The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	45565	89678	3149273	transposase	Moraxella_phage(16.67%)	46	NA	NA
WP_129556427.1|45565_46141_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46086_46452_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211193.1|46650_47412_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_016211195.1|47713_49240_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49611_50451_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50490_51798_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51772_52942_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|52996_53722_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54000_54390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54549_55455_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55530_55674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274979.1|55721_56561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375632.1|56553_56889_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_155046698.1|57067_57229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|57345_57639_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_016210704.1|58533_60480_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|61134_64197_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|64193_65258_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|65613_66567_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|66598_67762_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|67767_68367_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|68554_69055_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|69072_70161_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|70587_71832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|71828_72671_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_016211096.1|72650_73460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|73638_73866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|73866_74817_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|74872_75424_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|75550_75973_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|75965_76712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|76754_77453_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|77463_78288_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|78617_78986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274980.1|78980_80042_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|80091_80322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|80451_81666_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|81966_83028_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_016211249.1|83041_84769_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_016211245.1|84802_85534_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|85533_86322_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211251.1|86426_87050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|87369_87582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273383.1|87737_88310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046699.1|88514_89087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274981.1|89081_89678_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	136472	178469	3149273	transposase	Staphylococcus_phage(50.0%)	46	NA	NA
WP_054300271.1|136472_137447_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|137948_139361_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|139853_140861_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|140880_142401_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_129556430.1|142457_142664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211018.1|143639_144956_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|145059_145443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|145577_148643_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|148711_149815_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|149838_150393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|150507_151077_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211020.1|151196_151952_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_054300545.1|152118_153180_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_098082829.1|153574_153970_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|153991_154357_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|154413_154578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|154567_154867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|155119_155485_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|155430_156006_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212607.1|156006_156363_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|156451_157027_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|156972_157338_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|157817_158384_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|158395_159181_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|159812_160736_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|160787_161783_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|161814_162309_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_032126724.1|162400_162658_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|162747_163170_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|163488_164205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|164248_164500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556431.1|164513_165941_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|165968_167411_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|167498_167837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|167921_168452_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|168512_170705_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|170747_171233_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|171502_171934_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_016210245.1|171951_172782_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|172796_172940_-	lipoprotein	NA	NA	NA	NA	NA
WP_016210239.1|172970_173855_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|173826_174048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|174221_174500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|175470_176376_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016212383.1|176778_177897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|177893_178469_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	182275	239529	3149273	tail,transposase,protease,tRNA	Escherichia_phage(12.5%)	56	NA	NA
WP_075273327.1|182275_182851_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|182796_183162_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728339.1|183225_183498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212441.1|183765_183990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372761.1|185005_185455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|185518_186247_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016210779.1|186289_187219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210775.1|187511_188105_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_017377589.1|188073_188727_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016210784.1|188904_189876_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210782.1|189898_190795_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_016210786.1|190953_191400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210787.1|191396_192038_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016210789.1|192147_192726_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_016210776.1|193201_193639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047085.1|193963_195304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210785.1|195567_196962_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_075274986.1|198410_199478_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209863.1|199530_199953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209853.1|200193_200637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209873.1|200691_200949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209868.1|200926_201553_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_016209871.1|201630_203613_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|203822_205166_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|205432_208102_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|208125_210045_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|210214_211636_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|211781_212756_+	phospholipase A	NA	NA	NA	NA	NA
WP_016209855.1|212787_213183_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209859.1|213185_213407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|213570_215232_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|215304_215595_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_016209861.1|215820_216276_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|216340_216805_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|216897_218244_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|218243_219149_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|219210_220197_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|220189_220432_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|220553_222098_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_032126611.1|222144_223431_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|223473_224868_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|224891_225071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|225067_225643_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|225588_225954_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274988.1|226015_228250_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_016210079.1|228671_229169_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|229339_230035_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|230137_231700_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|232015_233809_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|233894_234167_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|234172_234799_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|234785_236216_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|236548_237604_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|237572_238250_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|238239_239076_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|239235_239529_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
>prophage 4
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	256926	301881	3149273	transposase,tRNA	Acinetobacter_phage(40.0%)	49	NA	NA
WP_075274991.1|256926_257502_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377888.1|257505_258066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556436.1|258121_259008_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046701.1|259034_259184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|259328_259529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|259576_260038_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|260461_261943_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|262005_263115_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|263212_265174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|265703_266108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|266160_267222_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046702.1|267347_267503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|270448_271601_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556437.1|271643_272066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556438.1|272335_273802_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_032126861.1|274005_274320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046703.1|274513_274651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|274654_275541_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212538.1|275712_276153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210630.1|276682_277798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664846.1|277736_278423_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_032126366.1|278416_279394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210638.1|279432_280596_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210640.1|281060_281285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|281670_281958_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_016210633.1|282132_282888_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556439.1|282893_283349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210637.1|283324_283801_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210636.1|283807_285385_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_032126367.1|285388_286153_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016210629.1|286206_286743_+	tim44-like domain protein	NA	NA	NA	NA	NA
WP_016210634.1|286739_287471_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_032126368.1|287579_288734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275120.1|288878_289190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664872.1|289513_290494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211898.1|290735_291359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211899.1|291686_291980_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_105962625.1|292076_292963_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046704.1|293574_293727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212296.1|293742_294471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126374.1|294579_295551_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664866.1|295582_295999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211609.1|296613_296922_+	double zinc ribbon family protein	NA	NA	NA	NA	NA
WP_032126373.1|296954_299141_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.0	2.7e-141
WP_016211605.1|299244_299478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211606.1|299694_300225_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_016211607.1|300253_300478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273369.1|300660_301476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300526.1|301584_301881_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	329456	375011	3149273	transposase	Hokovirus(33.33%)	46	NA	NA
WP_075273298.1|329456_330032_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210127.1|330084_331110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210128.1|331203_331467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|331833_332652_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|332724_335097_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_016210125.1|335809_337237_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|337271_338294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|338310_338688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126491.1|339045_339363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210122.1|339529_340222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|340848_341823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|341812_343585_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|343585_343933_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_032126493.1|344182_345409_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|345498_346797_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664834.1|346830_347190_-	VUT family protein	NA	NA	NA	NA	NA
WP_080664833.1|347235_347580_-	VUT family protein	NA	NA	NA	NA	NA
WP_016210137.1|347560_348112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664832.1|348338_349637_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|349753_350044_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_016212281.1|350355_351810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|352009_352585_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|352530_352896_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212359.1|353631_353850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|354217_355192_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212044.1|355730_355985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|356707_357694_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|357831_358026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664870.1|358708_359356_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_129556444.1|359348_359771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211797.1|359932_361336_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|361386_361962_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|361907_362222_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556445.1|362262_363149_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126227.1|363787_364078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212008.1|364115_364814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212010.1|364830_365127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556446.1|365244_366396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273619.1|366668_367244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211273.1|367301_368135_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	29.0	3.5e-17
WP_016211268.1|368250_369435_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211271.1|369453_370398_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016211269.1|370702_371488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211272.1|371605_371974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211270.1|372201_373779_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_054300173.1|373949_375011_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	447623	545943	3149273	transposase,protease,tRNA	Escherichia_phage(32.14%)	93	NA	NA
WP_075275004.1|447623_448487_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|448703_450263_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|450284_451319_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|451367_451937_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|452072_453044_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|453055_454633_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|454698_455685_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016210646.1|456016_457126_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|457231_458416_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|458493_460482_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|460690_460846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300511.1|461103_461403_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_075275005.1|461561_461897_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|462813_464220_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|464237_465224_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|465226_466381_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|466377_467073_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|467207_468698_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210494.1|468718_469768_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|469834_471229_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210489.1|472107_474039_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_075273353.1|474043_474574_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|474608_474803_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|474845_475205_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|475624_476620_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_032126132.1|476632_479014_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|479019_479307_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|479578_480055_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|480199_480397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|480521_481496_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|483604_483703_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210477.1|484187_485477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126626.1|485713_486406_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|486447_487221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|487222_488164_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|488296_489874_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|490083_491841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|492389_493148_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|493355_493928_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|494031_494580_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|494881_495127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|495155_495452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941726.1|495719_496643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556451.1|497121_497379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275008.1|497442_498171_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	3.3e-43
WP_129556452.1|498286_498634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|498636_500376_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300501.1|500880_501609_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_016212066.1|501969_502746_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_016212069.1|502957_503125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212070.1|503099_503699_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_054300500.1|504108_504837_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_155049877.1|504879_505122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300501.1|505185_505914_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|505925_506318_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|506314_506560_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300307.1|507663_508392_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_054300307.1|508998_509727_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_016212268.1|510371_510956_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_016212269.1|510959_511643_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|511925_512654_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_052104629.1|512990_514016_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212159.1|514159_514357_-	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_016212158.1|514624_515539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275019.1|515648_516353_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	9.2e-43
WP_105962625.1|516316_517203_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211714.1|517577_520922_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_144019196.1|520954_521611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300201.1|521666_522395_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_032126534.1|522909_523425_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212084.1|523424_524441_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_075274955.1|524722_525697_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212327.1|527082_527868_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075274956.1|527928_528297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|528339_529314_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016210580.1|529389_529650_-	methyltransferase	NA	NA	NA	NA	NA
WP_016210574.1|529790_530210_+	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_032126277.1|530297_530888_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210572.1|531110_532868_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126278.1|532989_533973_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_032126275.1|534053_534605_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126276.1|534615_535983_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126279.1|536133_536373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210582.1|536431_537175_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_016210581.1|537174_537819_+	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210578.1|537815_539480_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	7.1e-33
WP_016210576.1|539507_539843_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_016210570.1|539973_541572_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210577.1|541637_541928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|541942_542398_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273456.1|542357_542657_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556663.1|543034_543400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210376.1|543462_545943_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
>prophage 7
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	590094	641239	3149273	transposase,tRNA	Staphylococcus_phage(37.5%)	52	NA	NA
WP_075273298.1|590094_590670_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377880.1|590615_591095_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210761.1|591732_592470_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_016210755.1|592573_593302_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_016210763.1|593405_594650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210764.1|594958_595219_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_016210758.1|595392_596931_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_051307336.1|597088_598015_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	9.4e-11
WP_016210756.1|598153_600967_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A167RAL2	Powai_lake_megavirus	26.5	1.3e-76
WP_032126291.1|600959_601469_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_016210766.1|601472_601916_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_129556593.1|602004_602646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|602642_603218_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|603163_603529_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211782.1|603590_603773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126294.1|604372_605650_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211783.1|605930_606296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211784.1|606287_607010_-	aquaporin family protein	NA	M1HH19	Acanthocystis_turfacea_Chlorella_virus	35.8	1.6e-26
WP_075274951.1|607563_608448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|608444_609419_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016210171.1|609976_611536_+	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	50.4	5.8e-37
WP_016210175.1|611849_612179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210177.1|612564_612930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126297.1|613054_613915_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_016210164.1|613901_614681_+	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_016210168.1|614756_615440_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556592.1|615600_616131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210179.1|616421_616925_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_016210161.1|617125_617380_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210178.1|617881_618349_+	DoxX family protein	NA	NA	NA	NA	NA
WP_016210163.1|618438_618969_-	ferric uptake regulator family protein	NA	NA	NA	NA	NA
WP_016210172.1|618968_619493_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	59.6	6.9e-51
WP_016210170.1|619655_620771_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210174.1|621007_622168_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	8.2e-121
WP_016210183.1|622618_624622_+	transketolase	NA	NA	NA	NA	NA
WP_016210176.1|624690_625698_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210181.1|625771_626956_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_032126295.1|626965_628420_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_016210162.1|628450_629488_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_105962625.1|630172_631059_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212028.1|631146_631395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212027.1|631889_633113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126299.1|633135_633357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|633607_634582_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211964.1|634640_634961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|635073_635724_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211963.1|635825_636485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211962.1|637033_637549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212030.1|637846_638092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|638183_638846_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212032.1|638969_640097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|640353_641239_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	649326	683766	3149273	transposase,tRNA	Catovirus(20.0%)	36	NA	NA
WP_016210986.1|649326_650865_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	1.3e-86
WP_075273313.1|650922_651261_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377882.1|651220_651502_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377881.1|651508_651676_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377817.1|652592_653090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556591.1|653313_653970_+	porin family protein	NA	NA	NA	NA	NA
WP_032126306.1|654074_654371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274949.1|654595_655657_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046752.1|655634_656372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|656410_656839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210814.1|657188_657386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210817.1|657628_658261_-	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210815.1|658680_659631_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210821.1|659627_661160_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_017377821.1|661156_661687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210823.1|662021_662660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|663109_663814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210818.1|664105_664330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210820.1|664833_665775_-	DMT family transporter	NA	NA	NA	NA	NA
WP_129556549.1|665976_666862_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210940.1|666970_668158_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	6.4e-20
WP_016210937.1|668249_668531_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126309.1|668616_669294_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_032126310.1|669340_670600_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_016210941.1|670797_671847_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_016210931.1|671925_672732_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210936.1|672769_673564_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210944.1|673665_674685_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210942.1|674731_675343_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210943.1|675346_676033_+	acireductone synthase	NA	NA	NA	NA	NA
WP_016210935.1|676029_676572_+	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016211759.1|678384_679572_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_016211756.1|679817_680543_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_032126312.1|680721_681516_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_129556590.1|681512_681908_-	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_054300282.1|683301_683766_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	712406	819879	3149273	integrase,transposase,tRNA,protease	Escherichia_phage(36.59%)	102	729020:729079	735248:735535
WP_016210052.1|712406_713603_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
WP_032126425.1|713623_714220_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210066.1|714663_715332_-|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_016210076.1|715473_716775_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210073.1|717031_717763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210051.1|718187_718592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210069.1|718832_719915_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.6e-20
WP_016210054.1|719899_720421_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210050.1|720485_721361_+	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_016210068.1|721436_722012_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_155046750.1|723198_723336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|724580_725486_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211874.1|725529_727248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|727566_728646_-	hypothetical protein	NA	NA	NA	NA	NA
729020:729079	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_155046749.1|729190_729478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300489.1|729541_730144_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_129556589.1|730146_730422_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032126389.1|731823_732012_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212230.1|733545_734994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377879.1|735049_735274_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_075274946.1|735495_735939_+	hypothetical protein	NA	NA	NA	NA	NA
735248:735535	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACG	NA	NA	NA	NA
WP_016212294.1|735952_736297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046748.1|736648_736954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212659.1|737041_737287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212568.1|737431_737581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274945.1|737805_738156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211326.1|738300_739041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211324.1|739537_740092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211322.1|740627_741218_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211325.1|741280_742801_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	7.3e-85
WP_016211323.1|742790_743888_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	1.0e-27
WP_016211321.1|744061_745222_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211722.1|745602_748905_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	1.7e-54
WP_032126817.1|748914_749736_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_075274944.1|750092_750809_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
WP_129556588.1|750753_750921_+	phosphatase	NA	NA	NA	NA	NA
WP_075274943.1|751111_751636_-	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_087910645.1|751921_753074_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_032127022.1|753136_755323_-	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_075274942.1|755999_756728_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.1	2.7e-45
WP_016212339.1|756746_757493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275114.1|757645_758008_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274941.1|758037_758766_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.2e-42
WP_016211996.1|759149_760097_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211997.1|760098_761208_-	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	24.5	4.4e-07
WP_075274940.1|761563_762244_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	2.0e-42
WP_087910645.1|762271_763425_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274939.1|763537_764266_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.8e-42
WP_016212238.1|764295_765585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212264.1|766100_766694_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	5.4e-28
WP_016212263.1|766739_767333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664881.1|767495_767702_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300481.1|767791_768520_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_129556661.1|768508_769072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210616.1|769372_772183_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_016210625.1|772431_773178_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_129556587.1|773236_774139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307334.1|774182_774962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210618.1|775228_776278_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_016210617.1|776342_777767_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_075274938.1|777930_778437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210624.1|778455_778695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210615.1|778740_779211_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016211056.1|781586_782339_-	ComF family protein	NA	NA	NA	NA	NA
WP_016211049.1|782382_783345_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211052.1|783344_784598_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211045.1|784628_785402_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211044.1|785382_786243_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_016211050.1|786311_787019_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211051.1|786981_787485_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211047.1|787846_789481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211053.1|789568_790135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|790177_790906_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_036780855.1|791671_792169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049879.1|792143_792545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|792513_793242_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211625.1|793725_794595_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_016211621.1|794591_795941_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	4.6e-75
WP_016211623.1|796053_797694_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_016211987.1|799515_801252_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_144019359.1|801413_801611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556671.1|801755_802484_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_098082825.1|802547_802856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|802848_803181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|803184_803754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211655.1|803882_804296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211652.1|804555_805761_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211653.1|805868_806894_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_054300202.1|806985_807714_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300202.1|808144_808873_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212196.1|809281_809527_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_016212195.1|809523_809910_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212193.1|809977_810316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274934.1|810438_811107_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.0	2.8e-41
WP_016211949.1|811594_812845_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_016211951.1|812878_813976_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_075274933.1|814592_815321_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_075274932.1|815629_815851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|816072_817686_-	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_016211816.1|817727_818081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126570.1|818093_818393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|819150_819879_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
>prophage 10
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	909091	961150	3149273	transposase,tRNA	Agrobacterium_phage(12.5%)	45	NA	NA
WP_081007050.1|909091_909619_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|909675_910041_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211061.1|910102_910456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211058.1|910576_911110_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_032126660.1|911248_912886_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.2	5.8e-88
WP_016211065.1|912890_913112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211066.1|913209_914223_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_016211063.1|914385_916614_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.0	1.0e-82
WP_032126658.1|916594_917299_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|917533_917863_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_054300173.1|918943_920005_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126663.1|920031_920274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126664.1|920992_921676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212048.1|921869_922427_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_075274927.1|923190_924252_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664847.1|924324_925278_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_016210878.1|925778_928508_+	kinase	NA	NA	NA	NA	NA
WP_016210879.1|928610_928970_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210871.1|928966_929284_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210872.1|929300_930410_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210882.1|930436_931522_-	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210874.1|931644_932685_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210873.1|932699_933350_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210876.1|933417_934260_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016212197.1|934725_935643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|936661_936856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036794860.1|936932_937226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|937493_938411_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_016211373.1|938962_939109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211374.1|939163_940354_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211370.1|940486_940930_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211369.1|940972_942016_-	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211368.1|942062_943454_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211371.1|943650_944574_+	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211372.1|944560_945418_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016212287.1|951514_952660_-|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_054300173.1|952738_953800_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211408.1|954023_955370_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_016211412.1|955484_956477_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_016211411.1|956480_956978_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_016211407.1|956974_957814_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_051307356.1|957846_959379_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_032126774.1|959538_959874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|960029_960302_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|960313_961150_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
>prophage 11
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	1023062	1104670	3149273	transposase,tRNA	Staphylococcus_phage(35.29%)	83	NA	NA
WP_016211428.1|1023062_1025126_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.8	3.8e-36
WP_054300237.1|1025396_1026458_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556651.1|1026699_1027908_+	MFS transporter	NA	NA	NA	NA	NA
WP_075274925.1|1028095_1029157_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212285.1|1029204_1030683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1030732_1031794_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210196.1|1031751_1032105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210185.1|1032458_1034669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210188.1|1034669_1035356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210198.1|1035667_1036219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210195.1|1036235_1036637_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_016210190.1|1036827_1037703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126472.1|1037922_1038573_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_016210202.1|1039035_1041624_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.8	9.7e-122
WP_016210199.1|1041729_1042491_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_016210206.1|1042487_1043024_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	38.4	8.4e-20
WP_016210205.1|1043072_1044029_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.6	5.3e-49
WP_016210187.1|1044109_1047295_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_016210201.1|1047298_1048354_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	3.4e-49
WP_152498667.1|1048604_1049183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210186.1|1049226_1049889_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_016210194.1|1049923_1050271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210193.1|1050327_1050489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126473.1|1050469_1050652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210192.1|1050860_1051379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1051691_1052057_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1052002_1052578_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556569.1|1052567_1052777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211502.1|1053191_1054235_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_016211508.1|1054264_1054609_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211503.1|1054663_1055119_+	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_075274922.1|1055129_1055426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274921.1|1055403_1055502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211506.1|1055494_1056136_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|1056132_1056849_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211507.1|1056852_1058172_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_054300271.1|1058485_1059460_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212450.1|1059503_1060406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1060561_1060927_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1060872_1061448_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1061461_1061752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1061697_1062273_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556568.1|1062309_1063791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|1063980_1065042_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211004.1|1065454_1068091_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_080664849.1|1068139_1069228_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016210997.1|1069227_1069911_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_016210998.1|1071785_1072040_+	LapA family protein	NA	NA	NA	NA	NA
WP_016211001.1|1072117_1072423_+	competence protein ComEA	NA	NA	NA	NA	NA
WP_016211002.1|1072586_1072985_+	VOC family protein	NA	NA	NA	NA	NA
WP_051307345.1|1073018_1073705_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211000.1|1073848_1074634_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_075274920.1|1074729_1075464_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	4.8e-10
WP_016210826.1|1076894_1077761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210824.1|1077870_1079550_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210830.1|1079676_1080927_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_032126465.1|1081002_1081464_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210835.1|1081460_1082609_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_016210836.1|1082614_1083289_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_052133275.1|1083318_1083942_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210828.1|1084057_1084531_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_016210832.1|1084532_1084955_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210829.1|1084941_1085961_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210831.1|1086230_1086776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|1086870_1087932_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212318.1|1088460_1088892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|1088893_1089220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212319.1|1089206_1089434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|1089992_1091438_-	MFS transporter	NA	NA	NA	NA	NA
WP_016212205.1|1091577_1091757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274918.1|1092440_1092806_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1092751_1093327_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212174.1|1094401_1094659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212177.1|1094735_1094909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|1095904_1096966_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|1096923_1097172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300443.1|1097224_1097503_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211538.1|1097741_1098665_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_016211536.1|1099359_1099593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211535.1|1099668_1101456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923739.1|1101667_1103176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212614.1|1103320_1103527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1103695_1104670_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 12
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	1125340	1252689	3149273	transposase,protease,tRNA	Staphylococcus_phage(17.65%)	119	NA	NA
WP_054300271.1|1125340_1126315_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212492.1|1126364_1127219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210459.1|1127423_1127942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210458.1|1131016_1131565_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_016210461.1|1131645_1131921_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_032126596.1|1131920_1132973_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_016210464.1|1133081_1135019_-	AsmA family protein	NA	NA	NA	NA	NA
WP_075275113.1|1135169_1136879_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_016210468.1|1136947_1137667_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_016210467.1|1137663_1138266_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210471.1|1138380_1139268_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|1139458_1139806_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210465.1|1139856_1140699_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_129556566.1|1141206_1141410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372565.1|1141318_1141690_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274914.1|1141738_1142614_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032126686.1|1143164_1143749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556565.1|1145218_1145614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273603.1|1145737_1145914_-	phosphatase	NA	NA	NA	NA	NA
WP_129556564.1|1147070_1147400_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046744.1|1148569_1148743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|1148799_1149165_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126745.1|1149236_1149839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122940402.1|1150047_1150671_+	porin family protein	NA	NA	NA	NA	NA
WP_016209896.1|1150985_1151555_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016209891.1|1151701_1152400_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_036777115.1|1152541_1152742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209884.1|1152818_1153442_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_016209882.1|1153551_1154445_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_016209898.1|1154551_1156162_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_016209888.1|1156158_1157454_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_016209876.1|1157475_1159398_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_016209881.1|1159508_1159811_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_016209893.1|1159903_1164793_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_016209883.1|1164847_1166164_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	9.4e-65
WP_129556563.1|1166282_1167383_+	FUSC family protein	NA	NA	NA	NA	NA
WP_016209878.1|1167434_1168373_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	29.6	1.9e-14
WP_080664826.1|1168453_1169053_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016209877.1|1169241_1170132_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_016209887.1|1170334_1170826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209894.1|1170969_1171461_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1171629_1172343_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556650.1|1172771_1173746_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209897.1|1174066_1174309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1174330_1174696_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1174641_1175217_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211960.1|1175460_1175988_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_129556649.1|1176527_1177385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|1177412_1177994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|1178563_1178749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556562.1|1178893_1179196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1179155_1179494_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211968.1|1179619_1180024_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1180036_1180177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126649.1|1180273_1181470_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_016211971.1|1181490_1182102_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_129556561.1|1182307_1183461_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	2.6e-58
WP_032126362.1|1183631_1183997_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1183942_1184518_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274909.1|1184616_1184943_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1185326_1185491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1185480_1185780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728345.1|1185820_1186429_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032126790.1|1186619_1187525_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_129556560.1|1187494_1188031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556559.1|1188111_1188540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212093.1|1188696_1189626_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_075273313.1|1189838_1190177_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377876.1|1190136_1190592_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212654.1|1190583_1190868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212100.1|1191278_1192199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212098.1|1192199_1193051_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1193758_1194805_+	glutathione synthase	NA	NA	NA	NA	NA
WP_032126840.1|1194788_1196786_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_122941967.1|1196964_1197270_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|1197499_1197706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|1197966_1198668_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211519.1|1198668_1199088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307348.1|1200243_1203000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211092.1|1203235_1204528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211091.1|1204571_1207052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211094.1|1208116_1208440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1208459_1209434_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211036.1|1209781_1211653_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_016211039.1|1211744_1213490_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211043.1|1213569_1214019_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211035.1|1214071_1214287_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211042.1|1214533_1215550_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211037.1|1215598_1216228_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211040.1|1216578_1217790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126170.1|1218017_1218290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556558.1|1218453_1219347_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556557.1|1219491_1219803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212394.1|1219850_1220555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211450.1|1221576_1222599_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211448.1|1222697_1223906_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211446.1|1223895_1225623_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_129556648.1|1225806_1226778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1227191_1228253_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126397.1|1228601_1229192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210561.1|1229306_1230641_-	dihydroorotase	NA	NA	NA	NA	NA
WP_016210568.1|1230768_1231410_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_016210566.1|1231715_1232138_+	universal stress protein	NA	NA	NA	NA	NA
WP_016210559.1|1232498_1233461_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_016210564.1|1233457_1233919_+	amidohydrolase	NA	NA	NA	NA	NA
WP_016210557.1|1233921_1234674_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_016210560.1|1234762_1236463_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_016210562.1|1238030_1239683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210558.1|1239756_1240512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|1242148_1242514_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211932.1|1242924_1244214_-	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_016211931.1|1244409_1245597_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211476.1|1245914_1246124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211473.1|1246107_1246707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211474.1|1246781_1248131_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_032126518.1|1248213_1250415_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211478.1|1250431_1251247_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126519.1|1251226_1251946_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_129556556.1|1252113_1252689_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	1295697	1478905	3149273	integrase,transposase,tRNA,protease	Leptospira_phage(12.5%)	176	1361382:1361441	1429921:1431150
WP_016209434.1|1295697_1297119_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016209437.1|1297149_1297671_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	2.0e-10
WP_016209438.1|1297667_1298267_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_016209440.1|1298344_1299355_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.9	1.5e-06
WP_016209415.1|1299467_1300172_+	protein TolQ	NA	NA	NA	NA	NA
WP_016209407.1|1300208_1300640_+	protein TolR	NA	NA	NA	NA	NA
WP_016209428.1|1300642_1301737_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_129556552.1|1301772_1303140_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_016209425.1|1303175_1303817_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032126507.1|1303859_1304789_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_016209451.1|1304791_1305439_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	37.9	1.2e-36
WP_032126506.1|1305489_1306293_-	AAA family ATPase	NA	A0A0E3G5H5	Synechococcus_phage	43.1	8.9e-42
WP_016209417.1|1306474_1306687_+	SlyX family protein	NA	NA	NA	NA	NA
WP_016209423.1|1306690_1306924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209422.1|1306985_1308566_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_016209426.1|1308767_1309697_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.3	1.6e-13
WP_016209420.1|1309698_1310466_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_032126509.1|1310870_1311587_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_016209442.1|1311624_1311987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209432.1|1312158_1313868_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016209448.1|1314125_1315457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209449.1|1315898_1317371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1317544_1318519_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300152.1|1319192_1319558_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274897.1|1319798_1320665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273512.1|1321177_1321522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210519.1|1321511_1322279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210521.1|1322514_1324452_-	his Kinase A domain protein	NA	NA	NA	NA	NA
WP_016210517.1|1325465_1326185_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_032126504.1|1326298_1329838_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_016210525.1|1329904_1330723_+	ZipA protein	NA	NA	NA	NA	NA
WP_016210518.1|1330709_1332749_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.8	3.0e-126
WP_016210522.1|1332764_1333817_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_016210524.1|1333827_1334358_+	exsB family protein	NA	NA	NA	NA	NA
WP_129556549.1|1334896_1335782_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046739.1|1336667_1336808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210010.1|1338452_1338629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210017.1|1338804_1339188_+	hpt domain protein	NA	NA	NA	NA	NA
WP_075273518.1|1339263_1339557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210016.1|1339723_1340683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210020.1|1341283_1341439_+	putative membrane protein	NA	NA	NA	NA	NA
WP_016210025.1|1341703_1343074_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210009.1|1343066_1343273_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016210012.1|1343348_1344020_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210005.1|1344000_1346805_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	2.4e-57
WP_016210027.1|1346884_1347481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|1347870_1348626_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210004.1|1348825_1349467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210021.1|1349727_1351053_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210023.1|1351049_1353107_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210007.1|1353084_1353657_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126616.1|1353712_1354072_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210019.1|1354136_1355171_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_122941592.1|1355428_1356280_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|1356374_1357358_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_016210013.1|1357514_1359182_+	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
WP_032126790.1|1359367_1360273_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211421.1|1360369_1360594_+	hypothetical protein	NA	NA	NA	NA	NA
1361382:1361441	attL	GGTAACCCTCCCTTAAAATGAGACAACTCATAACTGGAATCTTCTGTTAACATTTTCAAA	NA	NA	NA	NA
WP_032126239.1|1361452_1361725_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1361736_1362573_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075274733.1|1362623_1362941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1362959_1363535_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1363480_1363846_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300287.1|1363867_1364197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556547.1|1364605_1365166_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_155049882.1|1365433_1365583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556546.1|1365591_1366778_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	5.9e-58
WP_081377874.1|1367238_1367706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1367874_1368132_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274890.1|1368201_1368882_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_129556545.1|1369086_1369428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212209.1|1369682_1370684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1371139_1371439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|1371428_1371593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1371750_1372089_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1372048_1372504_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075274888.1|1372508_1372844_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274886.1|1373115_1374177_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211279.1|1374920_1377389_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_016211277.1|1377402_1378371_+	homoserine kinase	NA	NA	NA	NA	NA
WP_016211278.1|1378357_1379617_+	threonine synthase	NA	NA	NA	NA	NA
WP_129556646.1|1379668_1381054_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300295.1|1381864_1382089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126750.1|1382369_1383167_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016211170.1|1383325_1383496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211167.1|1384127_1385249_+	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	1.5e-10
WP_016211172.1|1385298_1386495_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_080664856.1|1386683_1387748_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_051307350.1|1387731_1388478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211165.1|1388467_1389196_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211168.1|1389192_1389852_+	wbqC-like family protein	NA	NA	NA	NA	NA
WP_155046736.1|1389829_1390783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|1390782_1391298_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211164.1|1391340_1391718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210396.1|1391855_1392044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210391.1|1392111_1393062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210393.1|1393155_1395357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210398.1|1395557_1397150_+	B-type flagellin	NA	NA	NA	NA	NA
WP_032126669.1|1397374_1398952_+	B-type flagellin	NA	NA	NA	NA	NA
WP_122940572.1|1399070_1399496_+	flaG family protein	NA	NA	NA	NA	NA
WP_016210394.1|1399606_1400992_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_032126670.1|1401017_1401455_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210390.1|1401459_1401801_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_016210399.1|1401815_1403807_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210388.1|1403832_1404507_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210397.1|1404503_1406678_-	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_054300550.1|1406867_1407233_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1407289_1407454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1407443_1407743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210772.1|1407875_1409429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|1409512_1410322_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_033923762.1|1410449_1410683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210769.1|1410983_1412486_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_016210773.1|1412789_1415483_+	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210771.1|1415479_1418881_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_054300162.1|1418972_1420055_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_129556544.1|1420117_1420474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274882.1|1420588_1421185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212246.1|1422120_1422777_+	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300162.1|1422880_1423963_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300271.1|1424302_1425277_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212247.1|1425904_1426660_-	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_036779544.1|1427026_1428034_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1428033_1428291_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1428788_1429625_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1429636_1429909_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274880.1|1430904_1431870_+|transposase	transposase	transposase	NA	NA	NA	NA
1429921:1431150	attR	TTTGAAAATGTTAACAGAAGATTCCAGTTATGAGTTGTCTCATTTTAAGGGAGGGTTACCTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCGAAGTATCAGCCATGATAAAGTCACACGCTTTTTAAATAAAAACCACTTTGGATCAAAAGAGCTCTGGAGCTATGTTAAAAAGCATGTTCGTCAGTATGAAGAAGAAGTTGGAGGCGTTTTAAGTCTGGATGATACCGTGGAAGAAAAGCCTTATACAGATGAGAATGATGTGGTTTGTTGGCATTATTCACACAGCAAAAGCGCTCATGTAAAGGGAATTAATATTTTGACAAGTATGGTGACTTACAAG	NA	NA	NA	NA
WP_016212058.1|1432025_1433576_+	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_081377873.1|1434218_1435055_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.9	4.6e-41
WP_032126239.1|1435066_1435339_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209461.1|1435448_1435913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209453.1|1436022_1436172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209496.1|1436339_1436552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664817.1|1436581_1437355_+	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209485.1|1437379_1438402_+	chorismate mutase	NA	NA	NA	NA	NA
WP_032126728.1|1438454_1439759_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_052133284.1|1439749_1440316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209460.1|1440305_1441388_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.1	1.0e-72
WP_016209465.1|1441434_1442535_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_016209488.1|1442575_1443064_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_052047096.1|1443213_1443903_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016209481.1|1444105_1444432_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_016209480.1|1444481_1444709_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_016209484.1|1444720_1445173_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209475.1|1445382_1446804_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	1.7e-152
WP_016209491.1|1446836_1447934_+	alanine racemase	NA	NA	NA	NA	NA
WP_016209456.1|1447958_1448690_-	mannosyl-glycoendo-beta-N-acetylglucosaminidase family protein	NA	M1IDP9	Pelagibacter_phage	35.8	5.3e-09
WP_016209472.1|1448803_1450174_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_032126730.1|1450276_1450765_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_016209463.1|1451119_1451503_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_016209490.1|1451929_1452253_+	YqcC family protein	NA	NA	NA	NA	NA
WP_129556645.1|1452343_1454293_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_016209478.1|1454384_1455338_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209459.1|1455501_1456668_-	rasGEF domain protein	NA	NA	NA	NA	NA
WP_075273528.1|1456927_1457893_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_016209455.1|1458073_1459120_+	membrane protein	NA	NA	NA	NA	NA
WP_016209467.1|1459112_1460138_+	FUSC family protein	NA	NA	NA	NA	NA
WP_016209494.1|1460207_1462232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664818.1|1462913_1463249_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016209474.1|1463390_1463801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209462.1|1463810_1463954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209471.1|1463963_1464290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664819.1|1464436_1465474_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_016209486.1|1465515_1465767_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_155046977.1|1465885_1466206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209458.1|1466213_1467788_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_016209457.1|1467931_1468513_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_016209482.1|1468812_1470615_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	39.2	5.1e-21
WP_129556644.1|1470665_1471553_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209466.1|1471958_1472633_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	34.5	8.9e-27
WP_016209492.1|1472638_1473538_+	GTPase Era	NA	NA	NA	NA	NA
WP_016209497.1|1473551_1474295_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_016209489.1|1474297_1475029_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_016209473.1|1475025_1475409_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_016212202.1|1476370_1477618_-	glutaminase	NA	NA	NA	NA	NA
WP_075274878.1|1478029_1478905_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	1483346	1527477	3149273	transposase,integrase	Escherichia_phage(16.67%)	46	1498472:1498531	1528244:1528534
WP_075273327.1|1483346_1483922_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1483935_1484226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|1484171_1484747_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212551.1|1485088_1485583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556643.1|1486040_1487405_-	histidine kinase	NA	NA	NA	NA	NA
WP_016211983.1|1487500_1488160_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556539.1|1488407_1488752_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300307.1|1488820_1489549_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_075274875.1|1489595_1489898_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211212.1|1490180_1491740_-	APC family permease	NA	NA	NA	NA	NA
WP_016211215.1|1492100_1494071_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211211.1|1494262_1495342_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211213.1|1495390_1495597_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211210.1|1495603_1497085_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016211214.1|1497187_1497751_-	hypothetical protein	NA	NA	NA	NA	NA
1498472:1498531	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_016211942.1|1499513_1500773_+	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211940.1|1500893_1501226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1501339_1502314_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016211341.1|1502458_1502629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211343.1|1502827_1503850_+	YHYH protein	NA	NA	NA	NA	NA
WP_016211342.1|1503857_1505540_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.1e-32
WP_016211344.1|1505700_1506519_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211347.1|1506732_1507716_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211340.1|1507708_1507930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211346.1|1507957_1508599_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_105962625.1|1509748_1510634_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1510638_1510926_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_036774554.1|1510978_1511257_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126998.1|1511355_1511703_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_032126997.1|1512024_1512264_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075273532.1|1512481_1513069_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300314.1|1513029_1513365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211315.1|1513552_1514197_-	porin family protein	NA	NA	NA	NA	NA
WP_016211316.1|1514531_1515182_-	porin family protein	NA	NA	NA	NA	NA
WP_016211319.1|1515714_1516767_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032126786.1|1516784_1519865_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_075274874.1|1520163_1520532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1520532_1521108_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1521053_1521419_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274873.1|1521440_1521938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274872.1|1522412_1522952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556536.1|1522911_1524064_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_081377871.1|1524067_1524760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1524964_1525222_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556535.1|1525411_1526298_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377829.1|1526742_1527477_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
1528244:1528534	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTTT	NA	NA	NA	NA
>prophage 15
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	1557099	1674318	3149273	transposase,tRNA	Staphylococcus_phage(21.43%)	108	NA	NA
WP_016209621.1|1557099_1558104_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209619.1|1558536_1559985_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209620.1|1560071_1563128_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_080664820.1|1563110_1563281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556532.1|1563589_1563772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212485.1|1564068_1564602_-	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_075273327.1|1565354_1565930_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1565875_1566241_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126753.1|1566333_1566798_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_016211466.1|1566867_1568388_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126752.1|1568475_1569078_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211464.1|1569074_1569422_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_016211465.1|1569572_1570556_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_016211462.1|1571183_1572164_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_052047087.1|1572324_1572543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274864.1|1572714_1573740_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126540.1|1576960_1577824_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211749.1|1578032_1579226_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211748.1|1579305_1580910_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211752.1|1580925_1582071_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_129556531.1|1582275_1582473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1582435_1582774_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1582733_1583189_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_081007023.1|1583363_1584020_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016212534.1|1584096_1584363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211725.1|1585933_1586848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211728.1|1586886_1588821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211726.1|1589208_1589802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274862.1|1589973_1590570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046732.1|1590684_1590855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300325.1|1591048_1591321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211456.1|1591942_1592521_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_122942091.1|1592548_1592944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211455.1|1593049_1594507_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_016211452.1|1594568_1596056_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211454.1|1596806_1597277_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1597417_1597993_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1597938_1598304_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556641.1|1602178_1603441_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_016210751.1|1603528_1605334_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_016210752.1|1605817_1606615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210749.1|1606784_1607246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1607544_1609500_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1610179_1610365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212185.1|1610698_1611688_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_075273327.1|1611781_1612357_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1612302_1612668_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080664871.1|1613099_1614722_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.9	1.9e-27
WP_016211834.1|1614812_1615127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307365.1|1615383_1615644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211836.1|1615663_1616152_+	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_129556528.1|1617675_1618104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1618525_1618783_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047040.1|1618852_1619791_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_051307338.1|1619816_1621382_-	APC family permease	NA	NA	NA	NA	NA
WP_016210800.1|1621591_1622419_-	DsbA family protein	NA	NA	NA	NA	NA
WP_075273540.1|1622785_1623397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556527.1|1623581_1623842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210799.1|1624303_1625257_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_016210791.1|1625683_1625884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307339.1|1626258_1627065_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210795.1|1627170_1628142_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210801.1|1628123_1629095_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210793.1|1629417_1630098_-	OmpW family protein	NA	NA	NA	NA	NA
WP_081007004.1|1630099_1630555_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1630514_1630853_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211352.1|1631026_1631467_-	universal stress protein	NA	NA	NA	NA	NA
WP_016211350.1|1632145_1633084_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211349.1|1633147_1635142_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_032127067.1|1635138_1635741_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211351.1|1635737_1636076_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_129556640.1|1636151_1637378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1637644_1638619_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211856.1|1638834_1639020_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_016211855.1|1639146_1639614_+	bacterioferritin	NA	NA	NA	NA	NA
WP_016211857.1|1639610_1640489_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_032126602.1|1640739_1642047_+	MFS transporter	NA	NA	NA	NA	NA
WP_081007004.1|1642199_1642655_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1642614_1642953_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|1643914_1644820_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211738.1|1644890_1645535_+	membrane protein	NA	NA	NA	NA	NA
WP_016211741.1|1646011_1646788_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126783.1|1646933_1648175_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_155046971.1|1648285_1648831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274822.1|1649132_1650107_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_129556526.1|1650165_1650951_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.8	1.3e-45
WP_016212445.1|1650947_1651214_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016211177.1|1651428_1652649_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126450.1|1653016_1655011_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211185.1|1655123_1655732_-	smr domain protein	NA	NA	NA	NA	NA
WP_032126449.1|1655798_1656722_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016211180.1|1656742_1657207_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_016211178.1|1657269_1658298_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_032126448.1|1658388_1658769_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_016211182.1|1658800_1659130_+	DUF4404 family protein	NA	NA	NA	NA	NA
WP_016212475.1|1660114_1660321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1660518_1661493_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556525.1|1661568_1662389_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210855.1|1662542_1663520_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016210849.1|1663637_1665086_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210847.1|1665114_1666119_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210851.1|1666141_1666813_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210850.1|1666797_1668051_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1668299_1668854_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210848.1|1669149_1670334_+	MFS transporter	NA	NA	NA	NA	NA
WP_051307341.1|1670500_1672099_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_081007030.1|1672792_1673764_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377870.1|1673799_1674318_+|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	31.0	1.6e-07
>prophage 16
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	1702344	1741186	3149273	transposase,tRNA	Staphylococcus_phage(20.0%)	31	NA	NA
WP_129556523.1|1702344_1703231_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274822.1|1703566_1704541_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_054300148.1|1704638_1705700_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1706254_1707229_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273327.1|1707919_1708495_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1708440_1708806_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274858.1|1708942_1710028_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274857.1|1711607_1712483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126678.1|1712493_1713504_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_016211554.1|1713830_1714457_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_016211557.1|1714502_1715732_+	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_032126677.1|1715926_1716490_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211555.1|1716564_1717923_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_016211664.1|1718459_1719188_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211666.1|1719560_1722380_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211669.1|1722534_1722885_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556522.1|1725993_1727226_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211405.1|1727432_1729205_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_016211403.1|1729340_1730384_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_016211399.1|1730397_1731141_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_032126682.1|1731248_1731575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|1732179_1732878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211734.1|1733299_1733569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211731.1|1733584_1734691_+	protein kinase	NA	NA	NA	NA	NA
WP_016211733.1|1734746_1735571_-	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_075274856.1|1737326_1738352_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046730.1|1738570_1738711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1738978_1739626_-	LysE family translocator	NA	NA	NA	NA	NA
WP_016212267.1|1739906_1740266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|1740432_1740888_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273804.1|1740847_1741186_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	1751451	1851347	3149273	integrase,transposase,protease,tRNA	Staphylococcus_phage(20.0%)	96	1821863:1821922	1856347:1856427
WP_105962625.1|1751451_1752337_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556521.1|1752871_1753060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556520.1|1753010_1753907_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	1.8e-54
WP_032126362.1|1753867_1754233_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1754178_1754754_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|1754829_1755123_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_155046729.1|1755340_1756387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211631.1|1756645_1757452_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_016211634.1|1757707_1758529_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211632.1|1758564_1759419_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016211627.1|1759644_1759809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377868.1|1760114_1760771_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016210103.1|1760846_1762205_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_016210117.1|1762486_1762846_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210111.1|1763266_1764901_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_017377579.1|1764907_1765744_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210099.1|1765765_1767043_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_016210105.1|1767126_1767447_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210106.1|1767466_1768558_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_016210102.1|1768740_1770330_+	APC family permease	NA	NA	NA	NA	NA
WP_016210110.1|1770390_1771146_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	5.4e-65
WP_016210113.1|1771333_1772383_+	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.5	7.9e-30
WP_016210101.1|1772805_1774302_+	flagellin domain protein	NA	NA	NA	NA	NA
WP_016210107.1|1774591_1774864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210114.1|1774935_1776195_-	calcineurin-like phosphoesterase	NA	NA	NA	NA	NA
WP_016210108.1|1776287_1777553_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	9.1e-49
WP_122943012.1|1777738_1778194_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_016210112.1|1778310_1779738_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.0	2.5e-55
WP_032126690.1|1780431_1780914_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_052047138.1|1786961_1787195_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046728.1|1787457_1788432_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	6.8e-28
WP_155049900.1|1788560_1788866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211563.1|1789214_1789376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211564.1|1789408_1790284_-	ParA family protein	NA	NA	NA	NA	NA
WP_016211561.1|1790449_1794316_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_080728343.1|1794397_1794538_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_081007034.1|1794519_1794804_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_032126538.1|1795068_1796487_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_016211991.1|1797395_1798301_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126537.1|1798541_1798727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211994.1|1798763_1799300_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_016212348.1|1800718_1801948_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_075274849.1|1801942_1802686_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126239.1|1802811_1803084_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1803095_1803932_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_129556517.1|1803950_1804238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1804635_1805610_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300271.1|1806257_1807232_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212012.1|1807468_1808146_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016212013.1|1808161_1808545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212011.1|1808766_1809888_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_075274847.1|1810121_1810997_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211974.1|1811279_1812401_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075273551.1|1812500_1812803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556638.1|1812802_1813483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377865.1|1814827_1815112_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664876.1|1815470_1817333_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_033923779.1|1817645_1818482_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1818493_1818766_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212529.1|1818806_1819364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275108.1|1819722_1820328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1820304_1821279_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046727.1|1821522_1821867_+	hypothetical protein	NA	NA	NA	NA	NA
1821863:1821922	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_129556515.1|1822692_1823052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1823070_1823343_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1823354_1824191_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075274844.1|1824199_1824451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|1824631_1825606_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016211144.1|1826162_1826792_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_016211152.1|1826775_1827198_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211145.1|1827204_1828944_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211153.1|1828944_1830009_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1830012_1830366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1830478_1831435_+	ferrochelatase	NA	NA	NA	NA	NA
WP_016211151.1|1831444_1831756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1831771_1832341_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211148.1|1832604_1833933_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_081377864.1|1834014_1834254_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1834267_1835104_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1835115_1835388_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1835472_1836447_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210841.1|1836660_1837032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210839.1|1837090_1837864_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_129556514.1|1838015_1840472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126340.1|1840751_1841513_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_122941824.1|1841593_1843330_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016210844.1|1843514_1844642_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.2	5.7e-10
WP_016210843.1|1844728_1844959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556637.1|1845573_1846353_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016212589.1|1846827_1847265_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300363.1|1847688_1848036_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556512.1|1847981_1848557_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212275.1|1848546_1849530_-	MFS transporter	NA	NA	NA	NA	NA
WP_051307372.1|1849645_1850035_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036774189.1|1850082_1851090_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1851089_1851347_-|transposase	transposase	transposase	NA	NA	NA	NA
1856347:1856427	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCC	NA	NA	NA	NA
>prophage 18
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	1878197	1937307	3149273	transposase,tRNA	uncultured_Mediterranean_phage(30.77%)	55	NA	NA
WP_016211804.1|1878197_1879583_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
WP_016211805.1|1879589_1881128_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211806.1|1881170_1881896_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_032126239.1|1882685_1882958_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1882969_1883806_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_129556510.1|1884329_1885433_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	7.3e-10
WP_054300405.1|1885534_1886035_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016209947.1|1886556_1887219_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_016209946.1|1887245_1888475_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209940.1|1888631_1891403_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_016209937.1|1891478_1891922_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209931.1|1892074_1893547_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_016209926.1|1893658_1894720_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209945.1|1894716_1895751_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209932.1|1895753_1896794_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209936.1|1896976_1898092_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.6	1.4e-93
WP_016209930.1|1898130_1898484_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_032126634.1|1898504_1900373_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209935.1|1900394_1901339_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_016209925.1|1901572_1901851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1902060_1902699_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209944.1|1902673_1904101_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209927.1|1904301_1904979_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209939.1|1905113_1906388_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209943.1|1906455_1907211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209948.1|1907262_1908180_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_016209929.1|1908288_1909182_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075274822.1|1910640_1911615_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016211771.1|1911907_1912096_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_016211770.1|1912109_1913243_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_075274823.1|1913442_1917453_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211823.1|1917487_1917676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211827.1|1917716_1918337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1918668_1919022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1919235_1919430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|1920095_1920623_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300400.1|1920679_1920922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300399.1|1921066_1921333_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210885.1|1921674_1922556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|1922613_1923210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|1923242_1924016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|1924549_1924846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210888.1|1924868_1925120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210883.1|1925080_1925788_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210886.1|1925856_1926636_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_016210887.1|1926718_1927669_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210889.1|1928178_1931025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556636.1|1931042_1931351_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016212002.1|1932304_1932583_-	DNA-J related family protein	NA	NA	NA	NA	NA
WP_016212000.1|1932702_1933431_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016211998.1|1933561_1934125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211999.1|1934114_1934468_-	ras family protein	NA	NA	NA	NA	NA
WP_033923779.1|1934847_1935684_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1935695_1935968_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274825.1|1936245_1937307_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	1974121	2069135	3149273	transposase,tRNA	Bacillus_phage(15.0%)	86	NA	NA
WP_155097730.1|1974121_1974991_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211218.1|1976576_1977314_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_155097731.1|1980831_1980945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126789.1|1982592_1982775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211682.1|1983464_1985147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211680.1|1985194_1987594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274826.1|1987824_1988730_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1988986_1990258_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_016211218.1|1990282_1991020_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1991272_1992415_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1992431_1994033_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1994544_1994682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1994678_1995956_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|1996305_1996488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126600.1|1996759_1997281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212250.1|1997403_1998054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212251.1|1998215_1998752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300384.1|1998913_1999729_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075274828.1|2000137_2001460_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	1.2e-11
WP_052133287.1|2001561_2001960_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212039.1|2002148_2002706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212040.1|2002882_2004232_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_054300162.1|2004435_2005518_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016210803.1|2005592_2006891_-	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_016210808.1|2007068_2007920_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_016210805.1|2007928_2008600_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_032126141.1|2009009_2010284_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016210804.1|2010348_2012268_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.0	4.5e-84
WP_032126139.1|2012274_2013204_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_033923779.1|2015872_2016709_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075274829.1|2016720_2016993_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2017016_2017991_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046725.1|2018034_2018175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300382.1|2018391_2018814_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377858.1|2019032_2019743_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2019946_2020312_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2020326_2020833_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211414.1|2021048_2021867_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|2021974_2022436_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211415.1|2022452_2023376_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211417.1|2023399_2024449_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_051307357.1|2024585_2025179_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211422.1|2025201_2025672_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_032126143.1|2025760_2027032_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_075274832.1|2027131_2028106_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_016211838.1|2028417_2028591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211840.1|2029061_2029526_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211839.1|2029684_2031157_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211841.1|2031274_2031727_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|2032586_2033648_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|2033950_2035033_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212483.1|2035043_2035841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2035837_2036413_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2036358_2036724_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300380.1|2036825_2037482_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556508.1|2037752_2038196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|2038257_2038551_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556507.1|2038667_2039354_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	48.3	5.5e-48
WP_075273327.1|2039343_2039919_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2039864_2040230_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212421.1|2040721_2040904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2041654_2042629_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556505.1|2042669_2043635_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211470.1|2044401_2045055_+	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_016211471.1|2045114_2047100_-	sodium/hydrogen exchanger family protein	NA	NA	NA	NA	NA
WP_032126343.1|2047230_2048043_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_032126344.1|2048163_2049252_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_016211467.1|2049254_2049821_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_075273298.1|2049895_2050471_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|2050416_2050782_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052047029.1|2050949_2051291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2051363_2052425_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032127044.1|2052628_2052829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212482.1|2053043_2053187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|2053730_2054024_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556503.1|2055085_2055952_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	5.6e-58
WP_016210508.1|2055960_2057658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210507.1|2057978_2058527_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_075273576.1|2058654_2059383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|2059442_2062940_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_016210514.1|2062997_2064251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210515.1|2064359_2065262_-	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210512.1|2065315_2066353_-	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210506.1|2066488_2067727_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210510.1|2067719_2068448_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_081007040.1|2068478_2069135_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	2073671	2126352	3149273	transposase,protease,tRNA	Klosneuvirus(28.57%)	48	NA	NA
WP_075273327.1|2073671_2074247_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2074192_2074558_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126565.1|2074768_2075041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211013.1|2075358_2077725_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_016211011.1|2077785_2078982_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_016211010.1|2079260_2081690_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_016211008.1|2081782_2083285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211012.1|2083393_2083966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273571.1|2084115_2084793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556502.1|2084901_2085465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210926.1|2085724_2087194_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_016210918.1|2087278_2088028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210930.1|2088031_2088805_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210927.1|2088865_2089816_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016210917.1|2089940_2091383_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.5	5.4e-21
WP_032126561.1|2091596_2092781_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210925.1|2092904_2093591_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.5	9.7e-29
WP_016210921.1|2093682_2094267_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_155046724.1|2094491_2094659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210929.1|2094655_2095012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210928.1|2095046_2095352_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_054300375.1|2095566_2095767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728346.1|2096573_2096906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372539.1|2096923_2097787_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556501.1|2097819_2098395_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2098340_2098706_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211651.1|2098939_2100475_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016211650.1|2100599_2102084_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211648.1|2102743_2103283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126643.1|2104486_2104693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126642.1|2104762_2105224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126641.1|2105259_2107830_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_016209840.1|2107937_2108423_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_016209844.1|2108595_2109636_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209835.1|2109613_2110096_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209848.1|2110092_2112687_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209832.1|2112993_2113257_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209831.1|2113535_2114234_-	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209841.1|2114453_2114648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209827.1|2114723_2116283_-	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_129556633.1|2116601_2117498_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209845.1|2117714_2119190_-	APC family permease	NA	NA	NA	NA	NA
WP_016209826.1|2119712_2120735_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_016209830.1|2121065_2122433_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209846.1|2122668_2122923_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126639.1|2122938_2124225_+	GTPase HflX	NA	NA	NA	NA	NA
WP_016209836.1|2124244_2125459_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_016209838.1|2125458_2126352_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 21
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	2163424	2270459	3149273	transposase,tRNA	Bacillus_phage(16.67%)	95	NA	NA
WP_016211285.1|2163424_2164204_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_016211286.1|2164221_2164569_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_016211289.1|2164680_2164953_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211767.1|2166281_2167091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211764.1|2167641_2168463_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126803.1|2168663_2169896_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_081377862.1|2170382_2171219_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2171230_2171503_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046719.1|2171521_2171680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|2173898_2174714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211525.1|2177013_2179749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275102.1|2180337_2180796_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377901.1|2180976_2181687_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126856.1|2181747_2182089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|2182393_2183547_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_155049815.1|2183729_2183882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212005.1|2184447_2186208_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_016210592.1|2186597_2187254_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016210586.1|2187266_2188772_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210593.1|2188793_2189324_-	colicin V production protein	NA	NA	NA	NA	NA
WP_016210590.1|2189403_2190666_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210587.1|2190840_2191701_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_032126176.1|2191802_2192585_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210588.1|2192675_2194001_-	fimV domain protein	NA	NA	NA	NA	NA
WP_016210595.1|2194368_2195547_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210594.1|2195723_2196377_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_016210596.1|2196512_2198453_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	3.1e-72
WP_129556498.1|2198449_2199058_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075275098.1|2199570_2200500_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.1e-24
WP_080728317.1|2200690_2204056_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211391.1|2204122_2204698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211393.1|2204709_2206266_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_016211396.1|2206285_2206636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211395.1|2206632_2206968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372269.1|2207324_2207696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212466.1|2207900_2208626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212252.1|2208940_2209099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212254.1|2209136_2210579_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_075273327.1|2210568_2211144_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|2211089_2211380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2211393_2211969_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2211914_2212280_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274672.1|2212451_2213045_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211114.1|2213410_2216341_-	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_016211115.1|2216473_2218426_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211112.1|2218618_2219266_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211113.1|2219321_2220647_+	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_032126179.1|2220676_2220928_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_080664854.1|2220885_2221467_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_054300408.1|2221803_2222460_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_032126362.1|2222510_2222876_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275097.1|2222821_2223397_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275095.1|2223798_2224575_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209823.1|2224619_2225063_-	response regulator	NA	NA	NA	NA	NA
WP_016209809.1|2225487_2225976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209817.1|2226082_2227051_+	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_016209820.1|2227752_2231052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209803.1|2231110_2232148_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209810.1|2232352_2234266_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	6.9e-117
WP_016209822.1|2234327_2234975_-	methyltransferase domain protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_016209802.1|2235110_2236235_-	D-isomer specific 2-hydroxyacid dehydrogenase catalytic domain protein	NA	NA	NA	NA	NA
WP_016209800.1|2236231_2236828_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_016209821.1|2236858_2237191_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016209812.1|2237280_2239104_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	9.7e-44
WP_032126326.1|2239556_2240819_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	3.1e-25
WP_016209815.1|2241586_2242126_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_016209799.1|2242511_2242928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209818.1|2243023_2243839_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_016209805.1|2243971_2245465_+	neurotransmitter symporter family protein	NA	NA	NA	NA	NA
WP_032126324.1|2245643_2246066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209801.1|2246065_2248120_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016209813.1|2248404_2249220_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_016209824.1|2249320_2250139_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_016209808.1|2250135_2250504_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_016209806.1|2250846_2250996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212343.1|2251808_2252615_+	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_105962623.1|2252853_2254007_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016211588.1|2254174_2254876_-	cyclase family protein	NA	NA	NA	NA	NA
WP_032126329.1|2254951_2255581_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_129556496.1|2255766_2257005_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_016211592.1|2257279_2257942_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_016211589.1|2257931_2259164_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_129556495.1|2259286_2259544_+	VOC family protein	NA	NA	NA	NA	NA
WP_144019383.1|2259898_2260117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|2260524_2260818_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_032126540.1|2261048_2261912_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2262045_2262411_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2262356_2262932_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126332.1|2263578_2264778_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_016211366.1|2265030_2265318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126331.1|2265373_2267383_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_032126330.1|2267437_2268397_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_016211367.1|2268544_2269327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664860.1|2269482_2269920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2269883_2270459_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	2286586	2386143	3149273	transposase,tRNA	Armadillidium_vulgare_iridescent_virus(12.5%)	99	NA	NA
WP_016210280.1|2286586_2287681_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_054300412.1|2287917_2288232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273307.1|2288376_2288787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275091.1|2289057_2289543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556631.1|2290551_2290719_+	phosphatase	NA	NA	NA	NA	NA
WP_075275089.1|2290863_2291196_+	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	37.3	8.0e-05
WP_032126500.1|2291329_2292046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211118.1|2292182_2293430_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126499.1|2293808_2294420_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211122.1|2294516_2295383_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|2295386_2296148_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_016211128.1|2296311_2297217_+	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211125.1|2297439_2298270_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211126.1|2298439_2298829_+	lipoprotein	NA	NA	NA	NA	NA
WP_032126498.1|2298961_2299522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2299583_2299949_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2299894_2300470_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212621.1|2300466_2300871_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_016212585.1|2301165_2301486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274822.1|2301597_2302572_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_075273327.1|2302941_2303517_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2303462_2303828_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275086.1|2303788_2304787_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212356.1|2304764_2305610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047081.1|2305660_2306098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212519.1|2306368_2306749_-	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_075275084.1|2306823_2307885_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212611.1|2307932_2308253_-	histidine kinase	NA	NA	NA	NA	NA
WP_081377357.1|2308736_2309138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285940.1|2309222_2310044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126778.1|2310258_2310453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211088.1|2310631_2311594_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211087.1|2311813_2312809_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_016211081.1|2312836_2313772_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|2313812_2314274_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080664852.1|2314252_2315296_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016211090.1|2315308_2316943_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_080664853.1|2316902_2318645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|2319368_2321405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211709.1|2323664_2323811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274676.1|2323969_2324167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212323.1|2324241_2324514_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_148037404.1|2324590_2324851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212326.1|2324985_2325183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|2325408_2326294_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556489.1|2326298_2327495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2327740_2328802_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126869.1|2328779_2329019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2329539_2330115_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2330060_2330426_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2330656_2331232_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2331177_2331543_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|2332423_2333287_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556488.1|2334435_2335286_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275079.1|2335434_2336496_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126801.1|2336543_2337053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2337723_2338806_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300173.1|2338931_2339993_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212218.1|2341443_2341794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275077.1|2341938_2342775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2342859_2343765_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016210899.1|2344264_2346148_-	APC family permease	NA	NA	NA	NA	NA
WP_016210896.1|2346201_2347284_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210904.1|2347326_2347977_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210903.1|2348197_2348569_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_129556487.1|2348687_2350025_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210897.1|2350103_2351084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210894.1|2351424_2351727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|2352201_2352492_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210898.1|2352580_2352931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300269.1|2353842_2354211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2354232_2354598_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2354654_2354819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007012.1|2354808_2354979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275075.1|2354973_2356035_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273492.1|2356143_2356263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556486.1|2356353_2356701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556630.1|2356786_2358136_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211781.1|2358445_2359693_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_081377899.1|2360107_2360971_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210418.1|2361283_2361919_-	peroxiredoxin C	NA	NA	NA	NA	NA
WP_016210422.1|2362469_2363972_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_016210425.1|2363958_2367807_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_016210420.1|2367955_2369134_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.1	2.0e-50
WP_016210416.1|2369204_2369735_-	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_016210423.1|2369824_2370709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210417.1|2370705_2371143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126554.1|2371584_2372670_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_129556485.1|2372689_2375248_-	HAD-IC family P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	30.6	6.3e-73
WP_054300148.1|2375400_2376462_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273490.1|2376702_2377995_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_016211426.1|2378977_2380420_-	MFS transporter	NA	NA	NA	NA	NA
WP_129556484.1|2380763_2382224_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_129556700.1|2382788_2383034_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300265.1|2382993_2383254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300264.1|2383398_2383737_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_075275071.1|2383839_2384814_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212461.1|2385189_2385564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|2385567_2386143_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	2401981	2443751	3149273	transposase,integrase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(20.0%)	42	2412198:2412257	2440380:2441483
WP_052047108.1|2401981_2402380_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275068.1|2402481_2403072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2403156_2403522_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2403467_2404043_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211578.1|2404400_2404745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|2404760_2404955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|2405021_2405375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211582.1|2405472_2406252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211585.1|2406313_2406871_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016211581.1|2406989_2407760_-	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.9	8.9e-31
WP_016211583.1|2408036_2408945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211579.1|2409012_2409498_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054300162.1|2409721_2410804_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_129556481.1|2411061_2411493_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_016212302.1|2411677_2411977_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
2412198:2412257	attL	ACGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAAC	NA	NA	NA	NA
WP_054300271.1|2412290_2413265_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556480.1|2413288_2418778_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_016211300.1|2419289_2420330_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_054300162.1|2420380_2421463_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036781387.1|2421607_2421880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|2421872_2422151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126152.1|2422353_2422944_+|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016211531.1|2423007_2423688_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016211530.1|2424041_2424938_+	Abi family protein	NA	A3QSC6	Clostridium_virus	32.0	5.3e-35
WP_016211534.1|2424943_2425453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211532.1|2425439_2426390_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	35.8	1.8e-09
WP_016211528.1|2427036_2427342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664862.1|2427322_2428021_-	P-loop NTPase	NA	NA	NA	NA	NA
WP_075273327.1|2429194_2429770_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274918.1|2429715_2430081_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556479.1|2430568_2430751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212436.1|2430964_2431375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|2431713_2432599_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033923634.1|2432589_2433138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126157.1|2433342_2433747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|2434033_2435926_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_016211512.1|2436268_2437075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307360.1|2438166_2439096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2439935_2440301_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|2440472_2441447_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273512.1|2441583_2441928_+	hypothetical protein	NA	NA	NA	NA	NA
2440380:2441483	attR	ACGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTCTCTAGTTCGCCTTTTGACTTAGAGGGTAGAGATGGTTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGGTTATCAGAGGGAGACTCGCTCAGATCAATTGCTAGAGCACTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
WP_075275067.1|2442683_2443751_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	2462543	2603764	3149273	transposase,protease,tRNA	Staphylococcus_phage(15.0%)	119	NA	NA
WP_016209663.1|2462543_2463845_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_016209647.1|2463926_2464532_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209645.1|2464644_2465949_-	trigger factor	NA	NA	NA	NA	NA
WP_016209661.1|2466552_2467428_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_075273478.1|2467543_2468215_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209658.1|2468391_2469747_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_016209641.1|2469867_2470605_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032126159.1|2470684_2471398_-	aldolase	NA	NA	NA	NA	NA
WP_016209651.1|2472024_2473299_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2473329_2473905_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209649.1|2473949_2474915_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209640.1|2475373_2476393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|2476811_2477786_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_129556476.1|2477881_2478892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211684.1|2479436_2480012_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016211685.1|2480035_2481841_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211687.1|2481871_2482516_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_033923708.1|2482771_2483647_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556628.1|2483851_2484667_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.5e-32
WP_016210297.1|2484752_2486132_-	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_032126463.1|2486188_2487445_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_032126458.1|2487525_2489052_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_129556475.1|2489057_2490080_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_016210290.1|2490302_2491097_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210287.1|2491185_2492049_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_016210293.1|2492169_2493450_-	outer membrane beta-barrel domain protein	NA	NA	NA	NA	NA
WP_032126457.1|2494494_2494914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126460.1|2495821_2496259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210301.1|2496435_2497263_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_075273633.1|2497312_2497939_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_016210294.1|2498076_2498421_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_051307327.1|2498738_2499770_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.7e-35
WP_016210303.1|2500045_2500285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2500334_2501396_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210741.1|2502081_2502405_+	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_016210746.1|2502411_2506308_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210744.1|2506404_2506890_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210743.1|2506930_2508511_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_016210739.1|2508579_2510037_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210737.1|2510192_2512169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|2512487_2513108_-	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_016210742.1|2513273_2513549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2513699_2514674_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212172.1|2514693_2516166_-	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_075275065.1|2517056_2517731_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.9e-10
WP_054300173.1|2518030_2519092_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211822.1|2519401_2519815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211818.1|2520171_2521428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|2521630_2522131_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211819.1|2522427_2522658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556627.1|2522876_2523482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2523534_2524596_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2524622_2525198_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2525143_2525509_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052047106.1|2526224_2526701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2526774_2527350_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2527295_2527661_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155049892.1|2527711_2527951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212416.1|2528080_2528611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|2528612_2529068_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273456.1|2529027_2529327_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274832.1|2529449_2530424_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_016209398.1|2530982_2532209_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|2532807_2534514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664814.1|2534681_2535902_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209395.1|2536150_2538841_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_016209384.1|2539132_2539948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126585.1|2540298_2541219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209378.1|2541760_2542894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209380.1|2542981_2543404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209368.1|2543979_2545509_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_016209374.1|2545544_2546996_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209366.1|2546970_2547930_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_016209365.1|2548007_2551514_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.5	4.9e-193
WP_032126583.1|2551537_2552107_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	42.9	5.7e-27
WP_016209376.1|2552319_2553474_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_016209377.1|2553492_2554266_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_016209390.1|2554265_2554703_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_016209391.1|2554729_2555779_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_016209381.1|2555830_2556364_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_129556472.1|2556444_2558838_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_051307309.1|2559176_2560217_+	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_016209394.1|2562419_2563484_+	GHMP kinase	NA	NA	NA	NA	NA
WP_016209364.1|2563473_2564502_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_016209393.1|2564498_2565038_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_016209400.1|2565582_2567544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152498662.1|2568014_2569673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209397.1|2569793_2570669_-	bacterial lipid A biosynthesis acyltransferase family protein	NA	NA	NA	NA	NA
WP_016209379.1|2570756_2571563_-	cytidylyltransferase	NA	NA	NA	NA	NA
WP_032126580.1|2571570_2572308_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.5	7.2e-22
WP_016209396.1|2572324_2572882_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_016209399.1|2572885_2573623_-	UMP kinase	NA	NA	NA	NA	NA
WP_016209372.1|2573626_2574505_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_032126579.1|2574679_2575447_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_016209375.1|2575869_2576679_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_016209367.1|2576756_2579414_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_016209389.1|2579414_2580452_+	asparaginase	NA	NA	NA	NA	NA
WP_016209373.1|2580453_2581275_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_016209387.1|2581404_2582289_+	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2582426_2583002_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2582947_2583313_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275125.1|2585449_2586493_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210612.1|2588084_2589335_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016210605.1|2589323_2590205_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210611.1|2590197_2591283_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210607.1|2591279_2592539_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210598.1|2592707_2593367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556471.1|2593508_2594180_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210609.1|2594539_2595475_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_016210606.1|2595571_2596198_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210603.1|2596203_2596785_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210601.1|2596856_2597948_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210599.1|2598030_2598744_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_122940948.1|2598837_2599542_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300148.1|2599864_2600926_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126800.1|2601050_2601785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049893.1|2601969_2602185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046715.1|2602333_2602579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556470.1|2602878_2603764_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	2621811	2635610	3149273	transposase,protease	Bacillus_phage(66.67%)	16	NA	NA
WP_016209912.1|2621811_2622309_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209920.1|2622354_2625309_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_016209901.1|2625338_2625671_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_016209923.1|2625788_2626307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209908.1|2626781_2627492_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209899.1|2627488_2628523_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_032126651.1|2628626_2628812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275054.1|2628932_2629298_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2629243_2629819_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212369.1|2629822_2630269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212599.1|2631503_2631713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275052.1|2631762_2632272_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275050.1|2632416_2633112_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|2633187_2634093_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_129556700.1|2634949_2635195_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080743011.1|2635154_2635610_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	2672689	2811673	3149273	transposase,integrase,plate,tRNA	Escherichia_phage(32.14%)	141	2777629:2777688	2791414:2791605
WP_032126187.1|2672689_2673088_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_051307310.1|2673087_2674560_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_129556464.1|2674565_2675057_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_016209516.1|2675046_2676516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|2676520_2677213_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|2677190_2678219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126188.1|2678212_2679439_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209501.1|2679444_2680956_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_016209510.1|2681217_2681655_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209523.1|2681705_2683055_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209529.1|2683059_2683770_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_016209536.1|2683782_2686953_+	intracellular multiplication and macrophage-killing family protein	NA	NA	NA	NA	NA
WP_016209533.1|2688814_2689135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126191.1|2689279_2689801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376335.1|2689933_2690734_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_016210437.1|2690832_2691408_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.5	3.7e-58
WP_016210432.1|2691466_2692138_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_016210442.1|2692183_2693083_+	DUF3530 family protein	NA	NA	NA	NA	NA
WP_016210438.1|2693117_2693501_-	response regulator	NA	NA	NA	NA	NA
WP_016210440.1|2693628_2694105_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_033923648.1|2694104_2694386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210439.1|2694382_2695093_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_016210436.1|2695089_2696115_-	phosphotransferase	NA	NA	NA	NA	NA
WP_080664841.1|2696244_2698749_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_016210428.1|2698755_2700027_+	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_016210429.1|2700028_2701012_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_016210434.1|2701024_2701843_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_016210431.1|2701887_2702280_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_016210435.1|2702339_2703146_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_129556462.1|2703376_2704222_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.8	1.4e-24
WP_105962625.1|2704218_2705105_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007066.1|2705484_2705823_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275039.1|2705817_2706312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|2707115_2707406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007010.1|2707455_2708076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210530.1|2708916_2709597_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_016210535.1|2709593_2710406_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210534.1|2710479_2714160_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_016210531.1|2714169_2715657_-	ribonuclease G	NA	NA	NA	NA	NA
WP_016210527.1|2715666_2716284_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016210528.1|2716353_2716872_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210536.1|2716868_2717768_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2717783_2718827_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210537.1|2719016_2719304_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210532.1|2719415_2720867_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_032126195.1|2720908_2722345_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_155046713.1|2722639_2722804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275038.1|2722941_2723532_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2723477_2723843_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212074.1|2723869_2724091_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212072.1|2724177_2724375_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047032.1|2724404_2724638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212075.1|2724850_2725048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126197.1|2725161_2726115_+	DMT family transporter	NA	NA	NA	NA	NA
WP_054300271.1|2726255_2727230_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|2727340_2728402_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126201.1|2728423_2729170_-	lipoprotein	NA	NA	NA	NA	NA
WP_032126199.1|2729299_2729611_+	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_016211487.1|2729958_2730282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211494.1|2730306_2730762_-	arginine repressor	NA	NA	NA	NA	NA
WP_016211489.1|2730751_2731804_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_016211493.1|2731806_2733270_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211491.1|2733552_2733849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275036.1|2734109_2735171_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210915.1|2735300_2735765_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_032126715.1|2735962_2736778_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210906.1|2736906_2739219_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_051307343.1|2739338_2739866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210909.1|2740558_2741836_+	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_016210914.1|2741841_2742093_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.8e-20
WP_016210913.1|2742126_2742648_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_032126716.1|2742818_2743802_-	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210908.1|2743892_2744708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556458.1|2745599_2745833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2746208_2747270_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212580.1|2748005_2748356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2748443_2748809_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2748754_2749330_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211662.1|2749934_2751047_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_032126810.1|2751089_2751788_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211661.1|2752046_2753003_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_016211663.1|2753067_2753733_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_036776715.1|2753826_2754555_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211244.1|2754956_2755652_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_016211242.1|2755605_2756574_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_129556456.1|2756617_2757367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211238.1|2757568_2759062_-	amino acid permease	NA	NA	NA	NA	NA
WP_129556626.1|2759504_2760893_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211235.1|2761322_2761760_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_054300202.1|2762254_2762983_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211644.1|2763124_2763391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211639.1|2763505_2763808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126808.1|2763815_2764025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211640.1|2764187_2764790_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211645.1|2764821_2765571_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	28.2	2.4e-09
WP_016211641.1|2765593_2766049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556455.1|2766053_2766656_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211642.1|2766956_2767310_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_016211646.1|2767302_2767542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|2767911_2768748_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2768759_2769032_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275032.1|2769082_2769892_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	1.1e-15
WP_075275029.1|2770635_2771364_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	9.6e-43
WP_129556454.1|2771532_2773545_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_080728351.1|2773808_2773967_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211807.1|2773854_2774076_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275025.1|2774325_2776341_+	DUF1561 family protein	NA	NA	NA	NA	NA
2777629:2777688	attL	GAGGCACACGTTTGACGAAAGTGGGGCCTCAGCCGTTTGGCGATCTGCGAGCCATACTCG	NA	NA	NA	NA
WP_036771330.1|2777856_2778831_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_032126150.1|2778929_2779163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212425.1|2779311_2779902_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	34.4	1.1e-20
WP_016212424.1|2780105_2780384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126738.1|2780376_2780649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126737.1|2780775_2781504_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211918.1|2782052_2783021_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_051307368.1|2783020_2784301_-	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_054300202.1|2784958_2785687_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_052047116.1|2786388_2786568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556453.1|2786712_2787144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273432.1|2787563_2788298_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_016212023.1|2788294_2789287_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_016212022.1|2789773_2789992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212021.1|2789991_2790591_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212024.1|2790587_2790836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300201.1|2791231_2791960_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
2791414:2791605	attR	CGAGTATGGCTCGCAGATCGCCAAACGGCTGAGGCCCCACTTTCGTCAAACGTGTGCCTCTTGGCGGTTAGATGAAACGTTGGTGAAAATTAAAGGTCGTTGGTATTACCTTTATCGAGCCATTGATAAATATGGCAATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCGATGCGCTT	NA	NA	NA	NA
WP_016212110.1|2792606_2793077_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	62.5	7.6e-33
WP_016212114.1|2793080_2793311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126479.1|2793307_2793661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126478.1|2793647_2793986_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.7e-24
WP_129556625.1|2793978_2794536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275021.1|2794750_2795692_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300201.1|2795759_2796488_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_075274955.1|2796787_2797762_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212306.1|2797797_2798328_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212310.1|2798357_2798813_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_129556598.1|2801362_2803876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211935.1|2804810_2807459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274958.1|2807907_2808969_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2808995_2809571_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2809516_2809882_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046755.1|2809953_2810130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556599.1|2810520_2811673_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 27
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	2924235	2967633	3149273	transposase,protease	Acanthamoeba_polyphaga_lentillevirus(14.29%)	41	NA	NA
WP_016209259.1|2924235_2925084_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_016209274.1|2925200_2926112_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_075274963.1|2926830_2927892_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212454.1|2928111_2928792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211192.1|2929580_2930939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211189.1|2930983_2931442_-	NfeD family protein	NA	NA	NA	NA	NA
WP_016211187.1|2931466_2932387_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_016211186.1|2932513_2933296_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.3	8.2e-32
WP_016211190.1|2933385_2934885_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_016211188.1|2935206_2937090_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_075273298.1|2937163_2937739_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2937684_2938050_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211157.1|2938614_2939271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211161.1|2939378_2940488_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|2940499_2941144_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|2941162_2942149_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|2942228_2943305_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|2943507_2944332_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|2944648_2945653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|2945861_2946827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274965.1|2946965_2947841_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2948137_2949190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049173.1|2949511_2949886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2950099_2950591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2950646_2951897_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2951999_2952218_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_052104629.1|2952660_2953686_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080728341.1|2954135_2954306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212561.1|2954277_2954418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210728.1|2955332_2955803_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2956091_2957471_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2957498_2957957_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2957934_2959152_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2959343_2959580_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2959593_2959749_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2959829_2960792_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2960951_2962268_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2962277_2962946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2963308_2965123_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_129556601.1|2965240_2966017_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_052104629.1|2966607_2967633_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP038913	Piscirickettsia salmonis strain Psal-010a chromosome, complete genome	3149273	2999318	3116745	3149273	transposase,tRNA	Staphylococcus_phage(33.33%)	113	NA	NA
WP_054300271.1|2999318_3000293_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|3000368_3001388_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047000.1|3001435_3001582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047001.1|3001786_3001972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274966.1|3003987_3005049_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211201.1|3005129_3005438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211206.1|3005552_3006869_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664857.1|3007330_3008617_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211205.1|3008689_3009586_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211203.1|3009672_3010671_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032126430.1|3010779_3011304_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_129556668.1|3011551_3012790_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_016212222.1|3013337_3013811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|3013807_3014203_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|3015132_3015708_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|3015653_3016019_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211610.1|3016283_3018614_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_129556603.1|3018734_3020750_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075274967.1|3020933_3024326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|3024390_3024696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274968.1|3024865_3025966_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049897.1|3026213_3027470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209721.1|3028408_3029806_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.3e-77
WP_051307313.1|3029925_3030873_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|3030869_3031385_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|3031371_3032571_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|3032567_3032891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|3032892_3034122_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|3034121_3035165_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|3035164_3035848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3035844_3038334_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3038350_3038605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3038605_3038962_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|3039741_3040905_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|3040924_3044032_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|3044033_3045539_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3045566_3045848_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3045996_3046338_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3046457_3048338_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_059372650.1|3048422_3050021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3050038_3051154_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|3051281_3052280_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209700.1|3052283_3053042_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3053043_3054243_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3054226_3054898_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3054919_3055696_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3055699_3056698_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3056699_3057278_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3057274_3058744_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3058787_3059075_-	trp operon repressor	NA	NA	NA	NA	NA
WP_016209699.1|3059275_3059872_+	DMT family transporter	NA	NA	NA	NA	NA
WP_075274970.1|3060081_3060552_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|3060608_3060764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274971.1|3060908_3061361_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3061546_3061768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212371.1|3061883_3062516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274972.1|3062493_3063555_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211865.1|3063994_3064534_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|3064618_3065155_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|3065806_3066109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|3066558_3066867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556607.1|3067475_3067925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|3068207_3068918_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|3069144_3069543_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_016211231.1|3070410_3071361_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3071360_3073439_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3073586_3074102_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3074110_3074674_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3074654_3075401_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3075540_3075993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|3076416_3077253_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3077249_3078146_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3078178_3079246_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3079264_3079633_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3079658_3081107_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3081116_3082496_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3082536_3083868_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|3083839_3084799_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3084891_3085395_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3085529_3086681_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3086677_3087157_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3087303_3089625_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3089569_3090196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3090200_3091100_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3091172_3091751_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3092051_3092309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556611.1|3092317_3093471_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155049899.1|3094155_3094299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046758.1|3094607_3094739_+	phosphatase	NA	NA	NA	NA	NA
WP_155046759.1|3094883_3095039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212051.1|3095366_3096140_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126148.1|3096681_3096864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3097467_3098442_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3099536_3099875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212337.1|3099891_3100602_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_051307375.1|3100589_3100781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|3100942_3101242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|3101231_3101396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|3101452_3101818_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3103122_3103818_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3103814_3105242_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3105267_3105531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3105891_3106866_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556612.1|3106924_3107775_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|3107812_3108157_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3108153_3108990_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3108990_3109332_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3109333_3109939_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3109935_3111930_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3111949_3112891_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211292.1|3113118_3114543_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|3115055_3116030_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3116088_3116745_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP038914	Piscirickettsia salmonis strain Psal-010a plasmid unnamed1, complete sequence	108847	2892	102210	108847	protease,integrase,transposase	Streptococcus_phage(27.27%)	116	84782:84841	101093:101473
WP_054300202.1|2892_3621_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212168.1|3589_5278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275149.1|5621_6596_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.9e-25
WP_129556703.1|6821_7310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211956.1|7367_8096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211955.1|8552_9533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|9678_10407_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126843.1|10710_10890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126844.1|11108_11405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212118.1|11499_11961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|12879_13854_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_075274955.1|15229_16204_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_129556704.1|16697_17027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212122.1|17903_18605_+	ParA family protein	NA	J9Q7R7	Salmonella_phage	31.8	1.1e-19
WP_016212121.1|18558_19482_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_032126205.1|19915_20281_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556705.1|20226_20727_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	28.0	9.9e-07
WP_036771330.1|20785_21760_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_054300162.1|22272_23355_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212255.1|23541_23712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126838.1|23708_23912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212257.1|24248_24473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212260.1|24492_24765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|24922_25897_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_129556717.1|26551_27778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|28103_28940_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_016212398.1|29202_29664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047268.1|29830_30211_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|31011_31377_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|31322_31898_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_129556702.1|32881_34035_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075275159.1|34055_34763_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	32.0	3.8e-12
WP_129556701.1|35171_35696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126739.1|35942_36275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728342.1|36589_37093_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054300148.1|37132_38194_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|38299_38755_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_129556700.1|38714_38960_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377694.1|39136_39865_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_016212413.1|40198_40627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923775.1|40674_41415_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	4.6e-08
WP_032126346.1|41481_41724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273798.1|41815_42040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307367.1|42148_42673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211872.1|42793_43597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126138.1|44151_44415_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_016211871.1|44980_45316_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_129556699.1|45309_45510_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_054300590.1|45817_46042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|46071_46800_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_059372613.1|46905_47532_-	hypothetical protein	NA	A0A222ZGQ4	Arthrobacter_phage	33.7	1.8e-21
WP_016212412.1|47832_47997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|47989_48439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|48686_48860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212499.1|49064_49439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|50437_50731_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_081377914.1|50847_51177_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081377915.1|51321_51879_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	2.9e-47
WP_075273786.1|51887_52286_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211913.1|52718_53840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|54165_54438_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_032126795.1|54441_54702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211912.1|54974_55565_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
WP_129556698.1|55654_56356_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_098082791.1|56364_56667_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.6	8.6e-14
WP_081377916.1|56871_57396_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.4	2.5e-29
WP_075275158.1|57512_57806_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051307374.1|57920_58397_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_016212298.1|58637_58964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|59405_60134_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_081007042.1|60738_61554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211897.1|61947_62352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|62351_63098_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211895.1|63606_64665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126360.1|64787_65522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|65728_66304_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|66249_66615_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211773.1|67067_67742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211775.1|67843_68212_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_098082839.1|68379_68580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|68665_69394_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212152.1|69863_70247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|70553_70931_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_032126739.1|71095_71428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|71380_71533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085000.1|71616_72198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212019.1|73209_73905_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_016212018.1|74061_74361_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|74357_74603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212017.1|74632_75031_-	hypothetical protein	NA	W8VUR5	Pseudomonas_phage	38.8	2.3e-06
WP_016212014.1|75325_75739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275144.1|75836_76568_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_033923779.1|76600_77437_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|77448_77721_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962623.1|77865_79018_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556707.1|79647_80667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|81026_82001_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_051307371.1|82818_83433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212139.1|83404_83650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212137.1|83725_84787_+	hypothetical protein	NA	NA	NA	NA	NA
84782:84841	attL	CTGTAAAACTCCAGATATGATCTGACAAGCTTAAATCATCTGACAACATTTGTCTGATTG	NA	NA	NA	NA
WP_075274931.1|85230_85959_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.4e-38
WP_075274822.1|86159_87134_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016211890.1|87539_90116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|90319_91048_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046765.1|91934_92129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|92240_92969_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126832.1|93079_93988_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_054300202.1|94232_94961_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211886.1|95749_96178_+	nucleotidyltransferase substrate-binding, HI0074 family protein	NA	NA	NA	NA	NA
WP_016211884.1|96174_96474_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_129556706.1|96564_97194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211885.1|97207_98248_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_033923686.1|98356_99406_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212150.1|99462_99777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212151.1|99800_100763_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054300162.1|101127_102210_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
101093:101473	attR	CTGTAAAACTCCAGATATGATCTGACAAGCTTAAATCATCTGACAACATTTGTCTGATTGATCAGACTGTCAGATTGCACATTTTTATTGATTATTTTTTCTTGTGCTAAATGTTTTGAGTCCTGAAATGTTTGCATTGGTGTTTTTCCATAACAGTATTTCCCAGAATGTGGCCGATGCTGATTGTACTTTATCAACCACTCATCAACATCAACTTGCAGCTCCTCAAGTGAATTATAGACTTTTTTACGAAAAGCAATGTCATAAAACTCTTGTTTCATCGTGCGATGAAAGCGTTCACAAATACCATTTGTTTGAGGTGAACGGGCTTTTGTTCTGGTGTGATCTACATCTTCGATCGCTAAATAAAGCTGATAAGCG	NA	NA	NA	NA
>prophage 1
NZ_CP038915	Piscirickettsia salmonis strain Psal-010a plasmid unnamed2, complete sequence	79942	4824	28863	79942	transposase	Streptococcus_phage(16.67%)	33	NA	NA
WP_075273327.1|4824_5400_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|5345_5711_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212400.1|5761_6361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212399.1|6360_6621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|6750_7903_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212392.1|7931_8939_-	hypothetical protein	NA	W6E8G0	Rhizobium_phage	26.4	1.2e-06
WP_075273802.1|9002_9731_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.5e-37
WP_016212131.1|9914_10262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212135.1|10700_11885_+	3-methylitaconate isomerase	NA	NA	NA	NA	NA
WP_075275202.1|12128_12830_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	6.0e-10
WP_075275201.1|12832_13561_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_016212164.1|13689_14718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211443.1|15741_16428_+	Fic family protein	NA	NA	NA	NA	NA
WP_016211439.1|16431_16986_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	40.6	1.0e-20
WP_016211436.1|17030_17969_+	fic/DOC family protein	NA	S4TP71	Salmonella_phage	37.2	5.2e-25
WP_016211434.1|17941_18133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211445.1|18310_18661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211437.1|18677_19304_-	zinc-ribbon domain-containing protein	NA	A0A1S5XYQ1	Kurlavirus	28.2	4.4e-12
WP_155049210.1|19310_19736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211440.1|19713_20628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211444.1|20897_21404_+	antirestriction protein ArdA	NA	A0A222YZE5	Mycobacterium_phage	33.7	2.8e-17
WP_051307358.1|21552_21936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556729.1|22219_22450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212541.1|22436_22661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212539.1|22720_22870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|22866_23841_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212090.1|23884_24064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212087.1|24063_24492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126714.1|24659_25199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212089.1|25435_25666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126713.1|25764_26802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|27271_28297_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275198.1|28323_28863_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	40.2	8.4e-12
>prophage 2
NZ_CP038915	Piscirickettsia salmonis strain Psal-010a plasmid unnamed2, complete sequence	79942	37206	57887	79942	capsid,terminase,tail,protease,head,portal	Pseudomonas_phage(11.76%)	29	NA	NA
WP_129556725.1|37206_37887_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	39.3	3.3e-37
WP_016210977.1|38065_38359_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_129556724.1|38576_38759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046773.1|38903_39083_-	phosphatase	NA	NA	NA	NA	NA
WP_016212235.1|39129_39495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126134.1|39795_40179_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	5.6e-26
WP_016212234.1|40266_40746_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_016212231.1|40749_40959_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	43.1	1.3e-08
WP_080743047.1|40974_41331_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	61.3	5.4e-23
WP_081377926.1|41349_42432_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	1.2e-89
WP_016211136.1|42428_43670_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	46.0	3.1e-86
WP_080664855.1|43617_44289_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.8	3.0e-43
WP_016211140.1|44346_45540_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_016211133.1|45660_46995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211137.1|47185_47497_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_016211132.1|47493_47817_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211139.1|47809_48205_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211129.1|48201_48552_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211141.1|48551_48974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126913.1|48975_49299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|49355_49622_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_032126912.1|49625_51704_+	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	33.0	2.5e-56
WP_016210657.1|51696_52038_+|tail	phage minor tail family protein	tail	NA	NA	NA	NA
WP_016210666.1|52034_52706_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|52674_53421_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_016210665.1|53410_53968_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_016210662.1|53974_54262_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	2.5e-15
WP_016210670.1|54251_54506_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_016210653.1|54599_57887_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	33.5	5.2e-112
>prophage 1
NZ_CP038916	Piscirickettsia salmonis strain Psal-010a plasmid unnamed3, complete sequence	35470	14423	22146	35470	integrase,transposase	unidentified_phage(33.33%)	10	8028:8087	21468:21659
8028:8087	attL	TTATTCCGGTGAGATTATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTA	NA	NA	NA	NA
WP_129556741.1|14423_15095_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.4	3.4e-10
WP_052133268.1|15116_15398_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	38.7	8.3e-11
WP_016212274.1|15470_15935_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_032126154.1|15945_16140_-	addiction module toxin, HicA family	NA	A0A1X9I5T5	Streptococcus_phage	48.4	2.8e-10
WP_032126152.1|16355_16946_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.8	1.4e-20
WP_129556740.1|17009_17378_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155046774.1|17589_17766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300579.1|17984_18986_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	1.3e-26
WP_016211990.1|19315_21388_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_129556739.1|21417_22146_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
21468:21659	attR	TTATTCCGGTGAGATTATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTACCGTGATCTCAAAGAAATAGCAGCTGAAAGAGGTCTTGAGATTGAGCGTTCAACCATTTGTCGTTGGGTGCACGAGTATGGCTCGCAGATCGCCAAACGGCTGAGGCCCCACTTTCGTCAAACGTGTGCCTC	NA	NA	NA	NA
