NA	NA
WP_016210896.1|2327229_2328312_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210904.1|2328354_2329005_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210903.1|2329225_2329597_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_129556487.1|2329715_2331053_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210897.1|2331131_2332112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210894.1|2332452_2332755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|2333229_2333520_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210898.1|2333608_2333959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300269.1|2334870_2335239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2335260_2335626_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2335682_2335847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007012.1|2335836_2336007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275075.1|2336001_2337063_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273492.1|2337171_2337291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556486.1|2337381_2337729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556630.1|2337814_2339164_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211781.1|2339473_2340721_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_081377899.1|2341135_2341999_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	2356428	2403972	3130307	transposase,integrase	Bacillus_phage(16.67%)	48	2393890:2393949	2411174:2411613
WP_054300148.1|2356428_2357490_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273490.1|2357730_2359023_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_016211426.1|2360005_2361448_-	MFS transporter	NA	NA	NA	NA	NA
WP_129556484.1|2361791_2363252_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_129556469.1|2363753_2364062_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300265.1|2364021_2364282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300264.1|2364426_2364765_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_075275071.1|2364867_2365842_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212461.1|2366217_2366592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|2366595_2367171_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2367116_2367482_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300262.1|2367944_2368235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210542.1|2368226_2369933_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.9	2.5e-25
WP_051307331.1|2370004_2371783_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_016210552.1|2372137_2372704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210553.1|2372828_2373482_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_032126547.1|2373508_2374951_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210545.1|2375047_2376025_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_129556482.1|2376173_2376779_+	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_026063577.1|2376850_2377144_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556629.1|2377370_2378117_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_016210541.1|2378347_2378575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|2378639_2378822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|2379258_2379813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046716.1|2380510_2380657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212107.1|2381061_2382198_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_052047108.1|2383009_2383408_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275068.1|2383509_2384100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2384184_2384550_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2384495_2385071_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211578.1|2385428_2385773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|2385788_2385983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|2386049_2386403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211582.1|2386500_2387280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211585.1|2387341_2387899_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016211581.1|2388017_2388788_-	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.9	8.9e-31
WP_016211583.1|2389064_2389973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211579.1|2390040_2390526_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054300162.1|2390749_2391832_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_129556481.1|2392089_2392521_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_016212302.1|2392705_2393005_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_054300271.1|2393318_2394293_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
2393890:2393949	attL	TAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAG	NA	NA	NA	NA
WP_129556480.1|2394316_2399806_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_016211300.1|2400317_2401358_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_054300162.1|2401408_2402491_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036781387.1|2402635_2402908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|2402900_2403179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126152.1|2403381_2403972_+|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
2411174:2411613	attR	TAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
>prophage 24
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	2410222	2464675	3130307	transposase,protease	Bacillus_phage(15.38%)	45	NA	NA
WP_075273327.1|2410222_2410798_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274918.1|2410743_2411109_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556479.1|2411596_2411779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212436.1|2411992_2412403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|2412741_2413627_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033923634.1|2413617_2414166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126157.1|2414370_2414775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|2415061_2416954_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_016211512.1|2417296_2418103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307360.1|2419194_2420124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2420963_2421329_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|2421500_2422475_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273512.1|2422611_2422956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275067.1|2423711_2424779_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_059372266.1|2425111_2425597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556477.1|2425686_2427168_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_016209659.1|2427327_2428356_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_016209654.1|2428420_2429563_+	galactokinase	NA	NA	NA	NA	NA
WP_016209656.1|2429681_2431385_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209642.1|2431381_2433502_+	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209652.1|2433498_2434848_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209662.1|2434819_2436967_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209657.1|2437394_2437790_+	CrcB family protein	NA	NA	NA	NA	NA
WP_016209643.1|2437798_2438683_-	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_032126162.1|2438714_2440592_-	SurA domain-containing protein	NA	NA	NA	NA	NA
WP_016209655.1|2440695_2440968_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_032126161.1|2441071_2443504_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209663.1|2443571_2444873_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_016209647.1|2444954_2445560_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209645.1|2445672_2446977_-	trigger factor	NA	NA	NA	NA	NA
WP_016209661.1|2447580_2448456_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_075273478.1|2448571_2449243_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209658.1|2449419_2450775_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_016209641.1|2450895_2451633_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032126159.1|2451712_2452426_-	aldolase	NA	NA	NA	NA	NA
WP_016209651.1|2453052_2454327_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2454357_2454933_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209649.1|2454977_2455943_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209640.1|2456401_2457421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|2457839_2458814_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_129556476.1|2458909_2459920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211684.1|2460464_2461040_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016211685.1|2461063_2462869_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211687.1|2462899_2463544_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_033923708.1|2463799_2464675_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	2481362	2528030	3130307	tRNA,transposase	Staphylococcus_phage(28.57%)	39	NA	NA
WP_054300173.1|2481362_2482424_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210741.1|2483109_2483433_+	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_016210746.1|2483439_2487336_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210744.1|2487432_2487918_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210743.1|2487958_2489539_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_016210739.1|2489607_2491065_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210737.1|2491220_2493197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|2493515_2494136_-	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_016210742.1|2494301_2494577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2494727_2495702_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212172.1|2495721_2497194_-	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_075275065.1|2498084_2498759_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.9e-10
WP_054300173.1|2499058_2500120_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211822.1|2500429_2500843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211818.1|2501199_2502456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|2502658_2503159_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211819.1|2503455_2503686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556627.1|2503904_2504510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2504562_2505624_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2505650_2506226_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2506171_2506537_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052047106.1|2507252_2507729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2507802_2508378_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2508323_2508689_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212417.1|2508739_2508985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212416.1|2509108_2509639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|2509640_2510096_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273456.1|2510055_2510355_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274832.1|2510477_2511452_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_016209398.1|2512016_2513243_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|2513841_2515548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664814.1|2515715_2516936_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209395.1|2517184_2519875_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_016209384.1|2520166_2520982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126585.1|2521332_2522253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556473.1|2522794_2523883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209380.1|2524015_2524438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209368.1|2525013_2526543_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_016209374.1|2526578_2528030_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 26
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	2563460	2616644	3130307	tRNA,transposase,protease	Prochlorococcus_phage(33.33%)	52	NA	NA
WP_075273327.1|2563460_2564036_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2563981_2564347_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275125.1|2566483_2567527_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210612.1|2569118_2570369_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016210605.1|2570357_2571239_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210611.1|2571231_2572317_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210607.1|2572313_2573573_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210598.1|2573741_2574401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556471.1|2574542_2575214_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210609.1|2575573_2576509_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_016210606.1|2576605_2577232_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210603.1|2577237_2577819_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210601.1|2577890_2578982_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210599.1|2579064_2579778_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_122940948.1|2579871_2580576_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300148.1|2580898_2581960_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126800.1|2582084_2582819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046715.1|2583367_2583613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556470.1|2583912_2584798_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209916.1|2585035_2586007_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	3.7e-34
WP_016209900.1|2586198_2587668_-	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_016209924.1|2587661_2589038_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209906.1|2589049_2589442_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209919.1|2589438_2590542_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_032126654.1|2590720_2592022_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209907.1|2592029_2592977_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_016209913.1|2592988_2593807_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_032126655.1|2593809_2594610_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209910.1|2594603_2595662_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_016209903.1|2595658_2596669_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209904.1|2596675_2596873_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209914.1|2596933_2599840_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209918.1|2599881_2600736_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_032126652.1|2600768_2601335_-	chorismate lyase	NA	NA	NA	NA	NA
WP_016209915.1|2601417_2602278_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016209922.1|2602369_2602786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209912.1|2602845_2603343_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209920.1|2603388_2606343_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_016209901.1|2606372_2606705_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_016209923.1|2606822_2607341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209908.1|2607815_2608526_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209899.1|2608522_2609557_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_032126651.1|2609660_2609846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275054.1|2609966_2610332_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2610277_2610853_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212369.1|2610856_2611303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212599.1|2612537_2612747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275052.1|2612796_2613306_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275050.1|2613450_2614146_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|2614221_2615127_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_129556469.1|2615920_2616229_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080743011.1|2616188_2616644_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	2653723	2792707	3130307	tRNA,transposase,integrase,plate	Escherichia_phage(32.14%)	140	2758663:2758722	2772448:2772639
WP_032126187.1|2653723_2654122_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_051307310.1|2654121_2655594_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_129556464.1|2655599_2656091_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_016209516.1|2656080_2657550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|2657554_2658247_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|2658224_2659253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126188.1|2659246_2660473_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209501.1|2660478_2661990_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_016209510.1|2662251_2662689_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209523.1|2662739_2664089_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209529.1|2664093_2664804_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_016209536.1|2664816_2667987_+	intracellular multiplication and macrophage-killing family protein	NA	NA	NA	NA	NA
WP_016209533.1|2669848_2670169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126191.1|2670313_2670835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376335.1|2670967_2671768_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_016210437.1|2671866_2672442_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.5	3.7e-58
WP_016210432.1|2672500_2673172_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_016210442.1|2673217_2674117_+	DUF3530 family protein	NA	NA	NA	NA	NA
WP_016210438.1|2674151_2674535_-	response regulator	NA	NA	NA	NA	NA
WP_016210440.1|2674662_2675139_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_033923648.1|2675138_2675420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210439.1|2675416_2676127_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_016210436.1|2676123_2677149_-	phosphotransferase	NA	NA	NA	NA	NA
WP_080664841.1|2677278_2679783_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_016210428.1|2679789_2681061_+	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_016210429.1|2681062_2682046_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_016210434.1|2682058_2682877_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_016210431.1|2682921_2683314_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_016210435.1|2683373_2684180_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_129556462.1|2684410_2685256_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.8	1.4e-24
WP_105962625.1|2685252_2686139_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007066.1|2686518_2686857_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275039.1|2686851_2687346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|2688149_2688440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007010.1|2688489_2689110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210530.1|2689950_2690631_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_016210535.1|2690627_2691440_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210534.1|2691513_2695194_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_016210531.1|2695203_2696691_-	ribonuclease G	NA	NA	NA	NA	NA
WP_016210527.1|2696700_2697318_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016210528.1|2697387_2697906_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210536.1|2697902_2698802_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2698817_2699861_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210537.1|2700050_2700338_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210532.1|2700449_2701901_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_032126195.1|2701942_2703379_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_155046713.1|2703673_2703838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275038.1|2703975_2704566_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2704511_2704877_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212074.1|2704903_2705125_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212072.1|2705211_2705409_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047032.1|2705438_2705672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212075.1|2705884_2706082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126197.1|2706195_2707149_+	DMT family transporter	NA	NA	NA	NA	NA
WP_054300271.1|2707289_2708264_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|2708374_2709436_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126201.1|2709457_2710204_-	lipoprotein	NA	NA	NA	NA	NA
WP_032126199.1|2710333_2710645_+	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_016211487.1|2710992_2711316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211494.1|2711340_2711796_-	arginine repressor	NA	NA	NA	NA	NA
WP_016211489.1|2711785_2712838_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_016211493.1|2712840_2714304_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211491.1|2714586_2714883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275036.1|2715143_2716205_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210915.1|2716334_2716799_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_032126715.1|2716996_2717812_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210906.1|2717940_2720253_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_051307343.1|2720372_2720900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210909.1|2721592_2722870_+	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_016210914.1|2722875_2723127_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.8e-20
WP_016210913.1|2723160_2723682_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_032126716.1|2723852_2724836_-	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210908.1|2724926_2725742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556458.1|2726633_2726867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2727242_2728304_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212580.1|2729039_2729390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2729477_2729843_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2729788_2730364_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211662.1|2730968_2732081_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_032126810.1|2732123_2732822_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211661.1|2733080_2734037_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_016211663.1|2734101_2734767_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_036776715.1|2734860_2735589_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211244.1|2735990_2736686_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_016211242.1|2736639_2737608_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_129556456.1|2737651_2738401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211238.1|2738602_2740096_-	amino acid permease	NA	NA	NA	NA	NA
WP_129556626.1|2740538_2741927_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211235.1|2742356_2742794_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_054300202.1|2743288_2744017_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211644.1|2744158_2744425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211639.1|2744539_2744842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126808.1|2744849_2745059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211640.1|2745221_2745824_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211645.1|2745855_2746605_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	28.2	2.4e-09
WP_016211641.1|2746627_2747083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556455.1|2747087_2747690_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211642.1|2747990_2748344_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_016211646.1|2748336_2748576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|2748945_2749782_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2749793_2750066_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275032.1|2750116_2750926_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	1.1e-15
WP_075275029.1|2751669_2752398_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	9.6e-43
WP_129556454.1|2752566_2754579_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_080728351.1|2754842_2755001_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211807.1|2754888_2755110_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275025.1|2755359_2757375_+	DUF1561 family protein	NA	NA	NA	NA	NA
2758663:2758722	attL	GAGGCACACGTTTGACGAAAGTGGGGCCTCAGCCGTTTGGCGATCTGCGAGCCATACTCG	NA	NA	NA	NA
WP_036771330.1|2758890_2759865_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_032126150.1|2759963_2760197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212425.1|2760345_2760936_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	34.4	1.1e-20
WP_016212424.1|2761139_2761418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126738.1|2761410_2761683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126737.1|2761809_2762538_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211918.1|2763086_2764055_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_051307368.1|2764054_2765335_-	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_054300202.1|2765992_2766721_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_052047116.1|2767422_2767602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556453.1|2767746_2768178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273432.1|2768597_2769332_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_016212023.1|2769328_2770321_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_016212022.1|2770807_2771026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212021.1|2771025_2771625_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212024.1|2771621_2771870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300201.1|2772265_2772994_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
2772448:2772639	attR	CGAGTATGGCTCGCAGATCGCCAAACGGCTGAGGCCCCACTTTCGTCAAACGTGTGCCTCTTGGCGGTTAGATGAAACGTTGGTGAAAATTAAAGGTCGTTGGTATTACCTTTATCGAGCCATTGATAAATATGGCAATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCGATGCGCTT	NA	NA	NA	NA
WP_016212110.1|2773640_2774111_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	62.5	7.6e-33
WP_016212114.1|2774114_2774345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126479.1|2774341_2774695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126478.1|2774681_2775020_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.7e-24
WP_129556625.1|2775012_2775570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275021.1|2775784_2776726_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300201.1|2776793_2777522_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_075274955.1|2777821_2778796_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212306.1|2778831_2779362_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212310.1|2779391_2779847_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_129556598.1|2782396_2784910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211935.1|2785844_2788493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274958.1|2788941_2790003_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2790029_2790605_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2790550_2790916_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556599.1|2791554_2792707_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 28
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	2905269	2948667	3130307	transposase,protease	Acanthamoeba_polyphaga_lentillevirus(14.29%)	41	NA	NA
WP_016209259.1|2905269_2906118_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_016209274.1|2906234_2907146_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_075274963.1|2907864_2908926_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212454.1|2909145_2909826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211192.1|2910614_2911973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211189.1|2912017_2912476_-	NfeD family protein	NA	NA	NA	NA	NA
WP_016211187.1|2912500_2913421_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_016211186.1|2913547_2914330_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.3	8.2e-32
WP_016211190.1|2914419_2915919_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_016211188.1|2916240_2918124_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_075273298.1|2918197_2918773_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2918718_2919084_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211157.1|2919648_2920305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211161.1|2920412_2921522_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|2921533_2922178_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|2922196_2923183_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|2923262_2924339_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|2924541_2925366_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|2925682_2926687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|2926895_2927861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274965.1|2927999_2928875_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2929171_2930224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211698.1|2930491_2930920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2931133_2931625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2931680_2932931_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2933033_2933252_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_052104629.1|2933694_2934720_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080728341.1|2935169_2935340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212561.1|2935311_2935452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210728.1|2936366_2936837_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2937125_2938505_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2938532_2938991_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2938968_2940186_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2940377_2940614_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2940627_2940783_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2940863_2941826_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2941985_2943302_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2943311_2943980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2944342_2946157_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_129556601.1|2946274_2947051_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_052104629.1|2947641_2948667_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP038886	Piscirickettsia salmonis strain Psal-004 chromosome, complete genome	3130307	2980352	3100259	3130307	tRNA,transposase	Staphylococcus_phage(33.33%)	113	NA	NA
WP_054300271.1|2980352_2981327_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|2981402_2982422_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556602.1|2982820_2983030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274966.1|2985021_2986083_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211201.1|2986163_2986472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211206.1|2986586_2987903_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664857.1|2988364_2989651_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211205.1|2989723_2990620_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211203.1|2990706_2991705_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032126430.1|2991813_2992338_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_129556668.1|2992585_2993824_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_016212222.1|2994371_2994845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|2994841_2995237_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2996166_2996742_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2996687_2997053_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211610.1|2997317_2999648_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_129556603.1|2999768_3001784_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075274967.1|3001967_3005360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|3005424_3005730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274968.1|3005899_3007000_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049897.1|3007247_3008504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209721.1|3009442_3010840_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.3e-77
WP_051307313.1|3010959_3011907_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|3011903_3012419_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|3012405_3013605_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|3013601_3013925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|3013926_3015156_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|3015155_3016199_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|3016198_3016882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3016878_3019368_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3019384_3019639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3019639_3019996_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|3020775_3021939_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|3021958_3025066_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|3025067_3026573_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3026600_3026882_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3027030_3027372_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3027491_3029372_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_059372650.1|3029456_3031055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3031072_3032188_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|3032315_3033314_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209700.1|3033317_3034076_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3034077_3035277_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3035260_3035932_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3035953_3036730_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3036733_3037732_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3037733_3038312_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3038308_3039778_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3039821_3040109_-	trp operon repressor	NA	NA	NA	NA	NA
WP_016209699.1|3040309_3040906_+	DMT family transporter	NA	NA	NA	NA	NA
WP_075274970.1|3041115_3041586_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|3041642_3041798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274971.1|3041942_3042395_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3042580_3042802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212371.1|3042917_3043550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274972.1|3043527_3044589_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211865.1|3045028_3045568_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|3045652_3046189_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|3046840_3047143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|3047592_3047901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274973.1|3048491_3048959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|3049241_3049952_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|3050178_3050577_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_016211231.1|3051444_3052395_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3052394_3054473_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3054620_3055136_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3055144_3055708_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3055688_3056435_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3056574_3057027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|3057450_3058287_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3058283_3059180_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3059212_3060280_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3060298_3060667_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3060692_3062141_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3062150_3063530_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3063570_3064902_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|3064873_3065833_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3065925_3066429_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3066563_3067715_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3067711_3068191_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3068337_3070659_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3070603_3071230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3071234_3072134_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3072206_3072785_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3073085_3073343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556611.1|3073351_3074505_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046758.1|3075641_3075773_+	phosphatase	NA	NA	NA	NA	NA
WP_155046759.1|3075917_3076073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212051.1|3076400_3077174_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054300271.1|3078501_3079476_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3080570_3080909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212337.1|3080925_3081636_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_051307375.1|3081623_3081815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|3081976_3082276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|3082265_3082430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|3082486_3082852_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3084156_3084852_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3084848_3086276_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3086301_3086565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3086925_3087900_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556612.1|3087958_3088809_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|3088846_3089191_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3089187_3090024_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3090024_3090366_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3090367_3090973_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3090969_3092964_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3092983_3093925_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211292.1|3094152_3095577_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|3096089_3097064_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3097122_3097779_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_032126480.1|3097825_3098509_-	methyltransferase	NA	NA	NA	NA	NA
WP_080664873.1|3099054_3099369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556613.1|3099263_3100259_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP038887	Piscirickettsia salmonis strain Psal-004 plasmid unnamed1, complete sequence	108848	2323	51606	108848	integrase,protease,transposase	Streptococcus_phage(32.0%)	57	NA	NA
WP_129556705.1|2323_2824_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	28.0	9.9e-07
WP_036771330.1|2882_3857_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_054300162.1|4369_5452_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212151.1|5816_6779_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|6802_7117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923686.1|7173_8223_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|8331_9372_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|9385_10015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|10105_10405_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211886.1|10401_10830_-	nucleotidyltransferase substrate-binding, HI0074 family protein	NA	NA	NA	NA	NA
WP_054300202.1|11618_12347_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126832.1|12591_13500_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_054300202.1|13610_14339_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046765.1|14450_14645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|15531_16260_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|16463_19040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046766.1|19264_19402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274822.1|19445_20420_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_075274931.1|20620_21349_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.4e-38
WP_016212137.1|21792_22854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212139.1|22929_23175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307371.1|23146_23761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|24578_25553_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_129556707.1|25912_26932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|27560_28714_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_032126239.1|28858_29131_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|29142_29979_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075275144.1|30011_30743_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212014.1|30840_31254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212017.1|31548_31947_+	hypothetical protein	NA	W8VUR5	Pseudomonas_phage	38.8	2.3e-06
WP_047927838.1|31976_32222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|32218_32518_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_016212019.1|32674_33370_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_081377351.1|34183_34963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|35046_35199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126739.1|35151_35484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|35648_36026_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_016212152.1|36332_36716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|37185_37914_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_098082839.1|37999_38200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211775.1|38367_38736_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_016211773.1|38837_39512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|39964_40330_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|40275_40851_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126360.1|41057_41792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211895.1|41914_42973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|43481_44228_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211897.1|44228_44633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|45026_45842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|46446_47175_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212298.1|47616_47943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307374.1|48183_48660_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_075275158.1|48774_49068_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377916.1|49184_49709_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.4	2.5e-29
WP_098082791.1|49913_50216_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.6	8.6e-14
WP_129556698.1|50224_50926_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_016211912.1|51015_51606_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
>prophage 2
NZ_CP038887	Piscirickettsia salmonis strain Psal-004 plasmid unnamed1, complete sequence	108848	54701	101352	108848	integrase,transposase	Streptococcus_phage(22.22%)	55	80648:80707	107126:108234
WP_081377915.1|54701_55259_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	2.9e-47
WP_081377914.1|55403_55733_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|55849_56143_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_016212499.1|57141_57516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|57720_57894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|58141_58591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212412.1|58583_58748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372613.1|59048_59675_+	hypothetical protein	NA	A0A222ZGQ4	Arthrobacter_phage	33.7	1.8e-21
WP_054300202.1|59780_60509_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_054300590.1|60538_60763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556699.1|61070_61271_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211871.1|61264_61600_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_032126138.1|62165_62429_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_016211872.1|62983_63787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307367.1|63907_64432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273798.1|64540_64765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126346.1|64856_65099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923775.1|65165_65906_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	4.6e-08
WP_016212413.1|65953_66382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|66715_67444_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_129556700.1|67620_67866_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|67825_68281_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_054300148.1|68386_69448_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728342.1|69487_69991_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032126739.1|70305_70638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556701.1|70884_71409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275159.1|71817_72525_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	32.0	3.8e-12
WP_129556702.1|72545_73698_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273327.1|74682_75258_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|75203_75569_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212398.1|76916_77378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|77640_78477_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_129556717.1|78802_80029_+	hypothetical protein	NA	NA	NA	NA	NA
80648:80707	attL	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAA	NA	NA	NA	NA
WP_075274955.1|80683_81658_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_016212260.1|81815_82088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212257.1|82107_82332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126838.1|82668_82872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212255.1|82868_83039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273820.1|83225_84308_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.8	1.2e-142
WP_075273822.1|84464_84965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274741.1|85066_85324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556718.1|85392_86579_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_155046769.1|87828_87999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377350.1|88328_89144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372616.1|89389_89980_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	38.8	6.8e-23
WP_016211879.1|90945_91965_+	ParA family protein	NA	NA	NA	NA	NA
WP_016211878.1|91977_93318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046770.1|93614_93782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|93837_94566_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212168.1|94534_96223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275149.1|96566_97541_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.9e-25
WP_016211953.1|97775_98255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211956.1|98312_99041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211955.1|99497_100478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|100623_101352_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
107126:108234	attR	TTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCGAAGGTCGTTGGTATTACCTTTATCGAGCCATTGATAAATATGGCCATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCGATGCGCTTTTTCAAAAAGGCAATCGCCCAACCTTATGTGAAATCACCGCGTGTTGTGAATGTCGACAAGCACGCTTCATTTCCACCCGCTCACCAAAAAGCCAAAGATGAAGGTGTCTTTTCTAGTCAGTGTAAACTCAGGCGAGTGAAGTATTTAAACAACTGCATTGAAAATGATCACAAAGCGGTAAAGCGCAAATCCCGTTTCCGCCAATGGTACCAATCACTTTCTACAGCACGGCCTACCATTGACATAATGGAAGCGATGCGCATGGTTCAAAAAGGTCAATTACGTTATATTAAAAAACAGAATATCTGTGCCCAAAATCAGCTCATTGATAAATTATTTGGATTAGCTGCTTAATTCTAAGCAGAGAGCACAAGAAAATAACCTTTCTGAAGTTCACTATAATTTTTCGCAACAGTGCCCTTATAATAACAATTGCTGCGATTAAAATTTATTAATTCACATTGCCTTGTAACTGGAATATTTTTCGGCTCAGACTCAATAAGGCACTTTCTTTTTTCATAGTCCAAGCTCTTTAACTTTTTTGCAGCCCACTCCAACTCTGCTGTGCGTTTGCCCAGTTGACGGTGAAGTTCATTCACTTCTTTTTCTTTGGTTTTAATTTCATCCTTAAACTCCGCCACAGCACTATCGATATTGAAAGCTAGGCTTGCATTCGCTAAAAACACTTTTTTCCAGTTTTGAACAGTTTTAGGGACTAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCATTCGATGACCTCTAAGACAACTTTGGTTTTAAATTCAGCGCTTGGCTTCTTTCTTTTTTGACTCATATCATAGCTCCTAAAATGTTAAGCATCATTTTAACCTTTCAGGAATAAATCGTTAAACTATTCTGTCTGAAAACTCGGGAGCATTATACCGGTGGAAATGAAGCGTGTTTATCGACATTCACAA	NA	NA	NA	NA
>prophage 1
NZ_CP038888	Piscirickettsia salmonis strain Psal-004 plasmid unnamed2, complete sequence	79944	4824	28863	79944	transposase	Streptococcus_phage(16.67%)	33	NA	NA
WP_075273327.1|4824_5400_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|5345_5711_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212400.1|5761_6361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046771.1|6360_6594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|6750_7903_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212392.1|7931_8939_-	hypothetical protein	NA	W6E8G0	Rhizobium_phage	26.4	1.2e-06
WP_075273802.1|9002_9731_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.5e-37
WP_016212131.1|9914_10262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212135.1|10700_11885_+	3-methylitaconate isomerase	NA	NA	NA	NA	NA
WP_075275202.1|12128_12830_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	6.0e-10
WP_075275201.1|12832_13561_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_016212164.1|13689_14718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211443.1|15741_16428_+	Fic family protein	NA	NA	NA	NA	NA
WP_016211439.1|16431_16986_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	40.6	1.0e-20
WP_016211436.1|17030_17969_+	fic/DOC family protein	NA	S4TP71	Salmonella_phage	37.2	5.2e-25
WP_016211434.1|17941_18133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211445.1|18310_18661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211437.1|18677_19304_-	zinc-ribbon domain-containing protein	NA	A0A1S5XYQ1	Kurlavirus	28.2	4.4e-12
WP_032126541.1|19310_19703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211440.1|19713_20628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211444.1|20897_21404_+	antirestriction protein ArdA	NA	A0A222YZE5	Mycobacterium_phage	33.7	2.8e-17
WP_051307358.1|21552_21936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556729.1|22219_22450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212541.1|22436_22661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212539.1|22720_22870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|22866_23841_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212090.1|23884_24064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212087.1|24063_24492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126714.1|24659_25199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212089.1|25435_25666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126713.1|25764_26802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|27271_28297_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275198.1|28323_28863_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	40.2	8.4e-12
>prophage 2
NZ_CP038888	Piscirickettsia salmonis strain Psal-004 plasmid unnamed2, complete sequence	79944	37207	57888	79944	portal,head,protease,terminase,tail,capsid	Pseudomonas_phage(11.76%)	29	NA	NA
WP_129556725.1|37207_37888_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	39.3	3.3e-37
WP_016210977.1|38066_38360_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_129556724.1|38577_38760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046773.1|38904_39084_-	phosphatase	NA	NA	NA	NA	NA
WP_129556723.1|39178_39496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126134.1|39796_40180_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	5.6e-26
WP_016212234.1|40267_40747_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_016212231.1|40750_40960_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	43.1	1.3e-08
WP_080743047.1|40975_41332_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	61.3	5.4e-23
WP_081377926.1|41350_42433_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	1.2e-89
WP_016211136.1|42429_43671_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	46.0	3.1e-86
WP_080664855.1|43618_44290_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.8	3.0e-43
WP_016211140.1|44347_45541_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_016211133.1|45661_46996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211137.1|47186_47498_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_016211132.1|47494_47818_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211139.1|47810_48206_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211129.1|48202_48553_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211141.1|48552_48975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126913.1|48976_49300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|49356_49623_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_032126912.1|49626_51705_+	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	33.0	2.5e-56
WP_016210657.1|51697_52039_+|tail	phage minor tail family protein	tail	NA	NA	NA	NA
WP_016210666.1|52035_52707_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|52675_53422_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_016210665.1|53411_53969_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_016210662.1|53975_54263_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	2.5e-15
WP_016210670.1|54252_54507_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_016210653.1|54600_57888_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	33.5	5.2e-112
>prophage 1
NZ_CP038889	Piscirickettsia salmonis strain Psal-004 plasmid unnamed3, complete sequence	35471	14424	22147	35471	integrase,transposase	unidentified_phage(33.33%)	10	8029:8088	21469:21660
8029:8088	attL	TTATTCCGGTGAGATTATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTA	NA	NA	NA	NA
WP_129556741.1|14424_15096_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.4	3.4e-10
WP_052133268.1|15117_15399_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	38.7	8.3e-11
WP_016212274.1|15471_15936_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_032126154.1|15946_16141_-	addiction module toxin, HicA family	NA	A0A1X9I5T5	Streptococcus_phage	48.4	2.8e-10
WP_032126152.1|16356_16947_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.8	1.4e-20
WP_129556740.1|17010_17379_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155046774.1|17590_17767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300579.1|17985_18987_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	1.3e-26
WP_016211990.1|19316_21389_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_129556739.1|21418_22147_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
21469:21660	attR	TTATTCCGGTGAGATTATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTACCGTGATCTCAAAGAAATAGCAGCTGAAAGAGGTCTTGAGATTGAGCGTTCAACCATTTGTCGTTGGGTGCACGAGTATGGCTCGCAGATCGCCAAACGGCTGAGGCCCCACTTTCGTCAAACGTGTGCCTC	NA	NA	NA	NA
