The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	31806	91595	3198778	transposase,tRNA	Staphylococcus_phage(28.57%)	52	NA	NA
WP_036772169.1|31806_32682_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378444.1|33040_34396_+	chloride channel protein	NA	NA	NA	NA	NA
WP_017378443.1|34487_34994_-	GrpB family protein	NA	NA	NA	NA	NA
WP_017378442.1|34990_35359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378441.1|36761_38546_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_017378440.1|39026_40154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378439.1|40226_40982_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_027242743.1|41018_43712_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.7	9.9e-69
WP_036771562.1|43743_44295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063736.1|44402_45416_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017378435.1|45536_45761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378434.1|46116_46878_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_144420740.1|47020_47815_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875841.1|47959_48712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378433.1|49023_50550_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_065653750.1|50688_51762_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027242742.1|51801_53109_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
WP_017378429.1|53083_54253_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_027242741.1|54307_55033_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_027242740.1|55498_57604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378426.1|57818_58283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420739.1|58302_58812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420738.1|59196_60138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856772.1|60419_61871_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773655.1|62337_62742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|63302_64277_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|65011_65389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|65978_66953_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036773242.1|66992_67547_-	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_017378416.1|67727_68627_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_080963576.1|68631_69258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242705.1|69202_71524_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_016210342.1|71670_72150_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_017378414.1|72146_73298_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_017378413.1|73432_73936_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_026063734.1|74029_75004_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_036773239.1|74993_76307_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_017378410.1|76347_77727_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_080963575.1|77733_79185_+	potassium transporter	NA	NA	NA	NA	NA
WP_016210352.1|79210_79579_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_017378407.1|79597_80665_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_027242707.1|80697_81594_-	DMT family transporter	NA	NA	NA	NA	NA
WP_047927132.1|81590_82427_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_017378404.1|82562_83015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378403.1|83153_83900_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378402.1|83880_84444_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378401.1|84452_84968_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378400.1|85109_87188_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378399.1|87187_88138_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378398.1|89005_89404_+	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_075275373.1|89629_89959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875844.1|90575_91595_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	123077	241721	3198778	transposase,tRNA,protease	Staphylococcus_phage(12.5%)	106	NA	NA
WP_075278722.1|123077_123953_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929698.1|124393_124687_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_017377396.1|124687_124942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242714.1|124958_127451_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_017377399.1|127443_128127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377400.1|128126_129170_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_017377401.1|129169_130399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377402.1|130400_130730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377403.1|130726_131926_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_144420824.1|132038_132428_+	signal peptidase, peptidase S26 family protein	NA	NA	NA	NA	NA
WP_026063632.1|132427_133372_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_017377406.1|133491_134889_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	3.9e-77
WP_017377407.1|135214_135736_+	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	46.2	1.7e-30
WP_017377408.1|135859_136168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875847.1|136182_141405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242717.1|141795_143802_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377568.1|143932_146263_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_144420823.1|146438_147269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773453.1|147385_147781_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_027242719.1|147777_148311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242720.1|148307_148709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875848.1|149103_149424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377563.1|149433_150390_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.5	1.0e-12
WP_017377562.1|150899_151424_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_017377561.1|151524_152523_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_027242721.1|152611_153508_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080963593.1|153581_154868_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_155062804.1|155375_155558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377557.1|155615_156932_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377556.1|157045_157216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|157235_158210_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377551.1|158336_158597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377550.1|158864_159155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377545.1|161693_162734_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_048875849.1|162836_163808_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377543.1|163930_164779_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_017377542.1|164930_165218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|165528_165900_+	isochorismatase	NA	NA	NA	NA	NA
WP_017377540.1|166951_167185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|167322_167460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377539.1|167473_167686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377537.1|168209_169034_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377536.1|169172_170306_+	cation transporter	NA	NA	NA	NA	NA
WP_016210041.1|170365_171775_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_027242724.1|171922_173503_-	APC family permease	NA	NA	NA	NA	NA
WP_017377534.1|174260_175256_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242725.1|175261_177328_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_048875850.1|177385_178336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210045.1|178530_178857_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_026063646.1|179367_180627_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_036772663.1|180886_181762_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377528.1|181800_182763_+	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_017375799.1|188457_188802_-	DMT family protein	NA	NA	NA	NA	NA
WP_047927156.1|188898_189822_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375796.1|190321_190810_+	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_017375795.1|190912_191713_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375794.1|191723_193475_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_081000012.1|194364_194607_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420737.1|194610_195009_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|195240_196116_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375951.1|196834_197293_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420736.1|197474_197660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|198375_200190_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_017375948.1|200600_201269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375947.1|201278_202595_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375945.1|202754_203717_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210730.1|203797_203953_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375944.1|203966_204203_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_036773720.1|204395_205613_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375942.1|205590_206049_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_017375941.1|206076_207456_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_075275379.1|207492_207711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|208030_209326_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|209530_209722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|209920_210796_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|210983_212249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875854.1|212282_213158_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378152.1|213279_213738_-	NfeD family protein	NA	NA	NA	NA	NA
WP_017378151.1|213761_214682_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378150.1|214809_215592_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378149.1|215682_217182_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_027242686.1|217495_219379_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_027242685.1|219638_220301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242684.1|220367_221477_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_017378146.1|221488_222133_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_017378145.1|222151_223138_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378144.1|223222_224299_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378143.1|224500_225325_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378142.1|225627_226593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378141.1|226911_227964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|228022_228997_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027242682.1|229332_229761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|229997_230480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378138.1|230535_231786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378137.1|231888_232107_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378136.1|232578_233433_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378135.1|233487_233958_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_026063709.1|234254_234491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063708.1|234637_235018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|235076_235952_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063707.1|236718_237630_+	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_017378132.1|237746_238595_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_065653735.1|238661_239672_+	lipase	NA	NA	NA	NA	NA
WP_017378129.1|239695_240019_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_017375571.1|240029_240431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875856.1|240701_241721_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	315524	357883	3198778	transposase	Chrysochromulina_ericina_virus(20.0%)	54	NA	NA
WP_036772169.1|315524_316400_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378046.1|316480_317113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378045.1|317066_318512_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_051929544.1|318546_318966_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017378043.1|319739_320108_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_017378042.1|320117_320657_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_017378041.1|320817_321249_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_017378040.1|321252_321951_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_017378039.1|322198_322705_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_017378038.1|322747_323116_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_017378037.1|323386_327463_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.6	1.2e-22
WP_017378036.1|327526_331735_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_016209765.1|331896_332271_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_016209732.1|332375_332849_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_017378035.1|332864_334976_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209759.1|335003_336194_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_016209760.1|336200_336512_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_017378034.1|336634_337273_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_016209735.1|337288_337906_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_016209744.1|337902_338199_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_017378033.1|338213_339038_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_017378032.1|339054_339330_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_016209755.1|339335_339668_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_017378031.1|339680_340415_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_017378030.1|340428_340842_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_016209750.1|340841_341042_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_017378029.1|341041_341299_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_017378028.1|341420_341789_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_016209734.1|341806_342118_+	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_016209761.1|342133_342676_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_026063699.1|342688_342994_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_016209763.1|343022_343415_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_017378025.1|343427_343961_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_016209757.1|343970_344324_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_016209764.1|344334_344835_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_017378024.1|344840_345023_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_017378023.1|345025_345460_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_016209749.1|345460_346783_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_016209752.1|346839_346953_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_017378021.1|347096_347453_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_016209730.1|347478_347868_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_017378020.1|347877_348498_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_016209739.1|348519_349497_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_017378019.1|349545_349944_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_017378018.1|350056_351304_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_027242670.1|351290_351947_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_036772490.1|352031_352310_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375625.1|352552_352780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875859.1|352912_353707_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053856770.1|354015_355230_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|355627_355807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|355775_356429_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376985.1|356804_357053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771653.1|357142_357883_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
>prophage 4
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	367306	422219	3198778	tRNA,protease,transposase	uncultured_Caudovirales_phage(20.0%)	60	NA	NA
WP_017376975.1|367306_367858_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_017376974.1|367868_369236_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376973.1|369386_369623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376972.1|369681_370425_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_027242667.1|370424_371066_+	lipoprotein	NA	NA	NA	NA	NA
WP_017376970.1|371065_372730_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.8	6.4e-34
WP_017376969.1|372758_373094_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_027242666.1|373258_374857_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.1e-06
WP_017376966.1|374916_375207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772765.1|375407_375839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376964.1|375901_378382_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_017376963.1|378468_378948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772771.1|378920_379961_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080963574.1|379897_380614_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|380626_380962_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|380998_381469_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_017376959.1|381511_383347_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_036818645.1|383391_384480_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376957.1|384501_385563_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_017376956.1|385640_386156_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376955.1|386196_387474_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376954.1|387488_388340_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376953.1|388368_389016_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026063584.1|389012_389972_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_048875861.1|390493_391363_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875862.1|391507_391762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856769.1|391906_392473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|392578_393019_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_027242664.1|393530_394733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|395016_395991_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_155046562.1|396172_396316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046563.1|396460_396598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910653.1|396614_396830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|397034_397646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376943.1|397642_397900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376942.1|398150_398543_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016210000.1|398672_399221_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_026063583.1|399220_400048_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_017376940.1|400097_401783_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_017376939.1|401860_402322_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_026063582.1|402358_402922_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209991.1|403148_403478_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_017376937.1|403458_403683_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_017376936.1|403827_404418_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376935.1|404442_405714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|405731_406985_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376933.1|406981_407626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376932.1|407698_408748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376931.1|408849_410487_+	response regulator	NA	NA	NA	NA	NA
WP_017376930.1|410521_410851_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376929.1|411007_411295_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_155046565.1|411821_412115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376925.1|412364_413585_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376924.1|413643_416442_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376923.1|416747_417914_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_036772950.1|418012_418549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376921.1|418610_418943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|419200_420103_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|420172_420670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|420815_422219_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	451656	499795	3198778	transposase	Staphylococcus_phage(100.0%)	42	NA	NA
WP_036774259.1|451656_452631_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377364.1|452780_453617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|453736_455140_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242658.1|456482_457946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856768.1|458021_458816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242656.1|459107_459926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046566.1|459943_460537_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376894.1|460753_460987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155062807.1|461231_462107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155050372.1|462402_463182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376891.1|463351_464254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242654.1|464250_465474_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_027242653.1|465491_466418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242652.1|466433_467474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242651.1|467588_467999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376888.1|468051_468555_+	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_017376887.1|468547_469294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376886.1|469296_470427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420726.1|470431_470671_+	type IV secretion protein IcmT	NA	NA	NA	NA	NA
WP_027242650.1|473160_473649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242649.1|473651_474728_+	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_017376878.1|474720_475374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875870.1|475380_475806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242647.1|475842_478842_+	ATPase AAA	NA	NA	NA	NA	NA
WP_027242646.1|478903_480406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772357.1|480857_482477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376871.1|482518_484822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376870.1|485098_485995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242644.1|485997_489324_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_144420818.1|489525_489714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242642.1|489725_490202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772352.1|490244_490472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420817.1|490653_491187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242641.1|491217_491559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772347.1|491561_491978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876253.1|492139_492796_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.3e-10
WP_036771639.1|492792_493767_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_032126138.1|494208_494472_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_036771639.1|494899_495874_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_087910671.1|496261_496726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910670.1|496819_497005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875857.1|498820_499795_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
>prophage 6
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	504599	559282	3198778	transposase	Streptococcus_phage(22.22%)	52	NA	NA
WP_048875872.1|504599_505883_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|506055_506193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875873.1|506189_507593_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927246.1|507706_508144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242638.1|508264_508693_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017375827.1|508940_509378_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|509809_511198_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_017375825.1|511644_513138_+	amino acid permease	NA	NA	NA	NA	NA
WP_036773936.1|513332_514088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420725.1|514587_514818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|515922_516933_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375821.1|516929_517151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242636.1|517869_518811_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026063480.1|519338_519737_+	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_075275366.1|519676_520531_+	MFS transporter	NA	NA	NA	NA	NA
WP_017375815.1|520622_520904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242634.1|520989_521667_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_026063478.1|521712_522993_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_017375812.1|523168_524218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375811.1|524296_525097_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375810.1|525110_525905_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375809.1|526007_527027_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375808.1|527073_527685_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375807.1|527688_528375_+	acireductone synthase	NA	NA	NA	NA	NA
WP_017375806.1|528371_528914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375805.1|529206_530394_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375804.1|530638_531364_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_144420816.1|531549_532338_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_047927106.1|532334_532730_-	YchJ family protein	NA	NA	NA	NA	NA
WP_017375801.1|533122_534163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|534159_535563_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|537978_538236_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420723.1|538275_539661_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155050374.1|539978_541088_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.6e-49
WP_017377120.1|541121_542372_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_017377119.1|542372_543005_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017377118.1|543294_543747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063598.1|543792_544635_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377116.1|544669_545161_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_017377115.1|545356_547324_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377113.1|547551_547956_+	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_047927448.1|547933_548962_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_027242632.1|548948_549737_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053856766.1|550163_551567_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377110.1|551768_552779_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_075275363.1|552791_553259_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377107.1|553588_554959_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_017377106.1|555261_555732_+	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377105.1|556009_556285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|556295_557699_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_069971661.1|557873_558311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|558307_559282_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 7
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	591073	724467	3198778	transposase,tRNA,plate	Staphylococcus_phage(13.64%)	111	NA	NA
WP_036772726.1|591073_591622_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
WP_017377077.1|592374_593754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|594113_595577_+	nuclease	NA	NA	NA	NA	NA
WP_017377075.1|595760_596573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377074.1|597037_599032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377073.1|599426_600806_+	MFS transporter	NA	NA	NA	NA	NA
WP_036774567.1|600843_601281_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774569.1|601323_602040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|603586_604117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|604183_606004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|606568_607075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242613.1|607159_608563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|608677_608932_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_017377065.1|609084_609357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420722.1|609932_610115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|610231_610807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377063.1|610803_610974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242612.1|611874_612117_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_027242611.1|612419_613511_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377060.1|613491_614445_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_017377059.1|614668_616153_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_027242610.1|616192_616696_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_051929897.1|616955_618131_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_051929903.1|618278_618683_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_036772169.1|618839_619715_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242609.1|619749_620103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|623432_623858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|624088_625225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242608.1|625211_626534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377048.1|626526_627645_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377047.1|627765_628299_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377046.1|628437_630075_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377045.1|630079_630301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377044.1|630409_631423_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377043.1|631694_633923_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_026063593.1|633903_634608_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|634842_635172_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377039.1|636572_636791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|636849_637725_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377037.1|637717_638584_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_017377036.1|638651_639971_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036772137.1|640440_641001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856764.1|641319_642246_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376601.1|643141_644050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|647746_648586_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376604.1|648772_648988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|649036_649612_-	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376606.1|649608_649947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376607.1|650115_651105_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_051929685.1|652094_652997_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048875883.1|653256_653793_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420814.1|653937_654855_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376610.1|655289_656300_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_017376611.1|657107_657644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376613.1|658856_659204_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275357.1|659348_660308_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376616.1|660409_661192_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243116.1|661324_662284_+	response regulator	NA	NA	NA	NA	NA
WP_017376619.1|662308_662713_-	RidA family protein	NA	NA	NA	NA	NA
WP_026063546.1|662741_663416_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_027243117.1|663515_665231_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016209558.1|665227_665590_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_026063550.1|665604_666759_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_017376622.1|666762_667770_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_017376623.1|667772_668789_+	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376624.1|669004_670090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376625.1|670196_670589_-	RidA family protein	NA	NA	NA	NA	NA
WP_027243118.1|670721_672005_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_027243119.1|672020_673322_+	aspartate kinase	NA	NA	NA	NA	NA
WP_036772145.1|673339_675142_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420721.1|675146_676139_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376630.1|676219_677296_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017376631.1|677393_678368_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_144420813.1|678435_679407_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376633.1|679590_679860_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_017376634.1|680461_681748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|681812_682493_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376024.1|688148_688397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375775.1|688474_688669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275355.1|688716_689691_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_027242570.1|689904_691044_-	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_017376020.1|691252_692623_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_017376019.1|693001_693994_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376018.1|693997_694513_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376017.1|694509_695349_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_027242569.1|695381_696932_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376015.1|697039_697411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376011.1|698631_698793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|699373_700777_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375660.1|700811_701249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|701272_702247_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036774104.1|702305_702734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376321.1|702921_703728_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_017376322.1|703802_704195_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376323.1|704239_705061_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376324.1|705073_706057_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376325.1|706058_707327_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_048876074.1|707333_709838_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376328.1|709968_710994_+	phosphotransferase	NA	NA	NA	NA	NA
WP_017376329.1|710990_711701_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_080963653.1|711625_712456_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376331.1|712605_712989_+	response regulator	NA	NA	NA	NA	NA
WP_027242863.1|713023_713923_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_027242862.1|713968_714640_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_017376334.1|714722_715298_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_017376335.1|715396_716197_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376336.1|716338_717196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|718058_719195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242860.1|719261_722432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242859.1|722444_723155_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242858.1|723159_724467_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	733109	779426	3198778	transposase,plate	Staphylococcus_phage(21.43%)	51	NA	NA
WP_017376356.1|733109_733508_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_027242851.1|733504_735193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242850.1|735174_736131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|736173_736689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|736793_737726_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_017376360.1|737945_738332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376361.1|738349_738994_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_017376362.1|739144_739984_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.6	3.9e-16
WP_017376363.1|740059_740662_+	signal peptidase I	NA	NA	NA	NA	NA
WP_017376364.1|740662_741517_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_017376365.1|741874_742186_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017376366.1|742210_743599_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|743754_744486_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_027242849.1|744482_745010_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|745041_745599_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_027242848.1|745604_746585_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	3.5e-32
WP_016209539.1|746724_747525_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_017376369.1|747528_748296_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_017376370.1|748292_748757_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_017376371.1|748779_749433_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376372.1|749436_749784_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017376373.1|749817_750069_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|750146_751415_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027242847.1|751417_752176_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_017376376.1|752237_753128_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|753178_753862_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_017376377.1|753871_754219_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155062809.1|754488_756612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376379.1|756603_757476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376380.1|757643_759473_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_017376381.1|759640_760282_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_144420811.1|760606_761053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|761070_761244_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_017376383.1|761302_762352_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_017376384.1|762358_763309_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_017376385.1|763363_764308_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_017376386.1|764335_765073_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|765161_765404_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|765478_766702_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_017376387.1|766733_767582_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_017376388.1|767578_768631_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_017376389.1|768767_769388_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	43.7	2.7e-38
WP_087910645.1|769613_770766_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_036771330.1|771786_772761_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046570.1|772757_772928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971647.1|773896_774493_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876071.1|774461_775622_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_017377691.1|776132_776474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377690.1|776577_777612_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|777608_778319_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_036771330.1|778451_779426_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 9
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	787586	841897	3198778	transposase,protease,tRNA	Prochlorococcus_phage(33.33%)	49	NA	NA
WP_017377942.1|787586_788093_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_155048031.1|788174_788540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243057.1|788682_789543_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420810.1|789640_790186_+	chorismate lyase	NA	NA	NA	NA	NA
WP_017377937.1|790268_791120_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_048876070.1|791161_794068_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|794128_794326_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_017377935.1|794332_795343_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_017377934.1|795339_796398_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_087910662.1|796412_797192_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027243055.1|797194_798007_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_017377933.1|798018_798966_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_144420809.1|798976_800269_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377931.1|800447_801551_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_017377930.1|801547_801940_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_027243054.1|801952_803329_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377929.1|803322_804792_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_053856762.1|804985_805420_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_087910651.1|805715_805892_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_027243053.1|806926_807952_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	30.5	4.5e-30
WP_017377925.1|808453_808846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774583.1|810238_810889_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046574.1|811587_812382_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876067.1|812561_813206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|813380_814355_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377920.1|814755_815013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420808.1|816690_817368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243155.1|817601_818426_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377914.1|818519_819233_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_017377913.1|819322_820414_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377912.1|820485_821067_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377911.1|821072_821699_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_026063691.1|821795_822743_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_065653730.1|823089_823752_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017377908.1|823922_824582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377907.1|824750_826010_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377906.1|826006_827092_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377905.1|827084_827966_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_027243154.1|827954_829205_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_144420719.1|830590_830911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|831169_831436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|831926_832145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420718.1|833130_833352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|833348_834431_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063690.1|834441_834813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773050.1|834809_834989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|837692_837968_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065653755.1|838803_840261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|840688_841897_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	885577	948385	3198778	transposase,tRNA	Staphylococcus_phage(28.57%)	53	NA	NA
WP_048875904.1|885577_886453_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376744.1|886709_887147_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_017376743.1|887207_887840_-	endonuclease III	NA	NA	NA	NA	NA
WP_017376742.1|887855_888503_-	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_027242971.1|888505_890569_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_027242972.1|890895_892188_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242973.1|892576_894787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242974.1|894803_895460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242975.1|897845_898721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420805.1|898979_899591_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_027242976.1|900018_902607_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
WP_017375712.1|902709_903471_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242977.1|903467_904004_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375710.1|904052_905009_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242978.1|905086_908272_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_017375707.1|908275_909331_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	1.5e-49
WP_027242979.1|909560_910163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375705.1|910206_910869_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017375704.1|910903_911251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046576.1|911719_912664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|913213_914617_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242980.1|915735_916080_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027242981.1|916171_916627_+	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_144420715.1|916875_917010_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377756.1|917002_917644_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|917640_918357_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377754.1|918360_919680_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_155046577.1|920361_920523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773644.1|921484_924121_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	1.5e-98
WP_036773645.1|924162_925248_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377749.1|925247_925931_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_065653732.1|927539_927941_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377747.1|928093_928348_+	LapA family protein	NA	NA	NA	NA	NA
WP_017377746.1|928426_928744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377745.1|928896_929295_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242983.1|929376_930015_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_036771330.1|930171_931146_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420804.1|931518_931794_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|932343_932628_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772261.1|934444_935038_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243172.1|936125_937007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376527.1|937118_938798_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_017376526.1|938924_940175_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376525.1|940250_940712_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376524.1|940708_941857_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376523.1|941862_942537_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376522.1|942533_943190_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376521.1|943315_943789_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376520.1|943790_944213_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_047927196.1|944199_945219_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_155046578.1|945378_945558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243174.1|945776_946058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|947509_948385_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	952287	1019250	3198778	transposase,tRNA,protease	Bacillus_phage(20.0%)	56	NA	NA
WP_048876012.1|952287_953691_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|954049_954817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|954930_956334_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046579.1|956330_956492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|956807_957782_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376505.1|958022_959306_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376506.1|959372_960296_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376509.1|962491_964636_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_016210310.1|964657_964864_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376510.1|964924_965545_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_017376511.1|965585_966479_-	YicC family protein	NA	NA	NA	NA	NA
WP_016210308.1|966564_967290_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210305.1|967351_967756_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_027243115.1|967918_970027_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_017376514.1|970150_971200_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376515.1|971196_972663_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376516.1|972805_974143_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_047927029.1|974210_975701_-	nuclease	NA	NA	NA	NA	NA
WP_017376518.1|975929_976301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|976451_977279_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_027243112.1|977581_978238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927028.1|978185_979109_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036774751.1|979122_980046_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017376987.1|980293_980977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|982676_982904_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376989.1|983228_983777_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_017376990.1|983857_984133_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_027242882.1|984132_985182_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376991.1|985294_987232_-	AsmA family protein	NA	NA	NA	NA	NA
WP_080963631.1|987379_989092_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376994.1|989160_989880_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_017376995.1|989876_990479_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376996.1|990593_991481_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|991671_992019_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376997.1|992069_992909_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_017376998.1|993004_993751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063589.1|993947_994574_+	porin family protein	NA	NA	NA	NA	NA
WP_017377000.1|994889_995459_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017377001.1|995602_996301_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377003.1|997007_997631_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052106204.1|997740_998634_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377006.1|998740_1000351_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_027242880.1|1000347_1001643_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_027242879.1|1001664_1003587_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_017377007.1|1003697_1004000_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_017377008.1|1004094_1008981_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_047927528.1|1009028_1010351_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_036771855.1|1010475_1011570_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_027242877.1|1011621_1012560_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_026063591.1|1012640_1013225_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242876.1|1013609_1014500_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_017377014.1|1014702_1015194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242875.1|1015333_1015825_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1015993_1016707_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065653747.1|1016769_1018110_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_048875904.1|1018374_1019250_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	1024863	1087678	3198778	transposase	Staphylococcus_phage(33.33%)	57	NA	NA
WP_017377787.1|1024863_1025091_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377021.1|1025117_1026158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377022.1|1026224_1026794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|1027024_1027429_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1027441_1027582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929560.1|1027676_1028876_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_016211971.1|1028896_1029508_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_027242871.1|1029709_1030471_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080963583.1|1030766_1031693_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_144420803.1|1031853_1032810_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999998.1|1032954_1033224_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1033490_1034465_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375625.1|1034618_1034846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420711.1|1034962_1035388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|1035544_1036474_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_027242870.1|1036920_1037451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046580.1|1037835_1038078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|1038555_1038867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963609.1|1039206_1040373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|1042560_1043532_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046581.1|1044134_1044308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376283.1|1044703_1045621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376284.1|1045621_1046473_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1046913_1047960_+	glutathione synthase	NA	NA	NA	NA	NA
WP_144420802.1|1047949_1049941_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_036773579.1|1050050_1050425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420801.1|1050678_1050861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|1051122_1051824_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420709.1|1051824_1052244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619460.1|1054185_1056969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376294.1|1057204_1058497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|1058983_1059889_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376296.1|1060666_1061383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1061668_1062430_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_048876053.1|1062462_1063866_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1063862_1064027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|1064086_1064374_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017375910.1|1065118_1065847_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_048876052.1|1065815_1066562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046685.1|1066612_1067032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1067028_1068003_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772454.1|1068159_1068477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772457.1|1070952_1071261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|1071336_1071609_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_017377863.1|1074142_1074580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|1075181_1076369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963626.1|1076639_1078274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|1078324_1079053_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377858.1|1080480_1081443_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377857.1|1081666_1082662_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377856.1|1082689_1083625_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|1083668_1084130_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080963625.1|1084108_1084726_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1084755_1085730_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377852.1|1085784_1086252_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377851.1|1086264_1086909_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|1086949_1087678_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
>prophage 13
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	1096378	1147525	3198778	transposase	Acinetobacter_phage(22.22%)	41	NA	NA
WP_082300708.1|1096378_1096939_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378014.1|1098263_1098659_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378015.1|1098667_1099024_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_048876047.1|1099016_1099892_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420706.1|1099977_1100556_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876046.1|1100513_1100807_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_047927811.1|1101767_1103279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155062811.1|1103526_1104912_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1105116_1105374_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774189.1|1105373_1106381_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999997.1|1106714_1107149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275341.1|1107231_1107936_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999996.1|1108194_1108683_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_051929548.1|1108711_1109386_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|1109626_1110502_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075275340.1|1111032_1111641_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375723.1|1111911_1112370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375724.1|1112648_1113038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|1113223_1114039_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375727.1|1114261_1115167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211119.1|1115330_1116092_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375728.1|1116095_1116962_+	OmpA family protein	NA	NA	NA	NA	NA
WP_017375729.1|1117047_1117659_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_017375730.1|1118037_1119285_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_144420800.1|1119436_1120138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|1120435_1120609_-	phosphatase	NA	NA	NA	NA	NA
WP_048876044.1|1121098_1121599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1122677_1122905_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036774233.1|1122957_1123191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|1123219_1123900_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027242790.1|1123922_1126097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378188.1|1126342_1127413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1127409_1128813_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619408.1|1128961_1129447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242789.1|1129518_1130340_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_017378192.1|1131006_1132506_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_017378193.1|1132809_1135503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242788.1|1135499_1138901_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_048875961.1|1140488_1141892_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378201.1|1142970_1143642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1146550_1147525_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 14
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	1172248	1228946	3198778	transposase,tRNA	Staphylococcus_phage(28.57%)	51	NA	NA
WP_053093677.1|1172248_1172968_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_155046584.1|1173195_1173372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375975.1|1173620_1173944_+	YqcC family protein	NA	NA	NA	NA	NA
WP_036771316.1|1174032_1176051_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375977.1|1176073_1177027_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375978.1|1177192_1178380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876036.1|1179093_1179732_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_036771312.1|1180029_1181025_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_155052679.1|1181900_1182500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|1182492_1183518_+	FUSC family protein	NA	NA	NA	NA	NA
WP_017375766.1|1183584_1185615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1186921_1187149_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375561.1|1188492_1188636_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062365727.1|1188632_1189325_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242771.1|1189591_1189909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242770.1|1190051_1190462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242769.1|1190618_1190945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963649.1|1191091_1192129_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242767.1|1192170_1192416_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_129556541.1|1192540_1192855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242765.1|1192862_1194437_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_027242764.1|1194591_1195161_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242763.1|1195470_1197273_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_087910649.1|1197269_1198211_+	signal peptidase I	NA	NA	NA	NA	NA
WP_027242761.1|1198622_1199297_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_144420798.1|1199302_1200202_+	GTPase Era	NA	NA	NA	NA	NA
WP_027242759.1|1200215_1200959_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_027242758.1|1200961_1201693_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242757.1|1201689_1202073_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242756.1|1202210_1203458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242755.1|1203868_1205014_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242754.1|1205006_1205360_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242753.1|1205640_1206183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927692.1|1206827_1207016_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1207035_1208010_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420702.1|1208053_1208929_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036815628.1|1209282_1210110_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080963648.1|1210209_1210371_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375762.1|1211021_1212362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1213413_1213641_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027243003.1|1213782_1215144_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_027243002.1|1215239_1215899_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_017375760.1|1216641_1216794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375759.1|1216784_1217096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375757.1|1217692_1219252_-	APC family permease	NA	NA	NA	NA	NA
WP_017375893.1|1221796_1222867_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017375892.1|1222924_1223131_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375891.1|1223137_1224613_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375890.1|1224748_1225312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1225481_1226885_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242999.1|1227851_1228946_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	1245188	1292913	3198778	transposase	Staphylococcus_phage(50.0%)	42	NA	NA
WP_036772169.1|1245188_1246064_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876030.1|1246133_1247237_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774087.1|1247304_1247628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242984.1|1247784_1248567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063491.1|1248702_1249680_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_047927375.1|1249753_1251745_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_017375900.1|1251800_1252082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1252335_1253535_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_051929862.1|1255966_1256479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1256665_1257541_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375562.1|1257577_1257742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1258950_1259364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774270.1|1259374_1259710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420796.1|1259854_1260973_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876026.1|1261202_1261469_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1262751_1262979_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773258.1|1262989_1263496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243127.1|1263573_1264191_-	VOC family protein	NA	NA	NA	NA	NA
WP_017376680.1|1264322_1265555_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_017376681.1|1265544_1266207_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_026063554.1|1266481_1267738_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_087910647.1|1267875_1268535_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376683.1|1268609_1269311_+	cyclase family protein	NA	NA	NA	NA	NA
WP_036771330.1|1270058_1271033_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376688.1|1272241_1272595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1272808_1273003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1273070_1273583_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376691.1|1273720_1274575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1274623_1275268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1275301_1275946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653744.1|1276486_1276762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376695.1|1276860_1277643_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_017376696.1|1277725_1278676_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_027243124.1|1280718_1283559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376700.1|1283581_1284163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376701.1|1284282_1285011_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_036771330.1|1285156_1286131_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243123.1|1286246_1287152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376705.1|1287750_1288497_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376706.1|1288749_1289142_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376707.1|1289179_1289827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1291542_1292913_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	1317020	1358230	3198778	transposase	Enterobacteria_phage(16.67%)	37	NA	NA
WP_048876023.1|1317020_1318124_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_087910645.1|1318214_1319367_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876022.1|1319780_1320632_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420700.1|1320769_1320919_-	phosphatase	NA	NA	NA	NA	NA
WP_017377952.1|1321543_1323910_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_017377953.1|1323957_1325154_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_027242965.1|1325722_1328155_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036773041.1|1328476_1329976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242964.1|1330084_1330657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|1330971_1332441_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017377960.1|1332513_1333263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876021.1|1333266_1334040_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_027242961.1|1334138_1335089_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017377963.1|1335228_1336671_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242960.1|1336886_1338071_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377966.1|1338194_1338881_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_026063694.1|1339016_1339601_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_144420699.1|1339690_1340020_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017377969.1|1340355_1340595_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_017377970.1|1340643_1340835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275334.1|1341609_1341903_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420698.1|1342051_1342213_-	phosphatase	NA	NA	NA	NA	NA
WP_017378162.1|1342727_1343267_-	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1343605_1344250_-	porin family protein	NA	NA	NA	NA	NA
WP_017378160.1|1344583_1345234_-	porin family protein	NA	NA	NA	NA	NA
WP_017378159.1|1345757_1346810_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378158.1|1346827_1349908_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242571.1|1350073_1350322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|1350387_1351263_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772025.1|1352185_1352692_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027243218.1|1352709_1352907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1352925_1353069_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155046586.1|1353136_1353310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1353514_1354828_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000010.1|1354837_1355101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1355159_1356134_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377787.1|1358002_1358230_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 17
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	1389447	1438346	3198778	transposase,tRNA	Bacillus_thuringiensis_phage(25.0%)	40	NA	NA
WP_036772026.1|1389447_1390323_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242912.1|1390427_1393730_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_017376668.1|1393726_1395550_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_017376669.1|1395589_1395988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242911.1|1396096_1397113_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_027242910.1|1397547_1399002_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376672.1|1399083_1402140_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_144420694.1|1402433_1402670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081329473.1|1403530_1403950_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376676.1|1404322_1404787_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075275332.1|1404859_1405861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771585.1|1408753_1409086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420693.1|1409447_1409591_-	phosphatase	NA	NA	NA	NA	NA
WP_048876152.1|1409578_1410523_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080963606.1|1410526_1410913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275328.1|1410734_1411073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376273.1|1411447_1412047_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017376274.1|1412046_1412394_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_026063520.1|1412544_1413528_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376276.1|1414437_1414752_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_144420691.1|1414900_1415059_-	phosphatase	NA	NA	NA	NA	NA
WP_144420690.1|1415030_1415960_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_026063521.1|1416874_1417291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1418419_1419136_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376099.1|1419884_1420043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1420091_1420667_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_075275424.1|1420811_1421090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376100.1|1421154_1422030_-	ParA family protein	NA	NA	NA	NA	NA
WP_048876018.1|1422195_1426062_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376103.1|1426217_1427027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376104.1|1427076_1427898_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376105.1|1428097_1429330_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376106.1|1429500_1430226_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376107.1|1430268_1431807_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376108.1|1431813_1433199_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_048876011.1|1433512_1434562_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1435121_1435499_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420688.1|1435690_1436566_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1437547_1437775_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876149.1|1437827_1438346_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	1442644	1628210	3198778	transposase,tRNA,protease,integrase	Staphylococcus_phage(19.51%)	167	1509107:1509166	1579532:1580142
WP_048875984.1|1442644_1443181_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876016.1|1443325_1443736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375877.1|1444006_1444255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876014.1|1444615_1444951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375878.1|1445288_1445561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243180.1|1445632_1446892_-	phosphoesterase	NA	NA	NA	NA	NA
WP_017375881.1|1446976_1448242_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	1.2e-48
WP_026063485.1|1448400_1448883_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_036772592.1|1448960_1450421_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.4	2.3e-56
WP_155046587.1|1450543_1450684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063486.1|1451097_1451598_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_017375698.1|1457712_1458906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243221.1|1459249_1460878_+	cytochrome d terminal oxidase subunit I	NA	NA	NA	NA	NA
WP_027243222.1|1460893_1462042_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_051929845.1|1462116_1462941_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1463344_1464319_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927610.1|1464504_1465098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1465278_1465743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910660.1|1466137_1466419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1466415_1467819_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377324.1|1468470_1468851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1469090_1469747_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_036773200.1|1469891_1470188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1470247_1470535_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_027243051.1|1470818_1471028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772296.1|1471724_1472102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1472301_1473351_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377209.1|1473327_1475145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1475415_1475994_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_065653751.1|1476021_1476486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377206.1|1476522_1477980_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_027243048.1|1478041_1479529_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377202.1|1480298_1480901_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_017377201.1|1481462_1481933_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_036772316.1|1483580_1484324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275422.1|1484475_1484907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243044.1|1487544_1488891_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_036772310.1|1488978_1490784_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_017378301.1|1491249_1492047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378302.1|1492431_1492893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1493115_1494090_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963614.1|1494132_1494255_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376833.1|1494326_1496282_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1496671_1496857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376832.1|1497178_1498168_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_027243043.1|1498580_1500206_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376830.1|1500314_1500629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1500924_1502310_+	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376829.1|1502474_1502702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1502842_1503301_-	amino acid permease	NA	NA	NA	NA	NA
WP_144420685.1|1503501_1503687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1503755_1504583_-	DsbA family protein	NA	NA	NA	NA	NA
WP_144420792.1|1505037_1505562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420684.1|1505744_1505993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243041.1|1506162_1507116_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_036771330.1|1507310_1508285_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876009.1|1508412_1509438_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
1509107:1509166	attL	CCACCACGTGTCACTGATAAGTGGACGTGCGTATTCCAATTTAAACTCTGGCCGAAAGTA	NA	NA	NA	NA
WP_017376231.1|1510090_1510378_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929542.1|1510437_1510770_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081377820.1|1510974_1511535_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
WP_017376814.1|1514129_1514855_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_026063564.1|1515229_1518049_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	5.2e-312
WP_048876146.1|1518898_1520032_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	2.6e-15
WP_017376809.1|1520256_1522026_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_017376808.1|1522164_1523208_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376807.1|1523221_1523965_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_062312151.1|1524062_1524395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|1524456_1524636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243094.1|1524698_1525406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420791.1|1526189_1527401_+	protein kinase	NA	NA	NA	NA	NA
WP_017376801.1|1527456_1528281_-	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_017376798.1|1529468_1530104_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017376797.1|1530385_1530745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|1531018_1533304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420683.1|1533292_1533949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243096.1|1534125_1534758_+	MarC family protein	NA	NA	NA	NA	NA
WP_027243097.1|1534793_1534979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243098.1|1535044_1536190_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_027243099.1|1536425_1537739_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
WP_155046588.1|1538854_1539064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420682.1|1539598_1539760_-	phosphatase	NA	NA	NA	NA	NA
WP_017376785.1|1541166_1542072_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376784.1|1542312_1542498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242578.1|1542534_1543071_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_027242577.1|1543088_1544390_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_048876008.1|1544386_1545361_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_155046589.1|1545440_1545590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046590.1|1545769_1545934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1545935_1546811_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420680.1|1547126_1548047_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_017375696.1|1548062_1548446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1548772_1549729_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_144420678.1|1549996_1550275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243017.1|1550773_1552117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046591.1|1552290_1552434_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1552513_1553488_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927346.1|1553635_1555507_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_075275322.1|1555539_1555638_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017378518.1|1555873_1556503_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017378517.1|1556486_1556909_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378516.1|1556915_1558655_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378515.1|1558655_1559720_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1559723_1560077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1560189_1561158_+	ferrochelatase	NA	NA	NA	NA	NA
WP_017378513.1|1561167_1561479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1561494_1562064_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378512.1|1562327_1563656_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_036771639.1|1563696_1564671_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420677.1|1565257_1565659_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_146619459.1|1566178_1568635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773893.1|1568837_1569689_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275420.1|1569734_1571441_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_069971648.1|1572912_1573887_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_047927336.1|1574249_1574495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653736.1|1574858_1575887_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017375591.1|1576017_1576221_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420676.1|1576505_1577462_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
WP_047927838.1|1577754_1578000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1577996_1578296_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_036774927.1|1578518_1578989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1579599_1579827_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036772851.1|1581049_1581367_+	hypothetical protein	NA	NA	NA	NA	NA
1579532:1580142	attR	TACTTTCGGCCAGAGTTTAAATTGGAATACGCACGTCCACTTATCAGTGACACGTGGTGGTGTTCTGGTCAAGTCATATTGGACACTTTTAATTGAGACTTTTCAAAATTAATAGGCGATAGGTTAGCATTGGCTGTATGCAACCGATCATGATTGTAATATCGAATATAGGCCTCAACATCCTCCTTCATAGTATCACGGGTTAAGTGAATCACATTCAACAGCCATTCGTGCTTTAGGCTGCCAAAAAAACGCTCGACAACCGCATTGTCAACGCAAGCACCGACACTGCTCATAGAAGCGGTGATTTTATGCTTCTTCAACAGTTTTCGATATTTTTTACTGGTATACTGCGAACCACGATCACTGTGAAATAACAAGTGTTCTGTCGGCTGCCGCAAGTGAATCGCCATATCCATTGCACGACAAACTAGATTTTCGCTCATTCTCTTATTCATCGCCCAGCCAATCACTTTTCGAGAGTATAAATCAATAACGACCGCAAGATACAACCAGCCTTCAGCAGTTCTAAGGTAGGTAATGTCACCTGCCCATGAGTGATTTGCAATGACTGGATTAAACTGCTGATTCAATACGTTATCTGCAACAGC	NA	NA	NA	NA
WP_027243023.1|1581360_1581603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243024.1|1581953_1583054_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_017377328.1|1583222_1584524_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_047927520.1|1584600_1585104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|1585279_1586683_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772872.1|1586870_1587728_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243025.1|1587852_1588488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1588536_1588788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243027.1|1589043_1589943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1590079_1591153_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017375995.1|1591253_1591667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375994.1|1591687_1592401_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_027243028.1|1592588_1594001_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243029.1|1594210_1595179_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_075275321.1|1595912_1596281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420675.1|1596284_1596602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1596677_1597652_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375989.1|1598171_1598672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243163.1|1598742_1600071_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036773519.1|1600206_1601595_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243165.1|1601742_1603053_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|1603393_1604677_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_017375982.1|1604750_1605371_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_051929832.1|1605569_1605830_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155046592.1|1606032_1606179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876006.1|1606154_1606748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816364.1|1608611_1608830_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772303.1|1610082_1610853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420790.1|1610939_1611155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376496.1|1611251_1612373_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_036771330.1|1612639_1613614_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771628.1|1613876_1614998_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_017376491.1|1615290_1615578_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1615550_1616054_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_053093673.1|1616134_1616794_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876005.1|1617135_1618053_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_075275317.1|1618182_1618356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1619021_1620380_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_144420789.1|1620571_1621018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376485.1|1621212_1622442_-	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_017376484.1|1622487_1623114_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_027242833.1|1623263_1624451_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_048876004.1|1624459_1625152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910642.1|1625273_1626426_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876002.1|1627226_1628210_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
>prophage 19
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	1686545	1776860	3198778	transposase,tRNA,protease	Burkholderia_phage(14.29%)	82	NA	NA
WP_036774017.1|1686545_1687421_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377182.1|1687810_1688149_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_026063604.1|1688145_1688742_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_027242821.1|1688744_1690739_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_017377185.1|1690802_1691741_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_036771332.1|1692089_1693064_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_080999986.1|1693267_1693465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000007.1|1693626_1694031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816928.1|1695614_1696055_+	universal stress protein	NA	NA	NA	NA	NA
WP_048875996.1|1696381_1697257_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420669.1|1697269_1697512_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275315.1|1697918_1698173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1699384_1700350_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420668.1|1700442_1700754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1700954_1701731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816899.1|1702560_1702752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377573.1|1703480_1704530_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_017377574.1|1704700_1705474_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377575.1|1705534_1707124_-	APC family permease	NA	NA	NA	NA	NA
WP_017377576.1|1707314_1708406_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377577.1|1708428_1708746_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377578.1|1708832_1710110_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377579.1|1710131_1710968_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377580.1|1710974_1712609_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_026063647.1|1713040_1713400_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377583.1|1713681_1715040_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_017377584.1|1715065_1715308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|1715801_1715981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|1716236_1717493_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377585.1|1717606_1717864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420667.1|1718008_1719019_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_144420786.1|1719395_1720250_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|1720279_1721113_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_036773204.1|1721689_1722463_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_047927606.1|1722544_1722865_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_144420665.1|1723083_1723989_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_048875992.1|1724074_1724473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|1724617_1725115_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047927093.1|1726775_1727879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929549.1|1727977_1728355_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1728434_1729409_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_080999985.1|1730953_1731673_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1731756_1732044_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420664.1|1732328_1733201_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_048875990.1|1733157_1733934_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036816484.1|1734138_1734474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963600.1|1734872_1735229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377440.1|1735390_1735666_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_017377441.1|1735775_1736123_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377442.1|1736140_1736920_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377443.1|1736919_1737429_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|1737464_1737713_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377444.1|1738024_1738360_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_017377445.1|1738659_1739910_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242820.1|1739991_1742019_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377447.1|1742564_1742783_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242819.1|1742954_1743317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|1743465_1744869_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242818.1|1745150_1746326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377453.1|1746343_1748341_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242817.1|1748321_1749302_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075275308.1|1749357_1750200_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_036772544.1|1750199_1750616_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275307.1|1750596_1751016_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017377459.1|1751038_1751668_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017377460.1|1752236_1754426_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377461.1|1754437_1755643_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_080963599.1|1755627_1757475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106215.1|1757459_1758698_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242814.1|1758684_1760553_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_027242813.1|1760586_1761840_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017377465.1|1761845_1762703_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_017377694.1|1762721_1763450_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_081078114.1|1764588_1765380_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017376231.1|1765745_1766033_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017376477.1|1768155_1768545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376476.1|1768721_1769480_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_036772166.1|1769476_1771876_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_027242812.1|1771889_1773167_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_017376475.1|1773256_1774555_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_017376474.1|1774752_1775646_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_027242811.1|1775645_1776860_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 20
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	1787559	1838044	3198778	transposase,tRNA	Vibrio_phage(14.29%)	46	NA	NA
WP_069971651.1|1787559_1788435_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376461.1|1788807_1789071_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_017376460.1|1789377_1791972_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376459.1|1791968_1792451_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_017376458.1|1792428_1793469_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376457.1|1793643_1794129_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376456.1|1794236_1796807_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376455.1|1796840_1797302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773947.1|1797638_1798514_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376452.1|1798791_1800552_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_017376451.1|1800645_1801311_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376450.1|1801323_1802829_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376449.1|1802850_1803381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376448.1|1803454_1804717_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376447.1|1804903_1805776_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_026063532.1|1805877_1806666_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376445.1|1806758_1808084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376444.1|1808437_1809613_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376443.1|1809781_1810435_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376442.1|1810590_1812531_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_036773538.1|1812527_1813151_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036773116.1|1813315_1814290_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_075275305.1|1814561_1815182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1815178_1816582_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910640.1|1816649_1817066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875986.1|1817473_1817971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1817967_1818942_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046598.1|1819021_1819591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1819735_1820272_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375549.1|1820276_1820573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1820581_1821187_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017378212.1|1821372_1821771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1821961_1822165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046599.1|1822309_1822465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378213.1|1822589_1823042_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017378214.1|1823158_1824631_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_016211840.1|1825069_1825534_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_144420785.1|1826222_1827473_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_017378219.1|1827582_1828053_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_047927040.1|1828075_1828669_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_027242798.1|1828806_1829856_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_017378221.1|1829879_1830803_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1830819_1831281_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378223.1|1831388_1832207_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155046600.1|1832816_1832960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378228.1|1837123_1838044_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 21
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	1900335	1915651	3198778	transposase	Staphylococcus_phage(50.0%)	15	NA	NA
WP_017378288.1|1900335_1900557_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1900615_1901590_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046582.1|1901788_1901953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|1901949_1902585_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046602.1|1902861_1903641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1903673_1904435_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_075275303.1|1904411_1905401_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378290.1|1905536_1906412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|1906430_1907090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927801.1|1907331_1907778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1907774_1909178_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378294.1|1909291_1910137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1910281_1911931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378296.1|1912021_1912807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875980.1|1914247_1915651_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	1944324	1993196	3198778	transposase,tRNA	uncultured_Mediterranean_phage(33.33%)	43	NA	NA
WP_144420657.1|1944324_1945386_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420656.1|1946097_1946259_+	phosphatase	NA	NA	NA	NA	NA
WP_017376418.1|1947175_1947715_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_017376419.1|1948097_1948514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|1948609_1949425_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376421.1|1949557_1951051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|1951236_1951662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376423.1|1951658_1953719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376424.1|1954002_1954818_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376425.1|1954918_1955737_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_027242802.1|1955733_1956102_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_075275409.1|1956283_1957111_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|1957174_1957903_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1958305_1959034_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017376428.1|1959423_1960149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875975.1|1960183_1964056_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376430.1|1964256_1965390_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_026063530.1|1965403_1965592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376433.1|1965815_1967174_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_036773947.1|1968780_1969656_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875973.1|1970167_1970803_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999981.1|1970815_1971289_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_155046603.1|1971216_1971369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929627.1|1971562_1971913_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1971972_1972260_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420654.1|1972312_1973092_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376415.1|1973516_1974434_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376414.1|1974485_1975241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242801.1|1975308_1976583_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376412.1|1976703_1977381_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017376411.1|1977581_1979006_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_016209938.1|1978980_1979619_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376410.1|1979981_1980260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376409.1|1980493_1981438_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376408.1|1981459_1983328_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376407.1|1983348_1983702_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_026063528.1|1983740_1984856_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376405.1|1985040_1986081_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_027242800.1|1986083_1987118_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_017376402.1|1987114_1988176_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_017376401.1|1988287_1989760_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
WP_017376400.1|1989912_1990356_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017376399.1|1990424_1993196_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
>prophage 23
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	1997627	2046494	3198778	transposase	Staphylococcus_phage(25.0%)	46	NA	NA
WP_036773116.1|1997627_1998602_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376395.1|1999125_2001852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|2002739_2003714_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_051929562.1|2003964_2004669_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377436.1|2005908_2006427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242883.1|2007394_2008879_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_017377433.1|2009003_2010539_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017377432.1|2010561_2010891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963636.1|2010787_2011003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910639.1|2012986_2014186_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017377428.1|2014395_2015256_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_017377427.1|2015371_2015950_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_017377426.1|2016106_2016748_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	3.3e-07
WP_017377425.1|2016786_2017008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377424.1|2017000_2017984_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	6.2e-53
WP_080963565.1|2018377_2018875_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026063633.1|2019019_2019295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377423.1|2019446_2021129_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.1e-24
WP_017377422.1|2021136_2022159_-	YHYH protein	NA	NA	NA	NA	NA
WP_017377421.1|2022327_2023329_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_017377420.1|2023442_2023781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377419.1|2024256_2025516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2025724_2025952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420653.1|2025980_2026199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772807.1|2026336_2026702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772810.1|2026769_2027012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242887.1|2027026_2027362_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_017377418.1|2027366_2027804_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_036772812.1|2027829_2029215_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_036772815.1|2029325_2029757_-	flaG family protein	NA	NA	NA	NA	NA
WP_144420782.1|2029862_2031374_-	B-type flagellin	NA	NA	NA	NA	NA
WP_017377414.1|2031664_2033257_-	flagellin	NA	NA	NA	NA	NA
WP_027242888.1|2033457_2035653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772819.1|2035746_2037180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927084.1|2037222_2037738_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036772822.1|2037737_2038685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242892.1|2038668_2039334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242893.1|2039330_2040059_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047927085.1|2040048_2040795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963566.1|2040778_2041843_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_017377789.1|2042047_2043235_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377788.1|2043291_2044410_-	hypothetical protein	NA	A0A1V0SIK8	Klosneuvirus	29.3	1.0e-11
WP_047927086.1|2044857_2045115_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
WP_155062818.1|2045056_2045257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420652.1|2045394_2046072_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_017375591.1|2046290_2046494_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	2066194	2115729	3198778	transposase,protease,tRNA	Burkholderia_virus(20.0%)	41	NA	NA
WP_017377787.1|2066194_2066422_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377765.1|2066511_2067267_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377764.1|2067680_2068277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377763.1|2068356_2071161_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377762.1|2071141_2072095_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377761.1|2072087_2073458_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_080999971.1|2073628_2075032_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275295.1|2075803_2076130_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420651.1|2076334_2076988_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_017376600.1|2077307_2077487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|2077742_2078999_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999979.1|2079237_2079384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081049196.1|2079466_2079823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|2080318_2080678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375623.1|2080687_2081071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|2081959_2082100_+	phosphatase	NA	NA	NA	NA	NA
WP_048875965.1|2082244_2083165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377998.1|2085322_2085853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243145.1|2085863_2086919_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_036773465.1|2086934_2088974_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_017378003.1|2088960_2089791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378004.1|2089857_2093397_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378005.1|2093510_2094230_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378006.1|2094468_2095098_+	response regulator	NA	NA	NA	NA	NA
WP_048875961.1|2095217_2096621_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378007.1|2096766_2098710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|2099227_2100088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|2100523_2102269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420648.1|2102671_2104144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|2104326_2104926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|2105063_2105261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|2105461_2105602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875964.1|2105669_2106449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|2107013_2107415_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773793.1|2107559_2107937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|2108396_2109704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619530.1|2110452_2110710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2110761_2112165_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377869.1|2112405_2114115_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377870.1|2114284_2114647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875960.1|2114754_2115729_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 25
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	2130298	2189851	3198778	transposase,tRNA,protease	unidentified_phage(14.29%)	60	NA	NA
WP_017377892.1|2130298_2131720_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_026063687.1|2131809_2133408_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377894.1|2133564_2134191_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_027242839.1|2134271_2136944_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377896.1|2137426_2138383_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_017377897.1|2138435_2138855_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_048875958.1|2138881_2139745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377899.1|2139734_2140526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|2140830_2141802_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375746.1|2142150_2142459_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_048875957.1|2142455_2143112_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375749.1|2143245_2143731_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_017375750.1|2143808_2144330_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375751.1|2144375_2145269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|2145265_2146087_-	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_155046605.1|2146281_2146431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|2146658_2147489_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046606.1|2148894_2149065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242841.1|2149217_2150621_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_048875956.1|2150730_2151972_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080963644.1|2151958_2152690_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_017376088.1|2152701_2153979_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_017376087.1|2154078_2154453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376086.1|2154537_2155425_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376085.1|2155482_2156211_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_036771725.1|2156207_2157317_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376083.1|2157468_2157897_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_144420777.1|2157991_2158348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376081.1|2158340_2159552_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376080.1|2159548_2160337_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376079.1|2160499_2161294_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376078.1|2161743_2162484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376077.1|2162487_2164986_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376076.1|2165248_2166205_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_036771709.1|2166188_2166950_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_048875955.1|2167157_2168132_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_048875954.1|2168240_2168996_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2169120_2169366_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_017376072.1|2169425_2171699_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_036772670.1|2171753_2172056_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_016211261.1|2172296_2172590_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_065653731.1|2172760_2172940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420644.1|2173015_2173627_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376068.1|2173873_2175190_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2175200_2175569_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376067.1|2175599_2176262_-	adenylate kinase	NA	NA	NA	NA	NA
WP_144420776.1|2176684_2177263_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376065.1|2177242_2177650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999977.1|2177773_2178070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2178116_2178992_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876123.1|2179061_2181242_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_017376060.1|2181345_2182695_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_036772012.1|2182768_2183458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|2183590_2184778_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376055.1|2185296_2185941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|2185937_2187251_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|2187455_2187629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|2187898_2188372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420642.1|2188516_2188711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|2188975_2189851_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	2208913	2257424	3198778	transposase,tRNA	Staphylococcus_phage(16.67%)	42	NA	NA
WP_036771639.1|2208913_2209888_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875951.1|2209931_2210768_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376035.1|2210913_2211333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|2211609_2212290_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875949.1|2212255_2212606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376032.1|2212638_2213850_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376031.1|2214190_2214820_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376030.1|2214868_2215885_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_016211035.1|2216131_2216347_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376029.1|2216399_2216849_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_027243175.1|2216928_2218674_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376026.1|2218765_2220637_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_053093667.1|2221081_2221798_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378197.1|2223235_2224105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2224061_2224289_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378198.1|2225257_2226172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875948.1|2226217_2227240_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_155062820.1|2227308_2227968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155062822.1|2228112_2228646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046607.1|2229262_2229445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243219.1|2229729_2230038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2230204_2231608_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046608.1|2231700_2231865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771959.1|2232186_2232411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|2232421_2233633_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036774710.1|2234027_2234927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375571.1|2235100_2235502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|2235748_2236792_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376859.1|2236911_2237148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376860.1|2237936_2239490_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_082300723.1|2241670_2241898_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971648.1|2242768_2243743_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_017375736.1|2244469_2245552_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_017375735.1|2245594_2246245_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375734.1|2246467_2246839_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_027243178.1|2246949_2248311_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_155046609.1|2250031_2250238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2250548_2251631_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2251627_2251939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2252984_2253959_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999976.1|2254965_2255745_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|2256206_2257424_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	2270273	2331241	3198778	transposase,integrase	Staphylococcus_phage(30.0%)	47	2278126:2278185	2328547:2329307
WP_144420638.1|2270273_2271356_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2271352_2271664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243152.1|2273161_2274097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774146.1|2274689_2275835_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_048875940.1|2278077_2279241_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
2278126:2278185	attL	GTCTTAGAGGTCATTGAAGGAGATCAGACGCTCAACCAAATATGCTCGAAATATGAGCTA	NA	NA	NA	NA
WP_144420637.1|2279269_2279494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|2280841_2282017_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420636.1|2282362_2284873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|2284931_2285744_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377669.1|2286184_2286889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2286938_2287913_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420634.1|2288017_2289349_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420774.1|2289547_2289616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375857.1|2289747_2291190_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420773.1|2291581_2292994_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375855.1|2293683_2294130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|2294724_2295573_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017376916.1|2295826_2296885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927497.1|2296876_2298583_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_036774028.1|2298654_2300388_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_017376912.1|2300684_2301251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376911.1|2301375_2302029_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_027243158.1|2302055_2303516_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376909.1|2303612_2304590_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_048875878.1|2305059_2306463_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063577.1|2306988_2307282_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_026063576.1|2307508_2308273_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_017376905.1|2308480_2308708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|2308771_2308954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376903.1|2309516_2309696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046690.1|2309738_2310071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|2310925_2311630_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376899.1|2311827_2311968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772665.1|2312372_2312897_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144420633.1|2313043_2314300_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|2314367_2314847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2315287_2316691_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243186.1|2317105_2319487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377475.1|2319993_2321886_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_036771639.1|2322057_2323032_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377472.1|2323335_2324142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377471.1|2324210_2324822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377467.1|2326303_2326600_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_075275282.1|2326596_2327439_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|2327829_2328615_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_080999974.1|2328619_2330023_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2328547:2329307	attR	TAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCCTTCAATGACCTCTAAGACTAATGGCACTACCTTAAGGAGCGGATGAACATTTTTTATTGCTATTTTTCTTCATTCTTTTAGTTATTTCTGCCTTTTCCAATTCCCTGCTTTTATTCAGTCGCCTGAATGCTTTGGGACGTTTTTTAACAGCCCGAGGTTCAATCCGTCCAGGCCTATTCCCAACCTTGTTTTTTATGATTGCATGCAACAATATTGCATGGGCTTTATTACAGTCTGCCGAGAAACTGAGTAATGACACAAAGCTATTAAATAACTGTATTACATCCTTGAAACTAACCTGTATAGGAAGGCGTTCAGTATTACGACAAGCTTCTGCAATAAGCGTTCTAATTAAGTTGTATGCTAAAAAGTGTACTGCAATTTCTTTATGTACCATGTCAGGTGTCTTACTTCTTAAATGATCCATTGACATAATGGTTTTTAAGCTGTTGAAATTGATTTCAATGTGCCACCTTTGTTTGTAATGATTAGCCAATGCAACTTTATTGTATTTTTTATGATCTTGAAAAGTTGTTACATAAACCTCCCCTTTGATTTTGAACTCTCTTACCGTCATTTGATCAGGATAACTATCGTATGTTTCTTGTGTCATCCAGTCAGGTTTGTGAGGCTTTTTCCAAATGACAAGGTGATTTTTTGAACCCAACTTCCTTCCTTTACGAAAGTCATACTTCCTCTGTGAATGTGCTTTAAAAATA	NA	NA	NA	NA
WP_048875933.1|2330296_2331241_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	2352083	2379736	3198778	transposase,protease	Staphylococcus_phage(25.0%)	28	NA	NA
WP_017377305.1|2352083_2353385_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_016209647.1|2353466_2354072_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377304.1|2354184_2355489_-	trigger factor	NA	NA	NA	NA	NA
WP_017377303.1|2356089_2356965_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_075275279.1|2357080_2357752_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377301.1|2357931_2359287_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_017377300.1|2359407_2360145_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_144420629.1|2360223_2360940_-	aldolase	NA	NA	NA	NA	NA
WP_036771756.1|2361588_2362863_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2362893_2363469_+	VOC family protein	NA	NA	NA	NA	NA
WP_017377295.1|2363513_2364479_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_027243030.1|2364942_2365851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875931.1|2366238_2366490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377293.1|2366634_2367063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|2367048_2367993_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046611.1|2368197_2368350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910637.1|2368378_2369113_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_017377288.1|2369207_2369468_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999973.1|2369686_2370652_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_146619452.1|2370628_2370925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|2371115_2371565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|2371824_2372253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|2372348_2372849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|2372785_2372947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420627.1|2373827_2374049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093666.1|2375547_2376225_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_081377824.1|2377539_2377878_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2378761_2379736_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 29
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	2418980	2546732	3198778	transposase,tRNA	Burkholderia_virus(25.0%)	106	NA	NA
WP_080999971.1|2418980_2420384_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377224.1|2420497_2421073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|2422318_2422546_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377221.1|2422835_2423375_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_027243151.1|2423684_2425172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300719.1|2425223_2425649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2425867_2427271_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377217.1|2427267_2427645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243150.1|2427604_2428150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|2428545_2429772_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377214.1|2430372_2432025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046613.1|2431961_2432156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155062826.1|2432488_2433337_-	MFS transporter	NA	NA	NA	NA	NA
WP_027243147.1|2434215_2436888_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_027243146.1|2437176_2438013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420769.1|2438673_2439564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2440032_2441007_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876012.1|2441491_2442895_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|2443040_2444444_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155049759.1|2444528_2446349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999970.1|2448254_2449658_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376197.1|2449691_2451221_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_017376198.1|2451256_2452717_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_027242908.1|2452691_2453651_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_017376200.1|2453728_2457235_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.6	1.9e-192
WP_017376201.1|2457258_2457828_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	43.4	3.4e-27
WP_027242907.1|2458041_2459196_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_017376204.1|2459214_2459988_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|2459987_2460434_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017376206.1|2460451_2461501_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_017376207.1|2461611_2462145_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_036771893.1|2462225_2464643_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_027242906.1|2464927_2465995_+	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_017376209.1|2468197_2469262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376210.1|2469251_2470280_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_017376211.1|2470276_2470816_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_017376212.1|2471352_2473263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420623.1|2473310_2473508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420622.1|2473707_2475285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771906.1|2475381_2476257_-	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_080963646.1|2476345_2477245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063514.1|2477159_2477906_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.0	6.6e-23
WP_017376216.1|2477913_2478471_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_017376217.1|2478474_2479212_-	UMP kinase	NA	NA	NA	NA	NA
WP_017376218.1|2479215_2480094_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_017376219.1|2480258_2481026_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_017376220.1|2481432_2482242_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376221.1|2482319_2484977_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_017376222.1|2484980_2486018_+	asparaginase	NA	NA	NA	NA	NA
WP_017376223.1|2486019_2486841_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376224.1|2486971_2487856_+	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_036773116.1|2488168_2489143_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|2489195_2490191_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2490233_2491208_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376319.1|2491832_2492513_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_017376318.1|2492512_2493322_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027242903.1|2493395_2497076_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_026063524.1|2497085_2498573_-	ribonuclease G	NA	NA	NA	NA	NA
WP_017376313.1|2498582_2499200_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_017376312.1|2499269_2499788_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376311.1|2499784_2500684_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2500699_2501743_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376309.1|2501940_2502228_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_017376308.1|2502348_2503809_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_027242902.1|2503888_2505325_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_036771325.1|2505449_2506424_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420621.1|2508614_2509376_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2510533_2510761_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377706.1|2511714_2511927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|2511944_2512262_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242901.1|2512288_2512978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377709.1|2513318_2513522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420768.1|2513653_2514589_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047927332.1|2514601_2515384_-	lipoprotein	NA	NA	NA	NA	NA
WP_017377712.1|2515513_2515825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242900.1|2516168_2516495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377714.1|2516519_2516975_-	arginine repressor	NA	NA	NA	NA	NA
WP_017377715.1|2516964_2518017_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377716.1|2518019_2519483_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377787.1|2519617_2519845_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377718.1|2521261_2521726_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036773913.1|2521982_2522798_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377721.1|2522926_2525239_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_017377722.1|2525355_2525883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377723.1|2526574_2527852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377724.1|2527862_2528114_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377725.1|2528147_2528669_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377726.1|2528838_2529825_-	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377727.1|2529915_2530731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773915.1|2531159_2531555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2531527_2531755_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_047927746.1|2532723_2533311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|2533913_2534585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875918.1|2534729_2535311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420767.1|2535353_2536031_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243185.1|2536309_2537266_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_017377736.1|2537325_2537991_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017377737.1|2538024_2538570_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_155046615.1|2538849_2539011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774946.1|2539707_2540322_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_144420620.1|2540248_2541451_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875923.1|2541436_2542432_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875916.1|2542435_2542840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2543807_2544035_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971647.1|2545003_2545600_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046616.1|2545568_2546732_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	31.4	2.1e-20
>prophage 30
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	2556453	2607867	3198778	transposase,tRNA	Bacillus_phage(20.0%)	55	NA	NA
WP_048876031.1|2556453_2557857_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963580.1|2557962_2558187_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|2558369_2559191_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377842.1|2559336_2559591_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377841.1|2559979_2561764_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_017377840.1|2561852_2562572_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_027243134.1|2562733_2562940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243135.1|2562939_2563176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|2563188_2563542_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243136.1|2564079_2564913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377835.1|2565005_2565203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063682.1|2565300_2566686_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377833.1|2566812_2567403_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_017377223.1|2568434_2568722_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2568781_2568946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|2568942_2570313_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|2570679_2572092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|2572161_2572932_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_027243138.1|2573424_2573712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|2575188_2575482_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_144420618.1|2575439_2576261_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_026063680.1|2576405_2576630_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155046618.1|2576884_2577412_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_080999968.1|2577588_2577849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420617.1|2577767_2577923_+	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|2578021_2578996_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999967.1|2580324_2580474_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377700.1|2580590_2580884_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017376598.1|2581692_2582268_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|2582345_2583221_-	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376596.1|2583285_2583906_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027243040.1|2583890_2584973_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376593.1|2585206_2585611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376591.1|2587101_2588403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376590.1|2588549_2589218_+	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_144420764.1|2590150_2590714_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376588.1|2590770_2591967_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_017376587.1|2592091_2593456_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376586.1|2593452_2594544_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376585.1|2594798_2595449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|2595641_2595836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|2595943_2596096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376583.1|2596362_2597490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063543.1|2597579_2598413_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376581.1|2598416_2599067_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_017376580.1|2599056_2599896_-	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_016210074.1|2599901_2600528_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376579.1|2600688_2601231_+	septation protein A	NA	NA	NA	NA	NA
WP_017376578.1|2601314_2601617_+	YciI family protein	NA	NA	NA	NA	NA
WP_144420763.1|2601634_2601877_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376576.1|2601975_2602248_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_017376575.1|2602286_2602925_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376574.1|2602957_2604049_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376573.1|2604220_2605963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2606892_2607867_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 31
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	2617161	2735621	3198778	transposase,tRNA	Staphylococcus_phage(29.63%)	108	NA	NA
WP_080999966.1|2617161_2618511_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242585.1|2618808_2619366_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376558.1|2619459_2619966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376557.1|2620470_2621166_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_144420615.1|2621296_2622085_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_048876031.1|2622118_2623522_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875857.1|2623945_2624920_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017377787.1|2625176_2625404_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377821.1|2626491_2627022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377820.1|2627018_2628551_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2628547_2629498_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2629918_2630551_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2630793_2630991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2631340_2631769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|2631846_2632842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856754.1|2632986_2633238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|2633342_2633987_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2634222_2634720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2635231_2636206_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017377700.1|2636576_2636870_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017375632.1|2637682_2638018_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377815.1|2638338_2639877_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_144420614.1|2640029_2641128_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_036773165.1|2641366_2642566_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_027243005.1|2642596_2643223_+	ribonuclease T	NA	NA	NA	NA	NA
WP_017377811.1|2643251_2644136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275272.1|2644269_2644500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|2644637_2645879_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_144420613.1|2646158_2646530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|2648661_2648823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|2649198_2650326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|2650442_2651105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|2651190_2651451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|2651869_2652631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377799.1|2654692_2655352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377798.1|2655452_2656103_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_075275388.1|2656250_2656940_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377795.1|2656962_2658126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|2658330_2658582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619442.1|2659105_2659768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2659901_2660876_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376009.1|2662230_2662521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376008.1|2662842_2663880_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376007.1|2663910_2665365_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376006.1|2665374_2666559_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376005.1|2666632_2667640_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376004.1|2667708_2669712_-	transketolase	NA	NA	NA	NA	NA
WP_017376003.1|2670163_2671324_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_017376001.1|2671560_2672676_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376000.1|2672838_2673363_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_017375999.1|2673362_2673893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2675552_2676428_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420759.1|2676548_2677049_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376501.1|2677045_2677312_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_048875903.1|2677477_2678452_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_075275269.1|2678631_2679252_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|2679558_2680962_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771922.1|2681796_2682987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377263.1|2683553_2684021_-	DoxX family protein	NA	NA	NA	NA	NA
WP_017377264.1|2684522_2684777_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377265.1|2684978_2685482_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_036771941.1|2685698_2686304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2686464_2687148_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|2687223_2688003_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_017377269.1|2687989_2688850_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377270.1|2688973_2689339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377271.1|2689724_2690054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|2690464_2691439_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017377273.1|2691973_2692213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420610.1|2692206_2693586_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	3.3e-36
WP_017377275.1|2694620_2695343_+	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377276.1|2695334_2695703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243089.1|2695965_2697267_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377277.1|2697362_2697806_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_017377278.1|2697809_2698319_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377279.1|2698311_2701125_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_048875900.1|2701621_2702554_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377282.1|2702658_2703585_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_017377283.1|2703763_2705302_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2705475_2705736_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377686.1|2707010_2707619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2707665_2708394_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_155046620.1|2708640_2708778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619438.1|2709928_2710480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|2710714_2711626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377698.1|2711885_2712182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910634.1|2712526_2713680_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377702.1|2714276_2714825_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_144420757.1|2714928_2715492_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377704.1|2715709_2716468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|2717743_2717971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|2718193_2718373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971672.1|2718628_2719885_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875897.1|2719952_2720597_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_017378393.1|2721401_2721608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378392.1|2721878_2722031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816949.1|2722608_2723007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378390.1|2723200_2724778_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_017378389.1|2724911_2725853_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378388.1|2725854_2726628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963621.1|2728236_2728443_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_016211707.1|2728709_2728997_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_017378384.1|2729002_2731384_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378383.1|2731396_2732392_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_016210495.1|2732523_2732883_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378382.1|2732925_2733120_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075273353.1|2733154_2733685_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378381.1|2733689_2735621_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
>prophage 32
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	2773399	2826470	3198778	transposase	Staphylococcus_phage(50.0%)	45	NA	NA
WP_048875857.1|2773399_2774374_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378343.1|2774530_2776105_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_017378342.1|2776329_2776608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378341.1|2776677_2777553_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_016210208.1|2777562_2778723_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_017378340.1|2778837_2779986_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_017378339.1|2779996_2782798_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_017378338.1|2782904_2783603_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_017378337.1|2783615_2785379_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_016210223.1|2785382_2785730_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_017378336.1|2785723_2786098_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_017378335.1|2787087_2788371_+	citrate synthase	NA	NA	NA	NA	NA
WP_017378334.1|2788780_2790076_+	MFS transporter	NA	NA	NA	NA	NA
WP_017378333.1|2790431_2790977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046622.1|2791570_2792086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420607.1|2792097_2793477_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_017378329.1|2793712_2794147_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_017378328.1|2794143_2795496_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_027242734.1|2795495_2796611_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_017378326.1|2796611_2797628_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_017378325.1|2797617_2799288_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_017378324.1|2799307_2799643_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_036772382.1|2799670_2801110_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_047927447.1|2801106_2802153_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017378320.1|2802295_2803792_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017378319.1|2804087_2805089_+	glucokinase	NA	NA	NA	NA	NA
WP_080963617.1|2805194_2805806_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_144420755.1|2805926_2806304_-	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_027242736.1|2806354_2807761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378315.1|2807754_2808822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378314.1|2808928_2810530_-	APC family permease	NA	NA	NA	NA	NA
WP_027242737.1|2810778_2811696_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242738.1|2811764_2813459_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.3e-20
WP_017378310.1|2813693_2814623_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048876031.1|2814653_2816057_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378308.1|2816287_2816992_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_017378307.1|2817058_2817715_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_036774478.1|2817725_2818607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242739.1|2818777_2821447_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036771639.1|2821807_2822782_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_036771744.1|2822861_2823833_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2823886_2824861_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772729.1|2824980_2825202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420754.1|2825265_2825574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|2825498_2826470_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	2841036	2895297	3198778	transposase	Staphylococcus_phage(37.5%)	51	NA	NA
WP_026063658.1|2841036_2841765_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_027243070.1|2842074_2842329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2843042_2845697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378171.1|2845735_2846026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2846142_2847441_+	MFS transporter	NA	NA	NA	NA	NA
WP_036772686.1|2848011_2848500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420604.1|2848480_2848783_+	VUT family protein	NA	NA	NA	NA	NA
WP_075275265.1|2849029_2849518_+	VUT family protein	NA	NA	NA	NA	NA
WP_027243073.1|2849551_2850190_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243074.1|2850311_2850851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2850940_2852167_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_155046619.1|2852779_2853037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420603.1|2853123_2854023_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420602.1|2854167_2854434_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2854425_2854575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2854802_2855678_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2855807_2856035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815640.1|2856101_2856296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2856354_2857329_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963634.1|2857366_2857555_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_017376778.1|2857555_2859328_-	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_144420601.1|2859317_2860310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376776.1|2860917_2861610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376774.1|2862096_2862666_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_036771639.1|2862662_2863637_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_080999963.1|2863676_2864180_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856766.1|2864270_2865674_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2866372_2866558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|2866663_2868067_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046624.1|2868113_2868644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375939.1|2868677_2870105_-	amino acid permease	NA	NA	NA	NA	NA
WP_036772717.1|2871390_2873760_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.4	3.7e-160
WP_017375937.1|2873835_2874654_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_027243188.1|2875005_2875551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971669.1|2876033_2877272_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2877248_2878223_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017375625.1|2878315_2878543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376551.1|2878547_2879039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243039.1|2879711_2880599_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_027243038.1|2880688_2882179_-	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_017376549.1|2882202_2883084_-	ROK family protein	NA	NA	NA	NA	NA
WP_017376548.1|2883080_2883803_-	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376547.1|2884502_2885294_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016210862.1|2885480_2885726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420598.1|2885877_2886108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376543.1|2886137_2886917_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_047927468.1|2886942_2887248_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_144420752.1|2887244_2888138_-	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_027243035.1|2888493_2889792_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376538.1|2892394_2893576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|2893869_2895297_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	2902883	2952488	3198778	transposase,tRNA	Bodo_saltans_virus(14.29%)	44	NA	NA
WP_062312049.1|2902883_2904251_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243033.1|2904743_2905223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875888.1|2905402_2907466_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_144420751.1|2907474_2908200_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_017375919.1|2908827_2909541_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017375920.1|2909545_2910076_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375921.1|2910310_2910544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971668.1|2910656_2910905_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_144420596.1|2911712_2913905_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_017375924.1|2913922_2914231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2914884_2916594_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017378284.1|2916787_2916943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2918345_2919221_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243077.1|2919546_2920308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2920532_2921264_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_017376852.1|2921260_2921797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376851.1|2921850_2922615_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376850.1|2922617_2924195_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376849.1|2924201_2924678_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2924653_2925085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376847.1|2925117_2925873_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|2926047_2926335_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_027243078.1|2926717_2926942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2927281_2928445_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243079.1|2928479_2929457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2929450_2930137_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017376843.1|2930075_2931191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2931470_2932076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420595.1|2932313_2932793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2934615_2935269_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_027243083.1|2935381_2935933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2936032_2937007_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243084.1|2937292_2937817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376838.1|2938514_2939339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875886.1|2939594_2939951_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053856766.1|2939947_2941351_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243085.1|2941470_2942031_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_017376236.1|2942188_2942755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155062829.1|2942957_2945216_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_027243087.1|2945479_2946175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376234.1|2946215_2946428_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376229.1|2948000_2949110_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376228.1|2949165_2950647_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_048876031.1|2951084_2952488_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP038898	Piscirickettsia salmonis strain Psal-006b chromosome, complete genome	3198778	3080170	3145419	3198778	transposase,protease	Hokovirus(14.29%)	56	NA	NA
WP_017376170.1|3080170_3081271_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
WP_017376171.1|3081628_3082603_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771588.1|3082739_3083618_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_016209597.1|3083625_3083856_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771607.1|3083909_3084914_-	OmpA family protein	NA	NA	NA	NA	NA
WP_036771589.1|3085132_3085960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420747.1|3086041_3087430_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_017376176.1|3087717_3089118_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_017376177.1|3089212_3090139_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_027242699.1|3090135_3091272_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_027242700.1|3091268_3092276_-	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242701.1|3092272_3093436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376183.1|3093445_3094297_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242702.1|3094328_3095501_-	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_065653741.1|3095497_3096886_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_017376186.1|3096914_3097322_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_017376187.1|3097341_3098349_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376188.1|3098345_3099218_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_036771610.1|3099214_3100075_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_065653742.1|3100076_3102347_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_017376192.1|3102348_3103494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376193.1|3103540_3104026_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_027242703.1|3104065_3104689_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376237.1|3110368_3111121_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155046626.1|3111723_3111891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243062.1|3112452_3113076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243063.1|3113180_3113969_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243064.1|3113968_3114700_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376241.1|3114733_3116461_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_017376242.1|3116474_3117536_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376243.1|3117850_3119065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376244.1|3119197_3119722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063518.1|3120339_3121188_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376247.1|3121174_3121873_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_017376248.1|3121927_3122689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376249.1|3122681_3123104_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376250.1|3123233_3123785_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376251.1|3123840_3124803_-	TonB family protein	NA	NA	NA	NA	NA
WP_144420746.1|3124803_3125019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376253.1|3125205_3126015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|3125994_3126837_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376255.1|3126833_3128078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376256.1|3128216_3129305_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376257.1|3129322_3129823_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376258.1|3130010_3130610_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376259.1|3130615_3131779_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376260.1|3131811_3132765_+	glutathione synthase	NA	NA	NA	NA	NA
WP_017376261.1|3133128_3134193_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027243065.1|3134189_3137252_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_144420745.1|3137404_3137857_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243066.1|3137888_3138245_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772645.1|3138663_3139437_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376269.1|3142060_3142351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|3142575_3143451_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|3143447_3144005_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|3144015_3145419_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP038899	Piscirickettsia salmonis strain Psal-006b plasmid unnamed1, complete sequence	186370	0	43153	186370	transposase	Streptococcus_phage(47.06%)	49	NA	NA
WP_027243191.1|0_708_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_048876212.1|661_1540_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_027243193.1|1570_2113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|2384_3089_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_036772541.1|3100_3829_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|3858_4248_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|4270_4999_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|5001_5610_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
WP_155046641.1|5790_5955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420841.1|5981_6206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243184.1|6198_6537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133264.1|6550_6955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375840.1|6999_7218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275474.1|8186_9299_+	replication initiation protein	NA	A0A218MNI2	uncultured_virus	29.8	2.1e-25
WP_017377655.1|9640_9886_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|9882_10269_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772434.1|10356_11085_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_080963659.1|11063_11684_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377658.1|12029_12716_+	Fic family protein	NA	NA	NA	NA	NA
WP_082304501.1|13665_14028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|14030_15770_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046629.1|16171_16324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929558.1|16351_17035_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_036771347.1|17116_18094_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_081000019.1|18169_18340_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|18380_19109_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_036771293.1|19654_19921_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420835.1|20216_22130_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017377694.1|22536_23265_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_080999960.1|23332_23485_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046630.1|23901_24066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375754.1|24086_25373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771359.1|25555_26284_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_155062845.1|26411_26882_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155062847.1|27026_27677_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	41.3	8.9e-32
WP_155046631.1|27751_28402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046632.1|30411_30561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126795.1|31033_31294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772441.1|31297_31570_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_017375910.1|31645_32374_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_048876229.1|32943_33915_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048876208.1|34779_35607_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_036771289.1|36460_36931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046633.1|37824_37968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242940.1|39174_39774_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_017375850.1|40127_40904_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_036771279.1|41264_41993_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_155046634.1|42062_42263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876229.1|42181_43153_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP038899	Piscirickettsia salmonis strain Psal-006b plasmid unnamed1, complete sequence	186370	55994	172999	186370	terminase,tail,capsid,portal,transposase,head,integrase	Streptococcus_phage(31.58%)	112	62365:62424	180168:183715
WP_027242929.1|55994_56378_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|56464_56947_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|56949_58281_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_047927581.1|58485_58920_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_087910668.1|59006_59393_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|59430_60165_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|60211_60925_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_144420848.1|62303_62489_+	hypothetical protein	NA	NA	NA	NA	NA
62365:62424	attL	TAAAAATCCTCACCTACCTCGGCCTACTCACCCCGTGCCTTGCACTCCTTGGCTCGCAGC	NA	NA	NA	NA
WP_027243190.1|62492_65837_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017377509.1|66017_66746_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_075275482.1|66839_67814_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_027242596.1|68127_68490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|68529_69039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420849.1|69270_70251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|70716_71694_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|72174_73152_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046636.1|73166_73328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243211.1|73545_73800_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_027243212.1|73789_74077_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_036771347.1|74571_75549_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_027243215.1|75660_76683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774350.1|77165_77894_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_048876194.1|79133_79667_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_080963665.1|79847_80189_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_080963664.1|80369_80636_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_027243206.1|80708_82574_-	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_047927778.1|82741_83026_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|83369_84098_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046637.1|84179_84671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|85403_85631_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876191.1|87182_87611_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_081000015.1|87546_87933_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|87962_88691_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|88702_88852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|89098_89827_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036774388.1|91204_92167_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027242592.1|92190_92520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|92586_93627_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_144420833.1|93640_93832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774378.1|94036_94606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774316.1|94648_94948_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155046638.1|94944_95409_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774373.1|95682_96411_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_048876188.1|96584_97358_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_027243202.1|98071_99007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|99281_100010_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046639.1|100175_100379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929623.1|100478_103820_+	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_036772541.1|103977_104706_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_144420834.1|104999_105395_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036815648.1|105447_106176_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772541.1|106659_107388_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_027243197.1|107558_108128_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_087910667.1|108132_108816_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_036772541.1|108967_109696_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_080963627.1|109714_109933_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774644.1|110912_111974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|112482_113229_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_027243200.1|113229_113634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|113940_114915_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_036771293.1|115454_115721_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771296.1|116016_117912_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_048876182.1|118267_120163_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017375632.1|120862_121198_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017375836.1|121392_121596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243203.1|121689_122484_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
WP_080999971.1|126534_127938_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000017.1|128202_128454_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_048875857.1|128854_129829_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.2e-26
WP_048876221.1|130816_131272_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
WP_016212398.1|131366_131828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773695.1|133888_135961_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_017377509.1|135990_136719_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_144420837.1|136860_137793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377511.1|137822_138551_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|138553_138826_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|139676_140405_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|140460_141081_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|142229_142958_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155062849.1|143672_144368_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377667.1|145037_145208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619477.1|145352_145646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036815609.1|147510_147966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816769.1|148209_148608_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_047927763.1|148604_148868_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_048876259.1|149359_150376_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_027243195.1|150701_151748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|152113_153088_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
WP_017375692.1|153231_153465_+	hypothetical protein	NA	Q7Y5W4	Haemophilus_phage	42.6	1.3e-06
WP_017375691.1|153488_154190_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	37.6	9.6e-32
WP_036773107.1|154173_154491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|154778_155753_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242588.1|156091_156445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771953.1|156461_158741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|159203_160178_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_075275454.1|160227_160767_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_027242598.1|160780_161365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375778.1|161749_162061_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_017375779.1|162057_162483_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375780.1|162661_163057_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375781.1|163053_163404_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375782.1|163403_163826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375783.1|163827_164151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375784.1|164207_164474_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036771950.1|164477_166556_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375786.1|166548_166890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375787.1|166886_167558_+|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_144420832.1|167487_168273_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375789.1|168262_168820_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_027242568.1|168816_171507_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375652.1|171565_171994_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|172021_172999_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
180168:183715	attR	TAAAAATCCTCACCTACCTCGGCCTACTCACCCCGTGCCTTGCACTCCTTGGCTCGCAGCGTTTGCACCAAACTGAATTTTCACCTACGTTTAATTTAAGTTATAAATTTTTGTTAGTTTGCTAAATTATGTTTAACTCTAGCTATAAATTATTCTTTGCAACAACTAAACTGTTGTGGGTTTCTCAGGTGTTGATTTCTATCAATGCTGCACCAAGTAATACCTCTGTGATTGATGCAACTGTATCTGATGATGTTACTGTGACTGAGTCTGGCCTTTTTGGTAGTACAGTGATAAGCAGATCGCCGATTGATTTTGACTCAAACTCTCAAACATCAAATTCTGCTGGAGTGACATTACAAGCTGAGGATACAGTGAAAATTACGGTAGATACGGGCACACAAGTGGATCCAACAAATATCAATGTTAATGTGAATTTGGCTACTTTAGGAGTGGGTAAAACTTTGACTGGAGGCCGTGGTCTTGGTCCGATTACTAGTCCCACTCATGGTGGAGGTGGTGCTGCCGTCGATCTTCGTGTGAACGCGGATGTGTACACGAATATTAGTATTAAATCTAATGCCACTGGAGGAATTAATGCTTTTGGAGATGATAGTAGTACCGGTGATGGCATTTCTGGAAGTAGTCAATCGGCAAACTCTGCTGTTAATTTAACCATCTTTGCAGGGAGTAGTTCGTCTAATTTTACAGAAAACACTGTAAATATCTCTGGAAATATGATCGGTGGATCTGGAGGAAATGGTGGTAATTCCACCTTTGTTACAGGTAGTGGTGGCGTTGGAACTAACGGTAACAATGCAATTGTTGCCAATTTATTTGAAAATACGTTAACACATTTTTTAGTATCGGGGAATCTAACAGGTGGTAATGGTGGTAATGGTGGCTCTACAACAGGCTCTGGTACTTCAGGTAATGCAGGTGATGGAGAAGAGGCTTTTTATTTAAGCTCTCCAGCTAAAAATAGCACAGTGATTTTTGATATTGGTAAAAACGCTAACGGTAATATTATACCAGTAACCGTTAAAGGCGGGAGCGGCGGTACATCGCCTTCTAATCCAGGGGGTATTGGTTCTTATCGAGCGGGAATGATTTTATTTTTGGGTGATGCTGGAAATATTGGTAGTGTTACATTAAATGTGCATAAGGGCTCAACCATAGCACCTGGAGATACAGGCGTTAATGCGGGAATGAGAAGCGCTAGCCTTTATCAAGTCCCAGGATCAAATATCATTAGCCAAGTGAATAATGATGGTTCAATTACAAATGGTATTGACTTTTCTTCTTCCTTACAAGCTGATGTTATCACCAATAATGAAAGTGGTGTAATCTCTGGAGTGTCTTATACAGGGCTAGGCGATGATAACTTAACAAACTCAGGAACGATAGAATCTATCGACCTTGGTTTTGGTGATGATATAGTAACTAACTTAACGGGTGGAGAAATATCACAAAATCTACTGACTGGAGCAGGCAGTGATATCGTCACAAATTCAAGTGAATTATCTGGCACAACGAATTTAGGAGCAGGTGATGACTTACTTGAAATTAAAGCAGGCAGTGTTGGTTCAATTGAAGGAGGAACGGGGACAGATACTCTCAATATAGTTAACTCAGTATCTACCGCATATATTAATGAAAATTGTGAATTTGCTAGTGGCTTTGCAACTTTAGGAAGCAATAATTGTAGCAAAGAAGTTGCAATAGCGAATGTAGAAACCATTAATGTGAATAGTCATAGAATATCTATTAATGGAGCCATAGAAAATACAACAACATTATCAGTGAATCAGGGAGCCATTCTTTATTTGAATGCTATTAAAAATAACCAACTTTCGAAAGCTCAAGTAACTCAATTAAATAATATGGGCTCACTTTATTTAAACTCAGATGTGGATGGCGCTATAAACACGATAGGAAACAGTTCCTTGATATTAAATGAAAAAGATAATAAAGCTAGAAAAGTTACAACTTTTACAGCTACTATTAATAGCAATGGTATTCCGAGCATTCAAAGTGGTTTTTATAATGACGATGGCAGTGCAAAGCTCTATGCTTTAACAGCAACGTCATCTACGATTAATATCGTAAATAGTACTGGAGGCAGTGAAAAATATATTAATTATGTGATTGATCTTAGAAGTGAAGATGTTGACCAATTTGCTAAAAATGGCACAGAGTACCCTATTTTAAATGGTATATCTTCGAGCAATCACGATAATTTAGAAGCTACTAATTTTAATAACAACATCAGCTATATTAATAGCAGTGGTAGTATGGTAAGTCAACTGCCATTAGTTGATTTTTTTTCAAGACCTGGTTCAGGGGATAACAGTGGTAGTGTTGTATTGGTTGCTAAAGTAAAAAGCACCTGTGATTTTATTGAAGATGCAGGAACAGGGGGGTTAGCGAATCTATGTGGTAGCATTGATAGATTATCCAATACTTATAGTAATTCTGATGAGAATATAAGGAGAAGAGTACTTGAAAAAACACCTGTACTTACATCCATTCCTTCAAATGTTAATACGGTTTATTTAGATAAAGTGCTTGTTGCTAAACAAAATACGTTCCGTACAGGTTCGAGTACCTCTCAATCTGGAGTAAGTACCGGAGCAAAGGCAGTGGATCGGTTTTCTCCTTGGATTGATGCATATGCGGCGCATGAAAAAAAGGATCCTGTGGAAGGTTATGATGGGTACAGTCATTCGATTAAAGGGGTCTCCTTTGGTGTAGATTATAATGCGATCGATAAGTTTGGTCTTTTTGTTAGCTATAGTGAGAATAAGTTTTCTACGAAAATTACCGGTTCTTCTATTAAAAGCAATTCTTATGGTCTAACCTTGTTTTTAGAAAAGCCATTTAAGACTTTTGATTACTATGCGAGCTTGTCTTATTTTTATAATGACTTTGATAATGAGCGGCGCGATGTATCTAAAAGCGTAAACTCATTCAAATCATCATTTTCAAATCATTCACTGTTGTTTAATAGTAAACTACTCTACAATATTTATGATCAATCTTCTTATAGCTATGATTTAACATTACTTTTAGATATGGATTATATACAGATCATGGGATATGACTACCAAGAGAGCTACCTTAATTTAGGTGGGCAAACAGTTCAATCTGACACATGGCATCAATTGAACTTTGGTGCCGGTTTCTTAATTTCTAAAAGGATAAACCTGCTTAATGGTGTTATAACTCCTACTGCAAGTGTGAGGGTGCAATATTCAGTACTCAACGACCCGAATAGTATGAATGTCTCGTCAGTTGATTTTCCGGGCTTTATTCAAGTGCAGTCCGCAAACACTAAAAAAATCCAATATGATTTAGGAATAGCTTTAAAATACGAGTATAAAAAAAATATGGAAATAGATTTAGAGTATAATTCTATCTGGGATAATTCAAGAAAAGAAGTCGTATCTTTGGTAGCAAAATATAGATTTTAACGGCCGTAAGCATCGCGGTTCTGTCGCAATTTGAAATTTTCATAAAAGAGTGTTTTTCTTCAGCATGCGGTAGAG	NA	NA	NA	NA
>prophage 1
NZ_CP038900	Piscirickettsia salmonis strain Psal-006b plasmid unnamed2, complete sequence	76008	0	59634	76008	transposase,tRNA	Bacillus_phage(25.0%)	57	NA	NA
WP_053093673.1|1062_1722_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242771.1|1988_2306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242770.1|2448_2859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242769.1|3015_3342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963649.1|3488_4526_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242767.1|4567_4813_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_129556541.1|4937_5252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242765.1|5259_6834_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_027242764.1|6988_7558_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242763.1|7867_9670_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_087910649.1|9666_10608_+	signal peptidase I	NA	NA	NA	NA	NA
WP_027242761.1|11019_11694_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_144420798.1|11699_12599_+	GTPase Era	NA	NA	NA	NA	NA
WP_027242759.1|12612_13356_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_027242758.1|13358_14090_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242757.1|14086_14470_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242756.1|14607_15855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242755.1|16265_17411_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242754.1|17403_17757_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242753.1|18037_18580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927692.1|19224_19413_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|19432_20407_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_144420702.1|20450_21326_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.1	1.8e-19
WP_036815628.1|21679_22507_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080963648.1|22606_22768_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375762.1|23418_24759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|25810_26038_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027243003.1|26179_27541_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.2	2.9e-16
WP_027243002.1|27636_28296_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.5	3.2e-29
WP_017375760.1|29038_29191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375759.1|29181_29493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375757.1|30089_31649_-	APC family permease	NA	NA	NA	NA	NA
WP_017375893.1|34193_35264_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017375892.1|35321_35528_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375891.1|35534_37010_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375890.1|37145_37709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|37878_39282_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242999.1|40248_41343_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_027242998.1|41424_41946_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	3.8e-25
WP_027242997.1|41999_42476_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_027242996.1|42517_42814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242995.1|42878_43586_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_027242994.1|43962_44361_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_027242993.1|44406_44838_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_027242992.1|44848_45532_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_016210285.1|45606_47802_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_027242991.1|47906_48644_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_027242990.1|48671_49457_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_027242989.1|49502_50207_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_087910648.1|50194_51382_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_027242987.1|51436_52270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242986.1|52339_55327_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_027242985.1|55368_56760_+	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_080963581.1|56773_57235_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_047927184.1|57244_57589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|57585_58461_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876030.1|58530_59634_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP038900	Piscirickettsia salmonis strain Psal-006b plasmid unnamed2, complete sequence	76008	75148	75376	76008	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_017377787.1|75148_75376_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 1
NZ_CP038902	Piscirickettsia salmonis strain Psal-006b plasmid unnamed4, complete sequence	50690	2917	16712	50690	transposase,capsid,tail,head	Moraxella_phage(18.18%)	18	NA	NA
WP_036771347.1|2917_3895_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017375652.1|3922_4351_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242568.1|4409_7100_-	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375789.1|7096_7654_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_144420832.1|7643_8429_-	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375787.1|8358_9030_-|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_017375786.1|9026_9368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771950.1|9360_11439_-|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375784.1|11442_11709_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_017375783.1|11765_12089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375782.1|12090_12513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375781.1|12512_12863_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375780.1|12859_13255_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375779.1|13433_13859_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375778.1|13855_14167_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_155062855.1|14551_14935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275454.1|15148_15688_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_036771639.1|15737_16712_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
>prophage 1
NZ_CP038903	Piscirickettsia salmonis strain Psal-006b plasmid unnamed5, complete sequence	33267	3114	19136	33267	transposase,tail,capsid,terminase,head,integrase	unidentified_phage(35.71%)	21	NA	NA
WP_036771330.1|3114_4089_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212329.1|4624_5215_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_027242955.1|5445_5706_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211078.1|5698_6052_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_069971681.1|6228_7203_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_027242954.1|7735_8101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242953.1|8245_8500_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_080963620.1|8483_8840_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_036771330.1|8937_9912_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242951.1|10537_11404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242950.1|11616_12000_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242949.1|12086_12569_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242948.1|12571_12757_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_036771330.1|12776_13751_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_075275490.1|13847_14240_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242946.1|14275_14857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|15237_16212_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_144420855.1|16285_16501_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027242945.1|17304_17820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242944.1|18165_18723_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242943.1|18719_19136_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
