The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	45566	89679	3152175	transposase	Moraxella_phage(16.67%)	46	NA	NA
WP_129556427.1|45566_46142_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46087_46453_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211193.1|46651_47413_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_016211195.1|47714_49241_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49612_50452_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50491_51799_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51773_52943_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|52997_53723_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54001_54391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54550_55456_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55531_55675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274979.1|55722_56562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049098.1|56554_56893_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_155046698.1|57068_57230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|57346_57640_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_016210704.1|58534_60481_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|61135_64198_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|64194_65259_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|65614_66568_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|66599_67763_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|67768_68368_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|68555_69056_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|69073_70162_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|70588_71833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|71829_72672_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_016211096.1|72651_73461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|73639_73867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|73867_74818_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|74873_75425_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|75551_75974_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|75966_76713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|76755_77454_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|77464_78289_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|78618_78987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274980.1|78981_80043_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|80092_80323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|80452_81667_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|81967_83029_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_016211249.1|83042_84770_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_016211245.1|84803_85535_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|85534_86323_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211251.1|86427_87051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|87370_87583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273383.1|87738_88311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046699.1|88515_89088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274981.1|89082_89679_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	136473	178470	3152175	transposase	Staphylococcus_phage(50.0%)	46	NA	NA
WP_054300271.1|136473_137448_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|137949_139362_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|139854_140862_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|140881_142402_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_129556430.1|142458_142665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211018.1|143640_144957_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|145060_145444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|145578_148644_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|148712_149816_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|149839_150394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|150508_151078_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211020.1|151197_151953_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_054300545.1|152119_153181_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_098082829.1|153575_153971_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|153992_154358_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|154414_154579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|154568_154868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|155120_155486_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|155431_156007_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212607.1|156007_156364_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|156452_157028_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|156973_157339_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|157818_158385_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|158396_159182_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|159813_160737_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|160788_161784_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|161815_162310_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_032126724.1|162401_162659_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|162748_163171_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|163489_164206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|164249_164501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556431.1|164514_165942_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|165969_167412_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|167499_167838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|167922_168453_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|168513_170706_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|170748_171234_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|171503_171935_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_016210245.1|171952_172783_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|172797_172941_-	lipoprotein	NA	NA	NA	NA	NA
WP_016210239.1|172971_173856_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|173827_174049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|174222_174501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|175471_176377_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016212383.1|176779_177898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|177894_178470_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	182276	239530	3152175	tRNA,tail,transposase,protease	Escherichia_phage(12.5%)	56	NA	NA
WP_075273327.1|182276_182852_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274985.1|182797_183163_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728339.1|183226_183499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212441.1|183766_183991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372761.1|185006_185456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|185519_186248_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016210779.1|186290_187220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210775.1|187512_188106_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_017377589.1|188074_188728_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016210784.1|188905_189877_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210782.1|189899_190796_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_016210786.1|190954_191401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210787.1|191397_192039_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016210789.1|192148_192727_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_016210776.1|193202_193640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047085.1|193964_195305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210785.1|195568_196963_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_075274986.1|198411_199479_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209863.1|199531_199954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209853.1|200194_200638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209873.1|200692_200950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209868.1|200927_201554_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_016209871.1|201631_203614_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|203823_205167_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|205433_208103_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|208126_210046_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|210215_211637_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|211782_212757_+	phospholipase A	NA	NA	NA	NA	NA
WP_016209855.1|212788_213184_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209859.1|213186_213408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|213571_215233_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|215305_215596_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_016209861.1|215821_216277_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|216341_216806_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|216898_218245_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|218244_219150_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|219211_220198_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|220190_220433_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|220554_222099_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_032126611.1|222145_223432_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|223474_224869_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|224892_225072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|225068_225644_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|225589_225955_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274988.1|226016_228251_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_016210079.1|228672_229170_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|229340_230036_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|230138_231701_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|232016_233810_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|233895_234168_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|234173_234800_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|234786_236217_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|236549_237605_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|237573_238251_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|238240_239077_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|239236_239530_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
>prophage 4
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	256927	302003	3152175	tRNA,transposase	Acinetobacter_phage(40.0%)	47	NA	NA
WP_075274991.1|256927_257503_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377888.1|257506_258067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556436.1|258122_259009_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046701.1|259035_259185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|259329_259530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|259577_260039_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|260462_261944_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|262006_263116_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|263213_265175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|265704_266109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|266161_267223_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046702.1|267348_267504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|270449_271602_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556437.1|271644_272067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274994.1|272336_273923_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_032126861.1|274126_274441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|274775_275662_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212538.1|275833_276274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210630.1|276803_277919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664846.1|277857_278544_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_032126366.1|278537_279515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210638.1|279553_280717_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210640.1|281181_281406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|281791_282079_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_016210633.1|282253_283009_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556439.1|283014_283470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210637.1|283445_283922_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210636.1|283928_285506_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_032126367.1|285509_286274_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016210629.1|286327_286864_+	tim44-like domain protein	NA	NA	NA	NA	NA
WP_016210634.1|286860_287592_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_032126368.1|287700_288855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275120.1|288999_289311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664872.1|289634_290615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211898.1|290856_291480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211899.1|291807_292101_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_105962625.1|292197_293084_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274996.1|293492_294593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126374.1|294701_295673_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728325.1|295704_296082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211609.1|296735_297044_+	double zinc ribbon family protein	NA	NA	NA	NA	NA
WP_032126373.1|297076_299263_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.0	2.7e-141
WP_016211605.1|299366_299600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211606.1|299816_300347_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_016211607.1|300375_300600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273369.1|300782_301598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300526.1|301706_302003_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	329578	375133	3152175	transposase	Hokovirus(33.33%)	45	NA	NA
WP_075273298.1|329578_330154_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210127.1|330206_331232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210128.1|331325_331589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|331955_332774_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|332846_335219_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_016210125.1|335931_337359_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|337393_338416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|338432_338810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210122.1|339651_340344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|340970_341945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|341934_343707_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|343707_344055_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_032126493.1|344304_345531_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|345620_346919_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664834.1|346952_347312_-	VUT family protein	NA	NA	NA	NA	NA
WP_080664833.1|347357_347702_-	VUT family protein	NA	NA	NA	NA	NA
WP_016210137.1|347682_348234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664832.1|348460_349759_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|349875_350166_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_155049101.1|350477_351719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556427.1|352131_352707_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|352652_353018_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212359.1|353753_353972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|354339_355314_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212044.1|355852_356107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|356829_357816_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|357953_358148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664870.1|358830_359478_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_033923850.1|359455_359893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211797.1|360054_361458_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|361508_362084_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|362029_362344_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556445.1|362384_363271_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126227.1|363909_364200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212008.1|364237_364936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212010.1|364952_365249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556446.1|365366_366518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273619.1|366790_367366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211273.1|367423_368257_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	29.0	3.5e-17
WP_016211268.1|368372_369557_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211271.1|369575_370520_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016211269.1|370824_371610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211272.1|371727_372096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211270.1|372323_373901_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_054300173.1|374071_375133_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	447745	550159	3152175	tRNA,transposase,integrase	Escherichia_phage(42.86%)	98	507616:507675	540795:541175
WP_075275004.1|447745_448609_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|448825_450385_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|450406_451441_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|451489_452059_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|452194_453166_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|453177_454755_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|454820_455807_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016210646.1|456138_457248_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|457353_458538_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|458615_460604_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|460812_460968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300511.1|461225_461525_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_075275005.1|461683_462019_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|462935_464342_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|464359_465346_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|465348_466503_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|466499_467195_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|467329_468820_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210494.1|468840_469890_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|469956_471351_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210489.1|472229_474161_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_075273353.1|474165_474696_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|474730_474925_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|474967_475327_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|475746_476742_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_032126132.1|476754_479136_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|479141_479429_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|479700_480177_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|480321_480519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|480643_481618_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|482518_482617_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210477.1|483101_484391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126626.1|484627_485320_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|485361_486135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|486136_487078_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|487210_488788_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|488997_490755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|491303_492062_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|492269_492842_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|492945_493494_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|493795_494041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|494069_494366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941726.1|494633_495557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556451.1|496035_496293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275008.1|496356_497085_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	3.3e-43
WP_098082828.1|497399_497657_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275009.1|497788_498496_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.8	1.3e-44
WP_075275011.1|498539_499268_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.2e-42
WP_032126799.1|499459_500272_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_129556452.1|501392_501740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049103.1|501742_503059_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300501.1|503008_503737_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|503748_504141_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|504137_504383_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300307.1|505486_506215_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_054300307.1|506821_507550_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
507616:507675	attL	GATAAATATGGCAATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCG	NA	NA	NA	NA
WP_016212268.1|508194_508779_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_016212269.1|508782_509466_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|509748_510477_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_052104629.1|510813_511839_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212159.1|511982_512180_-	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_016212158.1|512447_513362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275019.1|513471_514176_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	9.2e-43
WP_105962625.1|514139_515026_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211714.1|515400_518745_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_016211713.1|518777_519467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300201.1|519489_520218_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_075275021.1|520285_521227_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556625.1|521441_521999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126478.1|521991_522330_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.7e-24
WP_032126479.1|522316_522670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212114.1|522666_522897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212110.1|522900_523371_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	62.5	7.6e-33
WP_054300201.1|524017_524746_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_016212024.1|525141_525390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212021.1|525386_525986_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212022.1|525985_526204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212023.1|526690_527683_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_075273432.1|527679_528414_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_129556453.1|528833_529265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047116.1|529409_529589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|530290_531019_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_051307368.1|531676_532957_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_016211918.1|532956_533925_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_032126737.1|536436_537165_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_036781387.1|537365_537638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|537630_537909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212425.1|538112_538703_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	34.4	1.1e-20
WP_032126150.1|538907_539141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|539239_540214_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_075275025.1|541729_543745_-	DUF1561 family protein	NA	NA	NA	NA	NA
540795:541175	attR	GATAAATATGGCAATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCGATGCGCTTTTTCAAAAAGGCAATCGCCCAACCTTATGTGAAATCACCGCGTGTTGTGAATGTCGACAAGCACGCTTCATTTCCACCCGCTCACCAAAAAGCCAAAGATGAAGGTCTCTTTTCTAGTCAGTGTAAACTCAGGCGAGTGAAGTATTTAAACAACTGCATTGAAAATGATCACAAAGCGGTAAAGCGCAAATCCCGTTTCCGCCAATGGTACCAATCACTTTCTACAGCACGGCCTACCATTGACATAATGGAAGCGATGCGCATGGTTCAAAAAGGTCAATTACGTTATATTAAAAAACAGAATATCTGTGCC	NA	NA	NA	NA
WP_016211807.1|543994_544216_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728351.1|544103_544262_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556454.1|544525_546538_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_075275029.1|546706_547435_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	9.6e-43
WP_075275032.1|548178_548988_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	1.1e-15
WP_032126239.1|549038_549311_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|549322_550159_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
>prophage 7
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	555087	612586	3152175	tRNA,transposase	Escherichia_phage(22.22%)	60	NA	NA
WP_054300202.1|555087_555816_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211235.1|556310_556748_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_155049105.1|556810_557008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556626.1|557177_558566_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211238.1|559008_560502_+	amino acid permease	NA	NA	NA	NA	NA
WP_129556456.1|560703_561453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211242.1|561496_562465_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_016211244.1|562418_563114_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_036776715.1|563515_564244_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211663.1|564337_565003_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211661.1|565067_566024_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_032126810.1|566282_566981_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211662.1|567023_568136_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_075273327.1|568740_569316_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|569261_569627_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212580.1|569714_570065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|570800_571862_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556458.1|572237_572471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210908.1|573362_574178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126716.1|574268_575252_+	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210913.1|575422_575944_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_016210914.1|575977_576229_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.8e-20
WP_016210909.1|576234_577512_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_051307343.1|578204_578732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210906.1|578851_581164_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_032126715.1|581292_582108_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210915.1|582305_582770_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275036.1|582899_583961_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211491.1|584221_584518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211493.1|584800_586264_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211489.1|586266_587319_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_016211494.1|587308_587764_+	arginine repressor	NA	NA	NA	NA	NA
WP_016211487.1|587788_588112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|588459_588771_-	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_032126201.1|588900_589647_+	lipoprotein	NA	NA	NA	NA	NA
WP_054300148.1|589668_590730_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|590840_591815_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126197.1|591955_592909_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016212075.1|593022_593220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047032.1|593432_593666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212072.1|593695_593893_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212074.1|593979_594201_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|594227_594593_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275038.1|594538_595129_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046713.1|595266_595431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126195.1|595725_597162_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016210532.1|597203_598655_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016210537.1|598766_599054_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|599243_600287_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210536.1|600302_601202_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210528.1|601198_601717_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210527.1|601786_602404_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016210531.1|602413_603901_+	ribonuclease G	NA	NA	NA	NA	NA
WP_016210534.1|603910_607591_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_016210535.1|607664_608477_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210530.1|608473_609154_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_081007010.1|609994_610615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|610664_610955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275039.1|611758_612253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007066.1|612247_612586_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	635015	735644	3152175	plate,transposase,protease,tRNA	Prochlorococcus_phage(17.65%)	104	NA	NA
WP_016209523.1|635015_636365_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209510.1|636415_636853_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209501.1|637114_638626_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_032126188.1|638631_639858_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|639851_640880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|640857_641550_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_016209516.1|641554_643024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556464.1|643013_643505_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_051307310.1|643510_644983_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032126187.1|644982_645381_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016209524.1|645377_647066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209506.1|647047_648004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|648046_648562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|648666_649599_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209534.1|649818_650205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209530.1|650221_650866_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209504.1|651046_651886_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_016209502.1|651961_652564_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209512.1|652564_653419_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209537.1|653775_654087_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209519.1|654111_655503_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|655658_656390_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_129556465.1|656386_656959_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|656945_657503_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_016209498.1|657508_658489_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209539.1|658628_659429_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_036780687.1|659432_660200_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209535.1|660196_660661_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_016209507.1|660683_661337_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209517.1|661340_661688_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209505.1|661721_661973_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|662047_663316_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209527.1|663318_664077_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209508.1|664138_665029_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|665079_665763_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_075273445.1|665848_666106_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_075275046.1|666378_668592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210408.1|668583_669456_-	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_016210409.1|669623_671453_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210411.1|671616_672258_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_075273448.1|672499_673030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|673047_673221_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_016210402.1|673279_674329_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210405.1|674335_675286_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210406.1|675339_676284_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210415.1|676311_677049_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|677137_677380_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|677454_678678_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210400.1|678709_679558_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210401.1|679554_680607_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_032126181.1|680727_681348_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_036780649.1|681363_682350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080743011.1|682460_682916_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556469.1|682875_683184_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|683977_684883_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075275050.1|684958_685654_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275052.1|685798_686308_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212599.1|686357_686567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|687801_688248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|688251_688827_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275054.1|688772_689138_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126651.1|689258_689444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209899.1|689547_690582_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|690578_691289_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209923.1|691763_692282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209901.1|692399_692732_-	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_016209920.1|692761_695716_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_016209912.1|695761_696259_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_155049110.1|696318_696741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209915.1|696826_697687_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126652.1|697769_698336_+	chorismate lyase	NA	NA	NA	NA	NA
WP_016209918.1|698368_699223_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_016209914.1|699264_702171_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|702231_702429_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209903.1|702435_703446_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209910.1|703442_704501_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_032126655.1|704494_705295_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209913.1|705297_706116_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209907.1|706127_707075_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_032126654.1|707082_708384_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209919.1|708562_709666_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_016209906.1|709662_710055_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209924.1|710066_711443_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209900.1|711436_712906_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_016209916.1|713097_714069_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	3.7e-34
WP_129556470.1|714305_715192_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|715491_715737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126800.1|716285_717020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|717144_718206_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940948.1|718528_719233_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210599.1|719326_720040_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016210601.1|720122_721214_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210603.1|721285_721867_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210606.1|721872_722499_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210609.1|722595_723531_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_129556471.1|723890_724562_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210598.1|724703_725363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210607.1|725531_726791_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210611.1|726787_727873_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210605.1|727865_728747_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210612.1|728735_729986_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_075275125.1|731577_732621_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|734757_735123_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|735068_735644_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	771062	817748	3152175	tRNA,transposase	Staphylococcus_phage(28.57%)	39	NA	NA
WP_016209374.1|771062_772514_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209368.1|772549_774079_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_016209380.1|774654_775077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556473.1|775209_776298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126585.1|776839_777760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209384.1|778110_778926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209395.1|779217_781908_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_080664814.1|782156_783377_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|783544_785251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209398.1|785849_787076_+	MFS transporter	NA	NA	NA	NA	NA
WP_075274832.1|787658_788633_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_075273456.1|788755_789055_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|789014_789470_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212416.1|789471_790002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212417.1|790125_790371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|790421_790787_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|790732_791308_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052047106.1|791381_791858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|792573_792939_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|792884_793460_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300173.1|793486_794548_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556627.1|794600_795206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211819.1|795424_795655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|795951_796452_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211818.1|796654_797911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211822.1|798267_798681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|798990_800052_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275065.1|800351_801026_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.9e-10
WP_016212172.1|801916_803389_+	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_054300271.1|803408_804383_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210742.1|804533_804809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|804974_805595_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_016210737.1|805913_807890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210739.1|808045_809503_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210743.1|809571_811152_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_016210744.1|811192_811678_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210746.1|811774_815671_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210741.1|815677_816001_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_054300173.1|816686_817748_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	834435	888690	3152175	transposase,protease	Staphylococcus_phage(15.38%)	45	NA	NA
WP_033923708.1|834435_835311_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211687.1|835566_836211_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211685.1|836241_838047_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|838070_838646_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556476.1|838992_840003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|840098_841073_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016209640.1|841491_842511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209649.1|842969_843935_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209646.1|843979_844555_-	VOC family protein	NA	NA	NA	NA	NA
WP_016209651.1|844585_845860_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126159.1|846486_847200_+	aldolase	NA	NA	NA	NA	NA
WP_016209641.1|847279_848017_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016209658.1|848137_849493_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_075273478.1|849669_850341_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209661.1|850456_851332_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_016209645.1|851935_853240_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|853352_853958_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|854039_855341_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_032126161.1|855408_857841_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209655.1|857944_858217_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_032126162.1|858320_860198_+	SurA domain-containing protein	NA	NA	NA	NA	NA
WP_016209643.1|860229_861114_+	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_016209657.1|861122_861518_-	CrcB family protein	NA	NA	NA	NA	NA
WP_016209662.1|861945_864093_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209652.1|864064_865414_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209642.1|865410_867531_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209656.1|867527_869231_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_155049178.1|869349_870492_-	galactokinase	NA	NA	NA	NA	NA
WP_016209659.1|870556_871585_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_129556477.1|871744_873226_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_059372266.1|873315_873801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275067.1|874133_875201_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273512.1|875956_876301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|876437_877412_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126362.1|877583_877949_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051307360.1|878788_879718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780074.1|880809_881616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|881958_883851_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_032126157.1|884137_884542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049115.1|884767_885295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|885284_886171_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212436.1|886509_886920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556479.1|887133_887316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274918.1|887803_888169_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|888114_888690_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	894940	957975	3152175	transposase,integrase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(14.29%)	59	887300:887359	904584:905023
887300:887359	attL	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAA	NA	NA	NA	NA
WP_032126152.1|894940_895531_-|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016212424.1|895733_896012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|896004_896277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|896421_897504_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211300.1|897554_898595_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_129556480.1|899106_904596_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|904619_905594_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
904584:905023	attR	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTA	NA	NA	NA	NA
WP_016212302.1|905907_906207_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_129556481.1|906391_906823_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_054300162.1|907080_908163_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211579.1|908386_908872_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211583.1|908939_909848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211581.1|910124_910895_+	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.9	8.9e-31
WP_016211585.1|911013_911571_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_144019303.1|911629_912412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|912509_912863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|912929_913124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211578.1|913139_913484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|913841_914417_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|914362_914728_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275068.1|914812_915403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047108.1|915504_915903_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212107.1|916714_917851_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046716.1|918255_918402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|919099_919654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|920090_920273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210541.1|920337_920565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556629.1|920795_921542_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_026063577.1|921768_922062_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556482.1|922133_922739_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_016210545.1|922887_923865_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_032126547.1|923961_925404_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210553.1|925430_926084_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_016210552.1|926208_926775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307331.1|927129_928908_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_016210542.1|928979_930686_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.9	2.5e-25
WP_054300262.1|930677_930968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307332.1|931015_931222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|931430_931796_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273371.1|931741_932317_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212461.1|932320_932695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275071.1|933070_934045_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_054300264.1|934147_934486_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_054300265.1|934630_934891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556469.1|934850_935159_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556484.1|935660_937121_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_016211426.1|937464_938907_+	MFS transporter	NA	NA	NA	NA	NA
WP_075273490.1|939889_941182_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_054300148.1|941422_942484_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556485.1|942636_945195_+	HAD-IC family P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	30.6	6.3e-73
WP_032126554.1|945214_946300_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_016210417.1|946741_947179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210423.1|947175_948060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210416.1|948149_948680_+	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_016210420.1|948750_949929_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.1	2.0e-50
WP_016210425.1|950077_953926_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_016210422.1|953912_955415_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_016210418.1|955965_956601_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_054300173.1|956913_957975_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	961849	1065041	3152175	tRNA,transposase	uncultured_Mediterranean_phage(11.11%)	111	NA	NA
WP_075275075.1|961849_962911_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007012.1|962905_963076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|963065_963230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|963286_963652_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300269.1|963673_964042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210898.1|964953_965304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|965392_965683_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210894.1|966157_966460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210897.1|966800_967781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556487.1|967859_969197_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210903.1|969315_969687_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_016210904.1|969907_970558_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210896.1|970600_971683_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210899.1|971736_973620_+	APC family permease	NA	NA	NA	NA	NA
WP_032126790.1|974119_975025_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075275077.1|975109_975946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212218.1|976090_976441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|977890_978952_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|979077_980160_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_032126801.1|980830_981340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275079.1|981387_982449_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556488.1|982597_983447_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126540.1|984596_985460_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|986340_986706_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|986651_987227_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|987457_987823_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|987768_988344_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126869.1|988864_989104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|989081_990143_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556489.1|990388_991585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|991588_992475_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212326.1|992700_992898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122941816.1|992984_993293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212323.1|993369_993642_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_075274676.1|993716_993914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211709.1|994072_994219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|996478_998515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664853.1|999238_1000981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049116.1|1000940_1002587_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_080664852.1|1002599_1003643_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|1003621_1004083_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_016211081.1|1004123_1005059_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211087.1|1005086_1006082_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_016211088.1|1006301_1007264_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126778.1|1007442_1007637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049117.1|1007872_1008673_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_081377357.1|1008757_1009159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212611.1|1009642_1009963_+	histidine kinase	NA	NA	NA	NA	NA
WP_075275084.1|1010010_1011072_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212519.1|1011146_1011527_+	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_052047081.1|1011797_1012235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212356.1|1012285_1013131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275086.1|1013108_1014107_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1014067_1014433_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1014378_1014954_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274822.1|1015323_1016298_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016212585.1|1016409_1016730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212621.1|1017024_1017429_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_075273327.1|1017425_1018001_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1017946_1018312_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126498.1|1018373_1018934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211126.1|1019066_1019456_-	lipoprotein	NA	NA	NA	NA	NA
WP_016211125.1|1019625_1020456_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211128.1|1020678_1021584_-	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211119.1|1021747_1022509_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_016211122.1|1022512_1023379_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032126499.1|1023475_1024087_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211118.1|1024465_1025713_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126500.1|1025849_1026566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275089.1|1026699_1027032_-	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	37.3	8.0e-05
WP_129556631.1|1027176_1027344_-	phosphatase	NA	NA	NA	NA	NA
WP_075275091.1|1028352_1028838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273307.1|1029108_1029519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300412.1|1029663_1029978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210280.1|1030214_1031309_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_016210284.1|1031390_1031912_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210276.1|1031966_1032443_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210275.1|1032498_1032801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210273.1|1032865_1033573_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210274.1|1033945_1034344_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_032126334.1|1034383_1034815_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_016210271.1|1034825_1035509_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_016210285.1|1035593_1037789_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_129556492.1|1037886_1038630_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210283.1|1038657_1039443_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_016210272.1|1039482_1040193_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210279.1|1040180_1041347_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210277.1|1041400_1042234_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210270.1|1042303_1045291_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210281.1|1045332_1046724_+	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_016210269.1|1046737_1047088_-	L,D-transpeptidase catalytic domain protein	NA	NA	NA	NA	NA
WP_032126362.1|1047125_1047491_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1047436_1048012_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080664860.1|1047975_1048413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211367.1|1048568_1049351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126330.1|1049498_1050458_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_032126331.1|1050512_1052522_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_016211366.1|1052577_1052865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126332.1|1053117_1054317_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_075273327.1|1054963_1055539_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1055484_1055850_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|1055983_1056847_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|1057077_1057371_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_144019383.1|1057778_1057997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126328.1|1058351_1058603_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211589.1|1058731_1059964_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_016211592.1|1059953_1060616_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_129556496.1|1060890_1062129_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_032126329.1|1062314_1062944_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211588.1|1063019_1063721_+	cyclase family protein	NA	NA	NA	NA	NA
WP_105962623.1|1063888_1065041_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 13
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	1094498	1137558	3152175	tRNA,transposase	Tupanvirus(28.57%)	40	NA	NA
WP_075275097.1|1094498_1095074_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1095019_1095385_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300408.1|1095435_1096092_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_080664854.1|1096428_1097010_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_032126179.1|1096967_1097219_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_016211113.1|1097248_1098574_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_016211112.1|1098629_1099277_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211115.1|1099469_1101422_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211114.1|1101554_1104485_+	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_075274672.1|1104850_1105444_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1105615_1105981_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1105926_1106502_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1106515_1106806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1106751_1107327_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212254.1|1107316_1108759_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016212252.1|1108796_1108955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212466.1|1109269_1109995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049121.1|1110220_1110571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211395.1|1110927_1111263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779999.1|1111178_1111610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211393.1|1111629_1113186_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_016211391.1|1113197_1113773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728317.1|1113839_1117205_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275098.1|1117395_1118325_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.1e-24
WP_129556498.1|1118837_1119446_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210596.1|1119442_1121383_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	3.1e-72
WP_016210594.1|1121518_1122172_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_016210595.1|1122348_1123527_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210588.1|1123894_1125220_+	fimV domain protein	NA	NA	NA	NA	NA
WP_032126176.1|1125310_1126093_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210587.1|1126194_1127055_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_016210590.1|1127229_1128492_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210593.1|1128571_1129102_+	colicin V production protein	NA	NA	NA	NA	NA
WP_016210586.1|1129123_1130629_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210592.1|1130641_1131298_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016212005.1|1131687_1133448_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_129556499.1|1134348_1135501_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_032126856.1|1135806_1136148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377901.1|1136208_1136919_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275102.1|1137099_1137558_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	1146392	1201014	3152175	tRNA,transposase	uncultured_Mediterranean_phage(36.36%)	51	NA	NA
WP_032126239.1|1146392_1146665_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1146676_1147513_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_129556510.1|1148036_1149140_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	7.3e-10
WP_054300405.1|1149241_1149742_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016209947.1|1150263_1150926_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_016209946.1|1150952_1152182_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209940.1|1152338_1155110_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_016209937.1|1155185_1155629_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209931.1|1155781_1157254_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_016209926.1|1157365_1158427_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209945.1|1158423_1159458_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209932.1|1159460_1160501_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209936.1|1160683_1161799_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.6	1.4e-93
WP_016209930.1|1161837_1162191_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_032126634.1|1162211_1164080_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209935.1|1164101_1165046_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_016209925.1|1165279_1165558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1165767_1166406_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209944.1|1166380_1167808_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209927.1|1168008_1168686_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209939.1|1168820_1170095_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209943.1|1170162_1170918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209948.1|1170969_1171887_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_016209929.1|1171995_1172889_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075274822.1|1174347_1175322_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016211771.1|1175614_1175803_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_016211770.1|1175816_1176950_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_075274823.1|1177149_1181160_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211827.1|1181423_1182044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1182375_1182729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1182942_1183137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|1183802_1184330_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300400.1|1184386_1184629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300399.1|1184773_1185040_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210885.1|1185381_1186263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|1186320_1186917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|1186949_1187723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|1188256_1188553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210888.1|1188575_1188827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210883.1|1188787_1189495_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210886.1|1189563_1190343_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_016210887.1|1190425_1191376_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210889.1|1191885_1194732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556636.1|1194749_1195058_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016212002.1|1196011_1196290_-	DNA-J related family protein	NA	NA	NA	NA	NA
WP_016212000.1|1196409_1197138_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016211998.1|1197268_1197832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211999.1|1197821_1198175_-	ras family protein	NA	NA	NA	NA	NA
WP_033923779.1|1198554_1199391_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1199402_1199675_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274825.1|1199952_1201014_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	1237828	1337964	3152175	tRNA,transposase	Bacillus_phage(15.0%)	93	NA	NA
WP_075274826.1|1237828_1238734_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1238990_1240262_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_016211218.1|1240286_1241024_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1241276_1242419_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1242435_1244037_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1244548_1244686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1244682_1245960_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|1246309_1246492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211682.1|1247181_1248864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211680.1|1248911_1251311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274826.1|1251541_1252447_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1252703_1253975_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_016211218.1|1253999_1254737_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1254989_1256132_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1256148_1257750_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1258261_1258399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1258395_1259673_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|1260022_1260205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049124.1|1260497_1260998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126846.1|1261165_1261771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212251.1|1261932_1262469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300384.1|1262630_1263446_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075274828.1|1263854_1265177_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	1.2e-11
WP_052133287.1|1265278_1265677_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212039.1|1265865_1266423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212040.1|1266599_1267949_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_054300162.1|1268152_1269235_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016210803.1|1269309_1270608_-	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_016210808.1|1270785_1271637_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_016210805.1|1271645_1272317_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_032126141.1|1272726_1274001_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016210804.1|1274065_1275985_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.0	4.5e-84
WP_032126139.1|1275991_1276921_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_033923779.1|1279589_1280426_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075274829.1|1280437_1280710_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1280733_1281708_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300382.1|1282108_1282531_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377858.1|1282749_1283460_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1283663_1284029_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|1284043_1284550_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211414.1|1284765_1285584_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|1285691_1286153_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211415.1|1286169_1287093_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211417.1|1287116_1288166_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_051307357.1|1288302_1288896_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211422.1|1288918_1289389_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_032126143.1|1289477_1290749_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_075274832.1|1290848_1291823_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_016211838.1|1292134_1292308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211840.1|1292778_1293243_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211839.1|1293401_1294874_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211841.1|1294991_1295444_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|1296303_1297365_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|1297667_1298750_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212483.1|1298760_1299558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1299554_1300130_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1300075_1300441_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300380.1|1300542_1301199_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556508.1|1301469_1301913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|1301974_1302268_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556507.1|1302384_1303071_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	48.3	5.5e-48
WP_075273327.1|1303060_1303636_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1303581_1303947_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212421.1|1304438_1304621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1305371_1306346_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556505.1|1306386_1307352_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211470.1|1308118_1308772_+	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_016211471.1|1308831_1310817_-	sodium/hydrogen exchanger family protein	NA	NA	NA	NA	NA
WP_032126343.1|1310947_1311760_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_032126344.1|1311880_1312969_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_016211467.1|1312971_1313538_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_075273298.1|1313612_1314188_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|1314133_1314499_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052047029.1|1314666_1315008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1315080_1316142_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032127044.1|1316345_1316546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|1317447_1317741_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556503.1|1318802_1319669_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	5.6e-58
WP_016210508.1|1319677_1321375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210507.1|1321695_1322244_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_075273576.1|1322371_1323100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|1323159_1326657_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_016210514.1|1326714_1327968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210515.1|1328076_1328979_-	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210512.1|1329032_1330070_-	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210506.1|1330205_1331444_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210510.1|1331436_1332165_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_081007040.1|1332195_1332852_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211831.1|1332989_1334717_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016211829.1|1335017_1335371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|1335786_1336287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047133.1|1336938_1337385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1337388_1337964_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	1358763	1397320	3152175	tRNA,transposase,protease	Klosneuvirus(28.57%)	33	NA	NA
WP_016210928.1|1358763_1359069_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_155046723.1|1359227_1359383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080728346.1|1360290_1360623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372539.1|1360640_1361504_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556501.1|1361536_1362112_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1362057_1362423_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211651.1|1362656_1364192_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016211650.1|1364316_1365801_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211648.1|1366460_1367000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144019283.1|1368218_1368410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126642.1|1368479_1368941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126641.1|1368976_1371547_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_016209840.1|1371654_1372140_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_016209844.1|1372312_1373353_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209835.1|1373330_1373813_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209848.1|1373809_1376404_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209832.1|1376710_1376974_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209831.1|1377252_1377951_-	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209841.1|1378170_1378365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209827.1|1378440_1380000_-	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_129556633.1|1380318_1381215_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209845.1|1381431_1382907_-	APC family permease	NA	NA	NA	NA	NA
WP_016209826.1|1383429_1384452_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_016209830.1|1384782_1386150_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209846.1|1386385_1386640_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126639.1|1386655_1387942_+	GTPase HflX	NA	NA	NA	NA	NA
WP_016209836.1|1387961_1389176_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_016209838.1|1389175_1390069_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209839.1|1390266_1391565_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209829.1|1392944_1395344_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209834.1|1395340_1396099_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209842.1|1396275_1396665_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_075273327.1|1396744_1397320_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	1428109	1473300	3152175	integrase,tRNA,transposase	Tupanvirus(28.57%)	45	1435905:1435964	1483710:1484064
WP_016211285.1|1428109_1428889_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_016211286.1|1428906_1429254_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_016211289.1|1429365_1429638_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211767.1|1430966_1431776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211764.1|1432326_1433148_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126803.1|1433348_1434581_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_081377862.1|1435067_1435904_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
1435905:1435964	attL	TCGTTTATCCTCTATATCGGTAGCTTTTTTTCCACAACATCTTTCAAAGCCTCAATTTCT	NA	NA	NA	NA
WP_032126239.1|1435915_1436188_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211806.1|1436977_1437703_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_016211805.1|1437745_1439284_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211804.1|1439290_1440676_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
WP_032126599.1|1441370_1442714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212498.1|1443353_1444037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273555.1|1444314_1444848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210332.1|1444978_1445722_-	ribonuclease T2 family protein	NA	NA	NA	NA	NA
WP_016210330.1|1445819_1446203_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210333.1|1446406_1447036_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_032126607.1|1447109_1448393_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_016210326.1|1448732_1450031_+	ankyrin repeats family protein	NA	NA	NA	NA	NA
WP_016210325.1|1450184_1451561_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210327.1|1451696_1453028_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210329.1|1453088_1453607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210321.1|1453655_1454624_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_129556511.1|1454820_1456257_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210323.1|1456439_1457150_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.7	6.3e-39
WP_032126606.1|1457061_1457583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210320.1|1457732_1458806_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_016210322.1|1458942_1459839_-	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016211334.1|1460456_1460645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211336.1|1460693_1461308_+	chorismate mutase	NA	NA	NA	NA	NA
WP_032126265.1|1461373_1462291_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016211328.1|1462614_1463076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082827.1|1463183_1464485_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.9	4.1e-28
WP_016211330.1|1464659_1465760_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_032126267.1|1466107_1466350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211335.1|1466343_1466661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664859.1|1466770_1467358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1467526_1467784_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774189.1|1467783_1468791_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_051307372.1|1468838_1469228_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016212275.1|1469343_1470327_+	MFS transporter	NA	NA	NA	NA	NA
WP_129556512.1|1470316_1470892_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300363.1|1470837_1471185_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212589.1|1471608_1472046_+	MFS transporter	NA	NA	NA	NA	NA
WP_129556637.1|1472520_1473300_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1483710:1484064	attR	AGAAATTGAGGCTTTGAAAGATGTTGTGGAAAAAAAGCTACCGATATAGAGGATAAACGAATGCTCGCTACTTACCTCAAAGATGAACATAAGCTAAGCCTCGTGGTTGCTTGTAATTTAGTCACTCTTCCAAGAGCAAGCTATTACCGAAAAAAACAGCATCAATCTGATAATGCTGAAATAATTTCAGAGCTAAAGACGTTAGCGAGCAAACACAAACGCTGGGGTTGCGACAAAATGGTCGCATATTTAAAAAACAAAGGTAAGCCTTGGAACCATAAGCGCATTCGTCGAGTCTATATTGAAATGGGCTTAAACATAAGCTGTAAACCAAAGCATCACTACGTCAAAAACG	NA	NA	NA	NA
>prophage 18
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	1482426	1531912	3152175	transposase,protease	Staphylococcus_phage(35.71%)	53	NA	NA
WP_054300271.1|1482426_1483401_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126239.1|1483485_1483758_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1483769_1484606_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_081377864.1|1484619_1484859_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211148.1|1484940_1486269_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|1486532_1487102_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211151.1|1487117_1487429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1487438_1488395_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1488507_1488861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211153.1|1488864_1489929_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211145.1|1489929_1491669_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211152.1|1491675_1492098_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211144.1|1492081_1492711_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075273474.1|1493267_1494242_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_075274844.1|1494422_1494674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1494682_1495519_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1495530_1495803_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556515.1|1495821_1496181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212558.1|1496158_1496455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046727.1|1497006_1497351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1497594_1498569_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075275108.1|1498545_1499151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556516.1|1499509_1500013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1500107_1500380_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1500391_1501228_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_080664876.1|1501540_1503403_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_081377865.1|1503761_1504046_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556638.1|1505390_1506071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273551.1|1506070_1506373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211974.1|1506472_1507594_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075274847.1|1507876_1508752_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212011.1|1508985_1510107_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_016212013.1|1510328_1510712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212012.1|1510727_1511405_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_054300271.1|1511641_1512616_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300271.1|1513263_1514238_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556517.1|1514635_1514923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1514941_1515778_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1515789_1516062_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274849.1|1516187_1516931_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212348.1|1516925_1518155_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_016211994.1|1519573_1520110_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_032126537.1|1520146_1520332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211991.1|1520572_1521478_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_129556518.1|1522386_1523784_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_081007034.1|1524069_1524354_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_080728343.1|1524335_1524476_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_016211561.1|1524557_1528424_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_016211564.1|1528589_1529465_+	ParA family protein	NA	NA	NA	NA	NA
WP_016211563.1|1529497_1529659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274852.1|1529869_1530313_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046728.1|1530441_1531416_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	6.8e-28
WP_052047138.1|1531678_1531912_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	1608845	1658355	3152175	transposase	Staphylococcus_phage(27.27%)	47	NA	NA
WP_075274858.1|1608845_1609931_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1610067_1610433_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1610378_1610954_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1611644_1612619_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1613173_1614235_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274822.1|1614332_1615307_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_129556523.1|1615642_1616528_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209772.1|1617547_1618099_-	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_016209778.1|1618117_1618492_-	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_016209796.1|1618522_1619740_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.0	2.9e-92
WP_080664823.1|1619763_1621164_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_016209795.1|1621144_1621900_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	1.3e-10
WP_016209793.1|1621940_1623389_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_032126436.1|1623404_1623860_-	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_016209771.1|1624566_1625289_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016209791.1|1625453_1626176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307317.1|1626312_1626606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209798.1|1626667_1628692_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_016209769.1|1628704_1629448_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_017377132.1|1629489_1629873_-	response regulator	NA	NA	NA	NA	NA
WP_016209784.1|1629959_1630682_-	RNA polymerase sigma factor FliA	NA	A0A1B1P7V3	Bacillus_phage	24.1	2.7e-05
WP_129556524.1|1630678_1631566_-	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_016209767.1|1631546_1633007_-	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_016209770.1|1633037_1635131_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_016209786.1|1635165_1636299_-	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_016209787.1|1636312_1637098_-	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_016209776.1|1637113_1637383_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_080664822.1|1637412_1638162_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_016209797.1|1638158_1638650_-	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_016209775.1|1638646_1639102_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_129556639.1|1639118_1639529_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209790.1|1639824_1640283_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209788.1|1640334_1641087_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016209785.1|1641208_1643152_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A1U9WQS3	Geobacillus_phage	23.9	1.1e-05
WP_016209794.1|1643197_1643821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377870.1|1644555_1645074_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	31.0	1.6e-07
WP_081007030.1|1645109_1646081_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051307341.1|1646774_1648373_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_016210848.1|1648539_1649724_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1650019_1650574_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210850.1|1650822_1652076_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210851.1|1652060_1652732_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210847.1|1652754_1653759_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_155049131.1|1653787_1655236_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210855.1|1655353_1656331_+	DMT family transporter	NA	NA	NA	NA	NA
WP_129556525.1|1656484_1657304_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1657380_1658355_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 21
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	1673206	1797591	3152175	tRNA,transposase,integrase	Staphylococcus_phage(12.5%)	111	1719656:1719715	1796637:1797600
WP_032126790.1|1673206_1674112_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1675073_1675412_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1675371_1675827_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126602.1|1675979_1677287_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211857.1|1677537_1678416_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_016211855.1|1678412_1678880_-	bacterioferritin	NA	NA	NA	NA	NA
WP_016211856.1|1679006_1679192_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_054300271.1|1679407_1680382_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556640.1|1680648_1681875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211351.1|1681950_1682289_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_032127067.1|1682285_1682888_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211349.1|1682884_1684879_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211350.1|1684942_1685881_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211352.1|1686559_1687000_+	universal stress protein	NA	NA	NA	NA	NA
WP_075273313.1|1687173_1687512_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1687471_1687927_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210793.1|1687928_1688609_+	OmpW family protein	NA	NA	NA	NA	NA
WP_016210801.1|1688931_1689903_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210795.1|1689884_1690856_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_051307339.1|1690961_1691768_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210791.1|1692142_1692343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210799.1|1692769_1693723_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_075274860.1|1694184_1694463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273540.1|1694629_1695241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210800.1|1695607_1696435_+	DsbA family protein	NA	NA	NA	NA	NA
WP_080750117.1|1696570_1698211_+	APC family permease	NA	NA	NA	NA	NA
WP_052047040.1|1698236_1699175_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1699244_1699502_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212463.1|1699923_1700343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211836.1|1701875_1702364_-	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_051307365.1|1702383_1702644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211834.1|1702900_1703215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664871.1|1703305_1704928_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.9	1.9e-27
WP_032126362.1|1705359_1705725_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1705670_1706246_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212185.1|1706339_1707329_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1707662_1707848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1708527_1710483_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016210749.1|1710781_1711243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210752.1|1711412_1712210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556641.1|1714586_1715849_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
1719656:1719715	attL	ATTATAGCGCTGGATTAACAGTTTCTGACATAATATCAGTAGGTTAAAAAATACAATAAG	NA	NA	NA	NA
WP_032126362.1|1719723_1720089_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1720034_1720610_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211454.1|1720750_1721221_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_016211452.1|1721971_1723459_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211455.1|1723520_1724978_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_122942091.1|1725083_1725479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211456.1|1725506_1726085_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_155049133.1|1726706_1726958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046732.1|1727172_1727343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274862.1|1727457_1728054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211726.1|1728225_1728819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211728.1|1729206_1731141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211725.1|1731179_1732094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|1733664_1733931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007023.1|1734007_1734664_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1734838_1735294_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1735253_1735592_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556531.1|1735554_1735752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211752.1|1735956_1737102_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211748.1|1737117_1738722_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211749.1|1738801_1739995_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_032126540.1|1740203_1741067_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212346.1|1741300_1741447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049135.1|1741671_1741818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274864.1|1744287_1745313_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047087.1|1745484_1745703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211462.1|1745863_1746844_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211465.1|1747471_1748455_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_016211464.1|1748605_1748953_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_032126752.1|1748949_1749552_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211466.1|1749639_1751160_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126753.1|1751229_1751694_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_032126362.1|1751786_1752152_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1752097_1752673_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212485.1|1753521_1754055_+	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_129556532.1|1754351_1754534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664820.1|1754842_1755013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209620.1|1754995_1758052_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209619.1|1758138_1759587_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209621.1|1760019_1761024_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209617.1|1761144_1761543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209627.1|1761582_1763406_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_033923701.1|1763402_1766705_+	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_016209616.1|1766735_1767650_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016209618.1|1767720_1768350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209632.1|1768394_1768829_-	lipoprotein	NA	NA	NA	NA	NA
WP_016209630.1|1768809_1769550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209625.1|1769563_1770961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209633.1|1770963_1773912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209614.1|1773911_1775633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209636.1|1775647_1776052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209631.1|1776052_1778926_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_075273639.1|1778928_1779645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209626.1|1780012_1781905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209637.1|1781936_1784474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274867.1|1784505_1785678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209624.1|1785674_1786286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209623.1|1786307_1787807_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016209615.1|1787823_1788330_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_155046733.1|1789571_1789709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046734.1|1789853_1789991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377829.1|1790646_1791381_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_129556535.1|1791825_1792711_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1792901_1793159_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377871.1|1793363_1794056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556536.1|1794058_1795212_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155049181.1|1795171_1795681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274873.1|1796185_1796683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1796704_1797070_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1797015_1797591_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
1796637:1797600	attR	ATTATAGCGCTGGATTAACAGTTTCTGACATAATATCAGTAGGTTAAAAAATACAATAAGGAAAAACGATGCCTTCTCCTTACAGTTATGACTTAAGAATTCGAGCACTAAAAATGATTGATGAAGGGATACCTATTACACAAATTTCCAAGCTCTTAAAAATCAGTCGAGACACTCTGCATCGTTGGAAAAATAGGCGTGATCATACAGGAGACGTCAAAGCAAGGTTTGGCTACCAAACGGGCTATAACCATAAAATCAGTGATATGAAAGAATTTCAAAAATTTATTGATCAGAATCCGGGTAAAACTCATCAACAACTCGCTGATCTTTACCCTGTAGAAATGAGTGCAAAAACCATGGGAGTGTGGATTAAAAAATTAGGCTATACCAGAAAAAAAAGAGCTTCAGATACCAAGAACGTGATGCATTAAAGCGGAAAGCTTTCCTGGAAAAAGTCGAGAAAATCGATAACGACAAAATTGTTTATATGGACGAAGCGGGTATGGATGATACTGAGCGTTACGCTTATGGCCACTCTGCTAAAGGTAAACGGTGCTATGCAGAGAAGCCAGGTAAAAAATCAATACGAATTAACTTTATAGGTGGTTTGCGCGGCAAGCAATTTATCGCACCAATGATGGTTGAAGGTTATTGCAATGCTAACGTTTGTCAGGCTTATATCGATCAGTGCTTAATTCCCTGTTTATCTCCTGGAGAGACTGTAATCATGGATAATGCCTCTTTTCACAAATCAAAAGGGGTTAAGGAAGCGATTGAAGATGCGGGTTGTCACTTATTATTTTTACCCCCTTATTCTCCTGATTTAAACCCGATAGAGCATGTATGGTCACCGCTTAAAAATAGGGTTCGCATGAAGCTTGATCAAGATGAAATAAATTTAGAGACAGCGCTTAGTCAAGTAATGAAGTCAATGTCAGAAACTATTCGTTGAGTGCTATAC	NA	NA	NA	NA
>prophage 22
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	1805054	1840094	3152175	transposase	Bodo_saltans_virus(20.0%)	36	NA	NA
WP_075273532.1|1805054_1805642_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126997.1|1805859_1806099_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_032126998.1|1806420_1806768_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_036774554.1|1806866_1807145_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1807197_1807485_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|1807488_1808375_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211346.1|1809524_1810166_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_016211340.1|1810193_1810415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211347.1|1810407_1811391_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211344.1|1811604_1812423_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211342.1|1812583_1814266_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.1e-32
WP_016211343.1|1814273_1815296_-	YHYH protein	NA	NA	NA	NA	NA
WP_016211341.1|1815494_1815665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1815809_1816784_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016211940.1|1816897_1817230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|1817350_1818610_-	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211214.1|1820372_1820936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211210.1|1821038_1822520_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016211213.1|1822526_1822733_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211211.1|1822781_1823861_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211215.1|1824052_1826023_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211212.1|1826383_1827943_+	APC family permease	NA	NA	NA	NA	NA
WP_075274875.1|1828225_1828528_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300307.1|1828574_1829303_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_075274876.1|1829389_1829716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211983.1|1829963_1830623_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556643.1|1830718_1832083_+	histidine kinase	NA	NA	NA	NA	NA
WP_016212551.1|1832540_1833035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|1833376_1833952_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1833897_1834188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1834201_1834777_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1834722_1835088_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211946.1|1836308_1837064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556540.1|1837282_1837678_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211947.1|1837670_1838816_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_075274878.1|1839218_1840094_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	1882784	1899151	3152175	transposase	Leptospira_phage(40.0%)	15	NA	NA
WP_032126239.1|1882784_1883057_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377873.1|1883068_1883905_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.9	4.6e-41
WP_016212058.1|1884547_1886098_-	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_075274880.1|1886253_1887219_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126239.1|1888214_1888487_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1888498_1889335_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_098082828.1|1889832_1890090_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|1890089_1891097_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212247.1|1891463_1892219_+	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|1892846_1893821_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300162.1|1894160_1895243_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212246.1|1895346_1896003_-	AT hook motif family protein	NA	NA	NA	NA	NA
WP_075274882.1|1896938_1897535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556544.1|1897649_1898006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1898068_1899151_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
>prophage 24
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	1943946	1985359	3152175	transposase,protease,integrase	Acinetobacter_phage(25.0%)	45	1934682:1934741	1981041:1981329
1934682:1934741	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_075274886.1|1943946_1945008_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274888.1|1945279_1945615_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081007004.1|1945619_1946075_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1946034_1946373_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046696.1|1946530_1946695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1946684_1946984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212209.1|1947439_1948441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556545.1|1948695_1949037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274890.1|1949241_1949922_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_098082828.1|1949991_1950249_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377874.1|1950417_1950885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049141.1|1951345_1952531_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.6e-58
WP_155046738.1|1952540_1952681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556547.1|1952957_1953518_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_054300287.1|1953926_1954256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1954277_1954643_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1954588_1955164_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274733.1|1955182_1955500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1955550_1956387_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1956398_1956671_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211421.1|1957529_1957754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|1957850_1958756_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016210013.1|1958941_1960609_-	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
WP_122941582.1|1960765_1961749_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_122941592.1|1961843_1962695_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_016210019.1|1962952_1963987_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_032126616.1|1964051_1964411_-	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210007.1|1964466_1965039_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210023.1|1965016_1967074_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210021.1|1967070_1968396_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210004.1|1968656_1969298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|1969497_1970253_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210027.1|1970642_1971239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210005.1|1971318_1974123_+	response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	2.4e-57
WP_016210012.1|1974103_1974775_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210009.1|1974850_1975057_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_016210025.1|1975049_1976420_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210020.1|1976684_1976840_-	putative membrane protein	NA	NA	NA	NA	NA
WP_016210016.1|1977440_1978400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273518.1|1978566_1978860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210017.1|1978935_1979319_-	hpt domain protein	NA	NA	NA	NA	NA
WP_016210010.1|1979494_1979671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556549.1|1982340_1983227_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
1981041:1981329	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGA	NA	NA	NA	NA
WP_016210524.1|1983765_1984296_-	exsB family protein	NA	NA	NA	NA	NA
WP_016210522.1|1984306_1985359_-|protease	protease SohB	protease	NA	NA	NA	NA
>prophage 25
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	2038478	2090644	3152175	tRNA,protease,transposase	Orpheovirus(18.18%)	52	NA	NA
WP_016209424.1|2038478_2039756_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
WP_016209433.1|2039855_2040230_-	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209412.1|2040314_2041202_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209436.1|2041259_2041988_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_129556555.1|2041984_2043115_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209444.1|2043245_2043674_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_032126508.1|2043768_2044128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209447.1|2044117_2045329_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016209421.1|2045325_2046114_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_016209411.1|2046276_2047071_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_054300271.1|2047276_2048251_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046761.1|2048677_2048851_+	phosphatase	NA	NA	NA	NA	NA
WP_075274901.1|2048995_2050009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2050012_2050312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2050301_2050466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2050522_2050888_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211553.1|2051227_2051968_-	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_016211549.1|2051971_2054476_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211548.1|2054738_2055695_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211550.1|2055678_2056440_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_075274903.1|2056517_2057393_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2057517_2057763_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_016211262.1|2057822_2060096_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_075273504.1|2060150_2060504_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211261.1|2060693_2060987_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_032126515.1|2061159_2061339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307354.1|2061414_2061990_-	DedA family protein	NA	NA	NA	NA	NA
WP_032126514.1|2062272_2063589_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2063599_2063968_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_016211265.1|2063998_2064661_-	adenylate kinase	NA	NA	NA	NA	NA
WP_032126362.1|2064835_2065201_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556556.1|2065146_2065722_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126519.1|2065889_2066609_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_016211478.1|2066588_2067404_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126518.1|2067420_2069622_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211474.1|2069704_2071054_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_016211473.1|2071128_2071728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211476.1|2071711_2071921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211931.1|2072238_2073426_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211932.1|2073621_2074911_+	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_054300152.1|2075321_2075687_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210558.1|2077323_2078079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210562.1|2078152_2079805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300273.1|2079833_2081372_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.2	5.1e-70
WP_016210560.1|2081371_2083072_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_081007068.1|2083160_2084336_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_016210559.1|2084374_2085337_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_016210566.1|2085697_2086120_-	universal stress protein	NA	NA	NA	NA	NA
WP_016210568.1|2086425_2087067_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_016210561.1|2087194_2088529_+	dihydroorotase	NA	NA	NA	NA	NA
WP_032126397.1|2088643_2089234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2089582_2090644_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	2098488	2143194	3152175	tRNA,transposase	Staphylococcus_phage(22.22%)	46	NA	NA
WP_129556558.1|2098488_2099382_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211040.1|2100045_2101257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211037.1|2101607_2102237_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211042.1|2102285_2103302_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211035.1|2103548_2103764_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211043.1|2103816_2104266_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211039.1|2104345_2106091_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211036.1|2106182_2108054_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_054300271.1|2108401_2109376_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211094.1|2109395_2109719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211091.1|2110783_2113264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211092.1|2113307_2114600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307348.1|2114835_2117592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211519.1|2118747_2119167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|2119167_2119869_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|2120129_2120336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941967.1|2120565_2120871_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126840.1|2121049_2123047_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2123030_2124077_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016212098.1|2124784_2125636_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016212100.1|2125636_2126557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212654.1|2126967_2127252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377876.1|2127243_2127699_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2127658_2127997_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212093.1|2128209_2129139_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_129556559.1|2129295_2129724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556560.1|2129804_2130341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2130310_2131216_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|2131406_2132015_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_081007013.1|2132055_2132355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2132344_2132509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274909.1|2132892_2133219_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2133317_2133893_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2133838_2134204_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556499.1|2134374_2135527_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211971.1|2135733_2136345_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032126649.1|2136365_2137562_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_017377024.1|2137658_2137799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211968.1|2137811_2138216_-	SufE family protein	NA	NA	NA	NA	NA
WP_075273313.1|2138341_2138680_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556562.1|2138639_2138942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|2139086_2139272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|2139841_2140423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556649.1|2140450_2141308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211960.1|2141847_2142375_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_075273327.1|2142618_2143194_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	2164393	2214717	3152175	tRNA,protease,transposase	Staphylococcus_phage(33.33%)	49	NA	NA
WP_016209884.1|2164393_2165017_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036777115.1|2165093_2165294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209891.1|2165435_2166134_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016209896.1|2166280_2166850_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_122940402.1|2167164_2167788_-	porin family protein	NA	NA	NA	NA	NA
WP_032126745.1|2167996_2168599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|2168670_2169036_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046744.1|2169092_2169266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556564.1|2170435_2170765_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273603.1|2171921_2172098_+	phosphatase	NA	NA	NA	NA	NA
WP_129556565.1|2172221_2172617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126686.1|2174086_2174671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274914.1|2175221_2176097_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_059372565.1|2176145_2176517_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556566.1|2176425_2176629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210465.1|2177136_2177979_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_016210463.1|2178029_2178377_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210471.1|2178567_2179455_+	ROK family protein	NA	NA	NA	NA	NA
WP_016210467.1|2179569_2180172_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210468.1|2180168_2180888_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_075275113.1|2180956_2182666_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_016210464.1|2182816_2184754_+	AsmA family protein	NA	NA	NA	NA	NA
WP_032126596.1|2184862_2185915_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_016210461.1|2185914_2186190_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016210458.1|2186270_2186819_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_155049143.1|2187135_2189730_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_052104763.1|2189894_2190392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212492.1|2190617_2191472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049145.1|2191521_2192496_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_033923740.1|2192554_2192842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211720.1|2193089_2194013_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155049148.1|2194026_2194311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049150.1|2194455_2195238_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_155049152.1|2195185_2195803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211719.1|2196144_2196972_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_155049154.1|2197412_2197877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126590.1|2198264_2199797_+	nuclease	NA	NA	NA	NA	NA
WP_032126591.1|2199859_2201197_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_016210313.1|2201339_2202806_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210314.1|2202802_2203852_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_016210306.1|2203975_2206084_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210305.1|2206248_2206653_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|2206713_2207439_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210307.1|2207524_2208415_+	YicC family protein	NA	NA	NA	NA	NA
WP_032126592.1|2208455_2209076_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.3	2.5e-20
WP_016210310.1|2209136_2209343_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_016210316.1|2209364_2211518_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.1e-12
WP_016210317.1|2211524_2213507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2213742_2214717_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 28
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	2221446	2267369	3152175	transposase	Staphylococcus_phage(50.0%)	52	NA	NA
WP_075274916.1|2221446_2222508_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212177.1|2223503_2223677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212174.1|2223753_2224011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2224123_2224699_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2224644_2225010_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2226044_2226620_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274918.1|2226565_2226931_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212205.1|2227614_2227794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|2227933_2229379_+	MFS transporter	NA	NA	NA	NA	NA
WP_016212319.1|2229937_2230165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|2230151_2230478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|2230479_2230911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|2231439_2232501_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210831.1|2232595_2233141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|2233410_2234430_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|2234416_2234839_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|2234840_2235314_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_052133275.1|2235429_2236053_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210836.1|2236082_2236757_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|2236762_2237911_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|2237907_2238369_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210830.1|2238444_2239695_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_016210824.1|2239821_2241501_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|2241610_2242477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274920.1|2243907_2244642_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	4.8e-10
WP_016211000.1|2244737_2245523_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307345.1|2245666_2246353_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211002.1|2246386_2246785_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|2246948_2247254_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_016210998.1|2247331_2247586_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|2247739_2249401_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|2249460_2250144_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|2250143_2251232_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016211004.1|2251280_2253917_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300237.1|2254329_2255391_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556568.1|2255580_2257062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2257098_2257674_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|2257619_2257910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2257923_2258499_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2258444_2258810_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212450.1|2258965_2259868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2259911_2260886_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211507.1|2261199_2262519_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|2262522_2263239_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211506.1|2263235_2263877_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_075274921.1|2263869_2263968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274922.1|2263945_2264242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211503.1|2264252_2264708_-	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_016211508.1|2264762_2265107_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211502.1|2265136_2266180_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_016211504.1|2266519_2266804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2266793_2267369_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	2336572	2396184	3152175	tRNA,transposase	Planktothrix_phage(16.67%)	57	NA	NA
WP_129556571.1|2336572_2337283_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2337311_2337716_+	RidA family protein	NA	NA	NA	NA	NA
WP_016209567.1|2338831_2339449_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126712.1|2339883_2340342_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209553.1|2341086_2342097_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	42.2	2.9e-58
WP_016209566.1|2342581_2343493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209545.1|2343818_2347313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209551.1|2347350_2348190_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.0	1.8e-45
WP_016209564.1|2348376_2348592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209547.1|2348640_2349216_-	ribonuclease HI	NA	V9M0C8	Vibrio_phage	46.6	1.3e-29
WP_016209540.1|2349212_2349551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209568.1|2349719_2350709_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.7	1.7e-18
WP_016209572.1|2350709_2351672_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-16
WP_016209559.1|2351681_2352584_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300271.1|2352627_2353602_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212612.1|2353739_2353973_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300455.1|2354066_2354432_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2354488_2354653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2354642_2354942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212572.1|2354999_2355392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2355521_2355887_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300461.1|2355943_2356252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2356343_2356919_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2356864_2357230_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|2357382_2357655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212514.1|2358065_2358203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|2358221_2359058_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2359069_2359342_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126774.1|2359497_2359833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307356.1|2359992_2361525_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_016211407.1|2361557_2362397_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211411.1|2362393_2362891_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_016211412.1|2362894_2363887_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_016211408.1|2364001_2365348_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_054300173.1|2365571_2366633_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212287.1|2366711_2367857_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_016211372.1|2373956_2374814_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016211371.1|2374800_2375724_-	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211368.1|2375920_2377312_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211369.1|2377358_2378402_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211370.1|2378444_2378888_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211374.1|2379020_2380211_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211373.1|2380265_2380412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|2380963_2381881_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_036794860.1|2382148_2382442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|2382518_2382713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212197.1|2383731_2384649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210876.1|2385114_2385957_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016210873.1|2386024_2386675_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210874.1|2386689_2387730_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210882.1|2387852_2388938_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210872.1|2388964_2390074_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210871.1|2390090_2390408_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210879.1|2390404_2390764_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210878.1|2390866_2393596_-	kinase	NA	NA	NA	NA	NA
WP_080664847.1|2394096_2395050_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_075274927.1|2395122_2396184_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	2434169	2497797	3152175	tRNA,transposase	Staphylococcus_phage(37.5%)	60	NA	NA
WP_036771330.1|2434169_2435144_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_129556574.1|2435440_2435794_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211760.1|2435846_2437226_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211761.1|2437332_2439324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274928.1|2439739_2440714_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	5.2e-28
WP_016209674.1|2440943_2441777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126406.1|2441960_2443439_-	nuclease	NA	NA	NA	NA	NA
WP_155049159.1|2443879_2445676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209671.1|2445758_2445986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556575.1|2446053_2447022_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_032126407.1|2446997_2447408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209685.1|2447412_2447748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556656.1|2447749_2448277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556657.1|2448762_2449203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209678.1|2449304_2452523_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_129556576.1|2452562_2453417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209670.1|2453385_2456394_-	ATPase AAA	NA	NA	NA	NA	NA
WP_032126408.1|2456396_2456822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209688.1|2456853_2457435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209684.1|2457434_2458478_-	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_016209692.1|2458480_2458960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047060.1|2458968_2461272_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_032126410.1|2461300_2461540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209677.1|2461560_2462667_-	type II/IV secretion system family protein	NA	NA	NA	NA	NA
WP_016209693.1|2462659_2463406_-	type IV secretion system protein DotC	NA	NA	NA	NA	NA
WP_016209695.1|2463398_2463902_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_032126411.1|2463965_2464400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209680.1|2464414_2465452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209681.1|2465467_2466448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556659.1|2466453_2467599_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209676.1|2467655_2468495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209672.1|2469008_2469434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209690.1|2469536_2472224_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_016211689.1|2472810_2473950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211690.1|2474025_2476182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556660.1|2476467_2477220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211688.1|2477405_2477624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211600.1|2477772_2478291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211601.1|2478626_2479049_-	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	37.3	1.1e-22
WP_016211597.1|2479354_2480725_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.8	2.6e-110
WP_016211595.1|2481082_2481550_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211599.1|2481562_2482573_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_080664865.1|2482768_2483245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|2483241_2484078_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2484089_2484362_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211743.1|2484428_2484791_-	ABC transporter membrane domain protein	NA	NA	NA	NA	NA
WP_129556577.1|2484777_2485806_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	4.8e-16
WP_016211744.1|2485783_2486188_-	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_016211742.1|2486418_2488398_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_054300202.1|2488677_2489406_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019244.1|2489495_2490107_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_016210955.1|2490463_2490718_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|2490816_2492601_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_016210956.1|2492689_2493409_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210951.1|2493591_2493798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210948.1|2493797_2494034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|2494046_2494424_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|2494930_2495749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210947.1|2495842_2496040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|2497068_2497797_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
>prophage 31
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	2501432	2609268	3152175	tRNA,transposase,protease,integrase	Escherichia_phage(34.15%)	102	2584127:2584186	2592368:2592655
WP_075274931.1|2501432_2502161_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_032126570.1|2502917_2503217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211816.1|2503229_2503583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|2503624_2505238_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_075274932.1|2505459_2505681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274933.1|2505989_2506718_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211951.1|2507334_2508432_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|2508465_2509716_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_075274934.1|2510203_2510872_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.0	2.8e-41
WP_016212193.1|2510994_2511333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|2511400_2511787_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|2511783_2512029_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300202.1|2512437_2513166_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211625.1|2513649_2514519_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_016211621.1|2514515_2515865_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	4.6e-75
WP_016211623.1|2515977_2517618_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_016211987.1|2519439_2521176_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_054300202.1|2521679_2522408_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_098082825.1|2522471_2522780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|2522772_2523105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|2523108_2523678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211655.1|2523806_2524220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211652.1|2524479_2525685_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211653.1|2525792_2526818_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_054300202.1|2526909_2527638_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_033923779.1|2527850_2528687_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2528698_2528971_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049161.1|2529021_2529531_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036780855.1|2529505_2530003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|2530768_2531497_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211053.1|2531539_2532106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211047.1|2532193_2533828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|2534189_2534693_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|2534655_2535363_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|2535431_2536292_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_016211045.1|2536272_2537046_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|2537076_2538330_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|2538329_2539292_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|2539335_2540088_+	ComF family protein	NA	NA	NA	NA	NA
WP_016210615.1|2542463_2542934_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|2542979_2543219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274938.1|2543237_2543744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|2543907_2545332_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_016210618.1|2545396_2546446_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|2546712_2547492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556587.1|2547535_2548438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210625.1|2548496_2549243_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_016210616.1|2549491_2552302_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_129556661.1|2552602_2553166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|2553154_2553883_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_080664881.1|2553972_2554179_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212263.1|2554341_2554935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212264.1|2554980_2555574_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	5.4e-28
WP_016212238.1|2556089_2557379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274939.1|2557408_2558137_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.8e-42
WP_087910645.1|2558249_2559402_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274940.1|2559430_2560111_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	2.0e-42
WP_016211997.1|2560466_2561576_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	24.5	4.4e-07
WP_016211996.1|2561577_2562525_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_075274941.1|2562908_2563637_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.2e-42
WP_075275114.1|2563666_2564029_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212339.1|2564181_2564928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274942.1|2564946_2565675_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.1	2.7e-45
WP_032127022.1|2566351_2568538_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_087910645.1|2568599_2569753_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274943.1|2570038_2570563_+	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_129556588.1|2570753_2570921_-	phosphatase	NA	NA	NA	NA	NA
WP_075274944.1|2570865_2571582_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
WP_032126817.1|2571938_2572760_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211722.1|2572769_2576072_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	1.7e-54
WP_016211321.1|2576452_2577613_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211323.1|2577786_2578884_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	1.0e-27
WP_016211325.1|2578873_2580394_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	7.3e-85
WP_016211322.1|2580456_2581047_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211324.1|2581582_2582137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211326.1|2582633_2583374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274945.1|2583518_2583869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212568.1|2584093_2584243_+	hypothetical protein	NA	NA	NA	NA	NA
2584127:2584186	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_016212659.1|2584387_2584633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212291.1|2584720_2584948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212294.1|2585377_2585722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274946.1|2585735_2586179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377879.1|2586400_2586625_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_016212230.1|2586680_2588129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|2589662_2589851_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556589.1|2591252_2591528_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|2591530_2592133_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_155046749.1|2592196_2592484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046945.1|2593034_2594108_+	hypothetical protein	NA	NA	NA	NA	NA
2592368:2592655	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_016211874.1|2594426_2596145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2596188_2597094_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046750.1|2598338_2598476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210068.1|2599662_2600238_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_016210050.1|2600313_2601189_-	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_016210054.1|2601253_2601775_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210069.1|2601759_2602842_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.6e-20
WP_016210051.1|2603082_2603487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210073.1|2603911_2604643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210076.1|2604899_2606201_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210066.1|2606342_2607011_+|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_032126425.1|2607454_2608051_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210052.1|2608071_2609268_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
>prophage 32
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	2637908	2672362	3152175	tRNA,transposase	Microbacterium_phage(20.0%)	38	NA	NA
WP_054300282.1|2637908_2638373_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377880.1|2638429_2638909_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556590.1|2639766_2640162_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_032126312.1|2640158_2640953_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211756.1|2641131_2641857_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211759.1|2642102_2643290_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_081377344.1|2643644_2644772_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210935.1|2645102_2645645_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|2645641_2646328_-	acireductone synthase	NA	NA	NA	NA	NA
WP_016210942.1|2646331_2646943_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|2646989_2648009_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|2648110_2648905_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|2648942_2649749_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|2649827_2650877_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|2651074_2652334_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|2652380_2653058_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2653143_2653425_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016210940.1|2653516_2654704_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	6.4e-20
WP_129556549.1|2654811_2655698_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210820.1|2655899_2656841_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|2657344_2657569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|2657860_2658565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210823.1|2659028_2659667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|2660001_2660532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779158.1|2660528_2662061_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2662057_2663008_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2663427_2664060_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2664302_2664500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2664849_2665278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307340.1|2665355_2666054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274949.1|2666031_2667093_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126306.1|2667317_2667614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|2667718_2668363_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2668598_2669096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377881.1|2670012_2670180_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377882.1|2670186_2670468_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2670427_2670766_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210986.1|2670823_2672362_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	1.3e-86
>prophage 33
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	2730310	2813628	3152175	tRNA,transposase,protease	unidentified_phage(21.43%)	82	NA	NA
WP_075273298.1|2730310_2730886_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155049165.1|2731017_2731632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307321.1|2731694_2732243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209980.1|2732329_2733496_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.7e-25
WP_032126286.1|2733801_2736600_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	4.9e-180
WP_016209981.1|2736658_2737879_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	8.5e-36
WP_016209998.1|2737908_2738310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209994.1|2738976_2739264_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_016209985.1|2739420_2739759_+	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_016209995.1|2739793_2741431_-	response regulator	NA	NA	NA	NA	NA
WP_016209992.1|2741532_2742582_+	WD domain, G-beta repeat family protein	NA	NA	NA	NA	NA
WP_016209988.1|2742654_2743299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556662.1|2743295_2744543_-	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_016209986.1|2744548_2745838_-	ubiquinone biosynthesis hydroxylase UbiH/UbiF/VisC/COQ6 family protein	NA	NA	NA	NA	NA
WP_016209989.1|2745862_2746453_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_016209996.1|2746597_2746822_+	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_016209991.1|2746802_2747132_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_033923658.1|2747357_2747921_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209997.1|2747955_2748417_+	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_016209977.1|2748493_2750179_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_032126288.1|2750228_2751029_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_016210000.1|2751055_2751604_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_016209993.1|2751733_2752126_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016209990.1|2752182_2752587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556594.1|2752619_2753387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2753852_2754914_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2755004_2755751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274953.1|2755875_2756739_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|2756982_2757345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377902.1|2757531_2758059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556595.1|2758203_2758620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|2760391_2761303_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|2761354_2762203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|2762647_2763358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556596.1|2763449_2764418_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|2764405_2765053_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_016210370.1|2765081_2765933_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|2765947_2767225_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|2767265_2767781_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210372.1|2767859_2768921_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|2768942_2770031_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_155049167.1|2770075_2771938_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2771952_2772423_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2772459_2772795_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080664840.1|2772807_2773524_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|2773460_2774477_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|2774473_2774953_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|2775036_2777517_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2777579_2777945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273456.1|2778322_2778622_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2778581_2779037_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2779051_2779342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210570.1|2779407_2781006_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2781136_2781472_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_016210578.1|2781499_2783164_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	7.1e-33
WP_016210581.1|2783160_2783805_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|2783804_2784548_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2784606_2784846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2784996_2786364_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|2786374_2786926_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126278.1|2787006_2787990_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|2788111_2789869_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126277.1|2790091_2790682_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|2790769_2791189_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_016210580.1|2791329_2791590_+	methyltransferase	NA	NA	NA	NA	NA
WP_075274955.1|2791665_2792640_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_075274956.1|2792682_2793051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212327.1|2793111_2793897_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075274955.1|2795282_2796257_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212084.1|2796538_2797555_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126534.1|2797554_2798070_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212085.1|2798111_2798585_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_052133268.1|2798742_2799024_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	40.2	3.1e-10
WP_129556741.1|2799045_2799717_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.4	3.4e-10
WP_016212306.1|2799752_2800283_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212310.1|2800312_2800768_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_129556598.1|2803317_2805831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211935.1|2806765_2809414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274958.1|2809862_2810924_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2810950_2811526_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2811471_2811837_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556599.1|2812475_2813628_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 34
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	2926190	2970536	3152175	transposase,protease	Acanthamoeba_polyphaga_lentillevirus(14.29%)	43	NA	NA
WP_016209259.1|2926190_2927039_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_016209274.1|2927155_2928067_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_075274963.1|2928785_2929847_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212454.1|2930066_2930747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211192.1|2931535_2932894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211189.1|2932938_2933397_-	NfeD family protein	NA	NA	NA	NA	NA
WP_016211187.1|2933421_2934342_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_016211186.1|2934468_2935251_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.3	8.2e-32
WP_016211190.1|2935340_2936840_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_016211188.1|2937161_2939045_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_075273298.1|2939118_2939694_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2939639_2940005_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211157.1|2940569_2941226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211161.1|2941333_2942443_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|2942454_2943099_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|2943117_2944104_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|2944183_2945260_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|2945462_2946287_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|2946603_2947608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|2947816_2948782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274965.1|2948920_2949796_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2950092_2951145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049173.1|2951466_2951841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2952054_2952546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2952601_2953852_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2953954_2954173_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_052104629.1|2954615_2955641_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080728341.1|2956090_2956261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212561.1|2956232_2956373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210728.1|2957287_2957758_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2958046_2959426_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2959453_2959912_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2959889_2961107_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2961298_2961535_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2961548_2961704_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2961784_2962747_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2962906_2964223_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2964232_2964901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2965263_2967078_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_081007013.1|2967498_2967798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2967787_2967952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2968008_2968374_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052104629.1|2969510_2970536_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP038923	Piscirickettsia salmonis strain Psal-011 chromosome, complete genome	3152175	3002220	3119647	3152175	tRNA,transposase	Staphylococcus_phage(33.33%)	112	NA	NA
WP_054300271.1|3002220_3003195_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|3003270_3004290_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556602.1|3004688_3004898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274966.1|3006889_3007951_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211201.1|3008031_3008340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211206.1|3008454_3009771_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664857.1|3010232_3011519_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211205.1|3011591_3012488_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211203.1|3012574_3013573_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032126430.1|3013681_3014206_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_129556668.1|3014453_3015692_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_016212222.1|3016239_3016713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|3016709_3017105_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|3018034_3018610_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|3018555_3018921_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211610.1|3019185_3021516_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_129556603.1|3021636_3023652_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075274967.1|3023835_3027228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|3027292_3027598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274968.1|3027767_3028868_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556605.1|3029262_3030372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209721.1|3031310_3032708_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.3e-77
WP_051307313.1|3032827_3033775_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|3033771_3034287_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|3034273_3035473_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|3035469_3035793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|3035794_3037024_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|3037023_3038067_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|3038066_3038750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3038746_3041236_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3041252_3041507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3041507_3041864_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|3042643_3043807_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|3043826_3046934_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|3046935_3048441_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3048468_3048750_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3048898_3049240_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3049359_3051240_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_059372650.1|3051324_3052923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3052940_3054056_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|3054183_3055182_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209700.1|3055185_3055944_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3055945_3057145_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3057128_3057800_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3057821_3058598_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3058601_3059600_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3059601_3060180_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3060176_3061646_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3061689_3061977_-	trp operon repressor	NA	NA	NA	NA	NA
WP_016209699.1|3062177_3062774_+	DMT family transporter	NA	NA	NA	NA	NA
WP_075274970.1|3062983_3063454_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|3063510_3063666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274971.1|3063810_3064263_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3064448_3064670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212371.1|3064785_3065418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274972.1|3065395_3066457_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211865.1|3066896_3067436_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|3067520_3068057_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|3068708_3069011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|3069460_3069769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556607.1|3070377_3070827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|3071109_3071820_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|3072046_3072445_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_016211231.1|3073312_3074263_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3074262_3076341_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3076488_3077004_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3077012_3077576_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3077556_3078303_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3078442_3078895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|3079318_3080155_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3080151_3081048_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3081080_3082148_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3082166_3082535_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3082560_3084009_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3084018_3085398_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3085438_3086770_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|3086741_3087701_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3087793_3088297_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3088431_3089583_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3089579_3090059_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3090205_3092527_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3092471_3093098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3093102_3094002_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3094074_3094653_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3094953_3095211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556611.1|3095219_3096373_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046758.1|3097509_3097641_+	phosphatase	NA	NA	NA	NA	NA
WP_155046759.1|3097785_3097941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212051.1|3098268_3099042_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054300271.1|3100369_3101344_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155049176.1|3102110_3102257_+	phosphatase	NA	NA	NA	NA	NA
WP_016212335.1|3102438_3102777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212337.1|3102793_3103504_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_051307375.1|3103491_3103683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|3103844_3104144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|3104133_3104298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|3104354_3104720_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126718.1|3105480_3105861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211790.1|3106024_3106720_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3106716_3108144_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3108169_3108433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3108793_3109768_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556612.1|3109826_3110677_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|3110714_3111059_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3111055_3111892_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3111892_3112234_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3112235_3112841_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3112837_3114832_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3114851_3115793_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211292.1|3116020_3117445_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|3117957_3118932_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3118990_3119647_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP038924	Piscirickettsia salmonis strain Psal-011 plasmid unnamed1, complete sequence	158304	2892	100622	158304	tail,integrase,transposase,capsid,head	Streptococcus_phage(26.67%)	112	NA	NA
WP_054300202.1|2892_3621_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155049199.1|3589_3835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047019.1|4324_4477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273751.1|4489_6220_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300477.1|6379_7108_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	7.1e-38
WP_155047020.1|7264_8188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275154.1|8428_9085_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.7	7.6e-31
WP_054300202.1|9214_9943_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155049201.1|10187_10808_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_054300202.1|10855_11584_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126843.1|11887_12067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126844.1|12285_12582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212118.1|12676_13138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|15300_16275_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_129556704.1|16768_17098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|17600_18437_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|18448_18721_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212122.1|19208_19910_+	ParA family protein	NA	J9Q7R7	Salmonella_phage	31.8	1.1e-19
WP_016212121.1|19863_20787_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_032126205.1|21220_21586_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556705.1|21531_22032_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	28.0	9.9e-07
WP_036771330.1|22090_23065_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_054300162.1|23577_24660_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212151.1|25024_25987_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|26010_26325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923686.1|26381_27431_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|27539_28580_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|28593_29223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|29313_29613_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211886.1|29609_30038_-	nucleotidyltransferase substrate-binding, HI0074 family protein	NA	NA	NA	NA	NA
WP_054300202.1|30826_31555_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126832.1|31799_32708_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_054300202.1|32818_33547_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046765.1|33658_33853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|34739_35468_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|35671_38248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274822.1|38653_39628_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_075274931.1|39828_40557_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.4e-38
WP_016212137.1|41000_42062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212139.1|42137_42383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307371.1|42354_42969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|43786_44761_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_129556707.1|45120_46140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|46768_47922_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_032126239.1|48066_48339_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|48350_49187_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075275144.1|49219_49951_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212014.1|50048_50462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212017.1|50756_51155_+	hypothetical protein	NA	W8VUR5	Pseudomonas_phage	38.8	2.3e-06
WP_047927838.1|51184_51430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|51426_51726_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_016212019.1|51882_52578_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_081377351.1|53391_54171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|54254_54407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126739.1|54359_54692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|54856_55234_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_016212152.1|55540_55924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|56393_57122_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_129556708.1|57237_57573_-	mRNA-degrading endonuclease	NA	A9D9Y1	Lactobacillus_prophage	35.6	2.6e-11
WP_016212365.1|57565_57808_-	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_054300271.1|58016_58991_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_075275142.1|59626_60355_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	1.2e-37
WP_075275141.1|60637_62323_+	protein kinase	NA	NA	NA	NA	NA
WP_129556709.1|62534_62624_+	DUF1891 domain-containing protein	NA	NA	NA	NA	NA
WP_129556710.1|62704_63175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275140.1|63328_64063_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.1e-38
WP_075275139.1|64689_64920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212404.1|65534_65768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126756.1|65888_66332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275138.1|66476_66785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049203.1|67010_68651_+	AAA family ATPase	NA	A0A0K2FLP8	Brevibacillus_phage	31.5	9.0e-65
WP_016212457.1|68660_69062_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_016212456.1|69058_69346_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_075275137.1|69389_69803_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126239.1|69858_70131_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|70142_70979_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_016212579.1|71909_72107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|73612_73813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|73823_74399_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|74344_74710_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212061.1|75541_77584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|78488_78854_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|78799_79375_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_081377872.1|79388_79679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|79624_80200_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075274752.1|80196_80496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|80531_81685_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_052047048.1|81865_82366_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046767.1|82365_82527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211937.1|82796_83186_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016211936.1|83675_84698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211938.1|85192_85753_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275134.1|85817_86216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275133.1|86324_86633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|87165_88319_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273327.1|88567_89143_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075275128.1|89088_89454_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556696.1|89553_90570_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.0	3.0e-18
WP_052133287.1|90671_91070_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_129556716.1|91203_91494_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
WP_016210655.1|91507_92104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210663.1|92422_92734_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	4.3e-08
WP_016210667.1|92730_93054_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210658.1|93046_93442_+	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210651.1|93438_93789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210664.1|93788_94211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210669.1|94212_94536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|94592_94859_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075273774.1|97060_98218_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275128.1|98359_98725_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|98670_99246_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126790.1|99716_100622_+|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
>prophage 2
NZ_CP038924	Piscirickettsia salmonis strain Psal-011 plasmid unnamed1, complete sequence	158304	105294	151598	158304	protease,transposase,integrase	Streptococcus_phage(18.18%)	60	113734:113793	137505:138476
WP_075273327.1|105294_105870_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126360.1|106076_106811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211895.1|106933_107992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|108500_109247_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211897.1|109247_109652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|110045_110861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|111465_112194_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212298.1|112635_112962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307374.1|113202_113679_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
113734:113793	attL	TGATCAGGCTACCCTATTCCGGACAAATAAATTACAATAATCCGAGCCGGAGGAATCACA	NA	NA	NA	NA
WP_075275158.1|113793_114087_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377916.1|114203_114728_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.4	2.5e-29
WP_155049205.1|114953_115235_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.6	8.0e-14
WP_129556698.1|115243_115945_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_016211912.1|116034_116625_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
WP_032126795.1|116897_117158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|117161_117434_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_016211913.1|117759_118881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273786.1|119313_119712_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081377915.1|119720_120278_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	2.9e-47
WP_081377914.1|120422_120752_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|120868_121162_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_016212499.1|122160_122535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|122739_122913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|123160_123610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212412.1|123602_123767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372613.1|124067_124694_+	hypothetical protein	NA	A0A222ZGQ4	Arthrobacter_phage	33.7	1.8e-21
WP_054300202.1|124799_125528_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_054300590.1|125557_125782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556699.1|126089_126290_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211871.1|126283_126619_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_032126138.1|127184_127448_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_016211872.1|128002_128806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307367.1|128926_129451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273798.1|129559_129784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126346.1|129875_130118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923775.1|130184_130925_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	4.6e-08
WP_016212413.1|130972_131401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|131734_132463_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_129556700.1|132639_132885_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|132844_133300_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_054300148.1|133405_134467_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728342.1|134506_135010_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032126739.1|135324_135657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556701.1|135903_136428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275159.1|136836_137544_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	32.0	3.8e-12
WP_129556702.1|137564_138717_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
137505:138476	attR	TGATCAGGCTACCCTATTCCGGACAAATAAATTACAATAATCCGAGCCGGAGGAATCACAATGGGAAAGCGTCACGTCACCAAGTACACCGAAGAATTTAAAAAATCATCTGCCAAGCTTGCAGTCGATTCAAATCAAGCAATCAGTCATACAGCACAGGAATTGGGTATTCACTCAAGTACACTGCATGGTTGGGTCAATAAATATCATCCAAACAGTCCAAATACTGTTAAAGATGAAGTTAGTGATATGGCTGCTGAAATAAAACAGTTAAAAAAAGAGTTGGCTAGAGTGACACAGGAACGTGAAATGCTAAAAAAAGCGTCGGCGTACTTTGCAAGCGAAACACAGTAAAGTATGCCTGGATCAAAGAAAATAAATGTGTTTTTCCAGTAGATAGGGTGTGCTCAATCTTAGGTGTTAGCCGATCAGGTTATTACAGTTGGTTAAAGGTACAGCCTTCCAAGCGAATGATAGAGAACCAAAAATTAGCTAGGCGAATCAAGGAAATATTCATCGAAAGCCGTGCAACCTATGGTACTCGAAGAATTAGAAAACAGTTGGCAACACAGGAAATTTCTGTAAGCCGTAAGCGAGTTGGCCGTTTAATGAAGCAGAACCAGCTTTGCTGCAAGATAAAGCGTAAATTCAAAGTAACTACGGATTCTAAACATCGATTGCCAATTGCGAAAAACGTGTTGGACCGGAATTTTTCAGCAACAGGCCCTAACCAAAAATATGTTGGTGATATTACCTACATACGGACCCAACAAGGCTGGTTGTACTTGGCTGTTGTGATTGACTTATTCTCACGAAAAGTTGTTGGCTGGGCCATGGAGGATCATATGGAAGCATCACTCGTCAATGATGCTCTGTTGATGGCCTTATGGAAACGAAAGCCTAAAGCTGGGTTAATTTGGCATTCAGATCGCGGAAGCCAATATGCTTCAGAAAGTCATCGTGAGATTCTTA	NA	NA	NA	NA
WP_075273327.1|139701_140277_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|140222_140588_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212398.1|141935_142397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|142659_143496_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_129556717.1|143821_145048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|145702_146677_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_016212260.1|146834_147107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212257.1|147126_147351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126838.1|147687_147891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212255.1|147887_148058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273820.1|148244_149327_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.8	1.2e-142
WP_075273822.1|149483_149984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274741.1|150085_150343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556718.1|150411_151598_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
>prophage 1
NZ_CP038925	Piscirickettsia salmonis strain Psal-011 plasmid unnamed2, complete sequence	78733	4824	28863	78733	transposase	Streptococcus_phage(16.67%)	33	NA	NA
WP_075273327.1|4824_5400_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|5345_5711_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212400.1|5761_6361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212399.1|6360_6621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|6750_7903_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212392.1|7931_8939_-	hypothetical protein	NA	W6E8G0	Rhizobium_phage	26.4	1.2e-06
WP_075273802.1|9002_9731_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.5e-37
WP_016212131.1|9914_10262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212135.1|10700_11885_+	3-methylitaconate isomerase	NA	NA	NA	NA	NA
WP_075275202.1|12128_12830_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	6.0e-10
WP_075275201.1|12832_13561_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_016212164.1|13689_14718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211443.1|15741_16428_+	Fic family protein	NA	NA	NA	NA	NA
WP_016211439.1|16431_16986_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	40.6	1.0e-20
WP_016211436.1|17030_17969_+	fic/DOC family protein	NA	S4TP71	Salmonella_phage	37.2	5.2e-25
WP_016211434.1|17941_18133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211445.1|18310_18661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211437.1|18677_19304_-	zinc-ribbon domain-containing protein	NA	A0A1S5XYQ1	Kurlavirus	28.2	4.4e-12
WP_155049210.1|19310_19736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211440.1|19713_20628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211444.1|20897_21404_+	antirestriction protein ArdA	NA	A0A222YZE5	Mycobacterium_phage	33.7	2.8e-17
WP_051307358.1|21552_21936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556729.1|22219_22450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212541.1|22436_22661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212539.1|22720_22870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|22866_23841_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212090.1|23884_24064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212087.1|24063_24492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126714.1|24659_25199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212089.1|25435_25666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126713.1|25764_26802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|27271_28297_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275198.1|28323_28863_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	40.2	8.4e-12
>prophage 2
NZ_CP038925	Piscirickettsia salmonis strain Psal-011 plasmid unnamed2, complete sequence	78733	37206	57887	78733	protease,portal,capsid,terminase,head,tail	Pseudomonas_phage(11.76%)	29	NA	NA
WP_129556725.1|37206_37887_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	39.3	3.3e-37
WP_016210977.1|38065_38359_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_032126476.1|38358_38637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046773.1|38903_39083_-	phosphatase	NA	NA	NA	NA	NA
WP_016212235.1|39129_39495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126134.1|39795_40179_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	5.6e-26
WP_016212234.1|40266_40746_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_016212231.1|40749_40959_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	43.1	1.3e-08
WP_080743047.1|40974_41331_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	61.3	5.4e-23
WP_081377926.1|41349_42432_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	1.2e-89
WP_016211136.1|42428_43670_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	46.0	3.1e-86
WP_080664855.1|43617_44289_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.8	3.0e-43
WP_016211140.1|44346_45540_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_016211133.1|45660_46995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211137.1|47185_47497_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_016211132.1|47493_47817_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211139.1|47809_48205_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211129.1|48201_48552_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211141.1|48551_48974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126913.1|48975_49299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|49355_49622_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_032126912.1|49625_51704_+	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	33.0	2.5e-56
WP_016210657.1|51696_52038_+|tail	phage minor tail family protein	tail	NA	NA	NA	NA
WP_016210666.1|52034_52706_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|52674_53421_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_016210665.1|53410_53968_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_016210662.1|53974_54262_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	2.5e-15
WP_016210670.1|54251_54506_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_016210653.1|54599_57887_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	33.5	5.2e-112
>prophage 1
NZ_CP038926	Piscirickettsia salmonis strain Psal-011 plasmid unnamed3, complete sequence	34920	0	12994	34920	transposase,integrase	Caulobacter_phage(33.33%)	12	5754:5813	9734:9947
WP_016211499.1|932_1916_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_032126374.1|2073_3045_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212329.1|3110_3701_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
5754:5813	attL	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAA	NA	NA	NA	NA
WP_032126737.1|6035_6764_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126738.1|6964_7237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|7229_7508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212425.1|7711_8302_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	34.4	1.1e-20
WP_032126150.1|8450_8684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|8782_9757_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212315.1|11410_11845_+	DUF29 domain-containing protein	NA	A0JC30	Ralstonia_phage	39.7	9.1e-25
9734:9947	attR	TTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCGTTATTCCGGTGAGATTATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTACCGTGATCTCAAAGAAATAGCAGCTGAAAGAGGTCTTGAGATTGAGCGTTCAACCATTTGTCGTTGGGTGCACGAGTATGGCTCGCAGACCGCC	NA	NA	NA	NA
WP_032126346.1|11944_12187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126347.1|12253_12994_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	6.0e-08
>prophage 2
NZ_CP038926	Piscirickettsia salmonis strain Psal-011 plasmid unnamed3, complete sequence	34920	16189	24563	34920	transposase	unidentified_phage(40.0%)	8	NA	NA
WP_129556741.1|16189_16861_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.4	3.4e-10
WP_052133268.1|16882_17164_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	38.7	8.3e-11
WP_016211990.1|17254_19327_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_129556739.1|19356_20085_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_032126239.1|20767_21040_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|21051_21888_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_081377864.1|21901_22141_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|23588_24563_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
>prophage 3
NZ_CP038926	Piscirickettsia salmonis strain Psal-011 plasmid unnamed3, complete sequence	34920	29285	30014	34920	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_080728333.1|29285_30014_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	45.9	1.2e-21
