The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	31805	68058	3220407	transposase	Staphylococcus_phage(60.0%)	29	NA	NA
WP_036772169.1|31805_32681_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378444.1|33039_34395_+	chloride channel protein	NA	NA	NA	NA	NA
WP_017378443.1|34486_34993_-	GrpB family protein	NA	NA	NA	NA	NA
WP_017378442.1|34989_35358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378441.1|36760_38545_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_017378440.1|39025_40153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378439.1|40225_40981_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_027242743.1|41017_43711_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.7	9.9e-69
WP_036771562.1|43742_44294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063736.1|44401_45415_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017378435.1|45535_45760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378434.1|46115_46877_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_144420740.1|47019_47814_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875841.1|47958_48711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378433.1|49022_50549_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_065653750.1|50687_51761_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027242742.1|51800_53108_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
WP_017378429.1|53082_54252_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_027242741.1|54306_55032_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_027242740.1|55497_57603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378426.1|57817_58282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420739.1|58301_58811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420738.1|59195_60137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856772.1|60418_61870_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773655.1|62336_62741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|63301_64276_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|65010_65388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|65631_66606_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_036771330.1|67083_68058_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 2
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	124813	243982	3220407	protease,tRNA,transposase	Staphylococcus_phage(11.76%)	106	NA	NA
WP_053093682.1|124813_125557_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929698.1|125997_126291_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_017377396.1|126291_126546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242714.1|126562_129055_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_017377399.1|129047_129731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377400.1|129730_130774_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_017377401.1|130773_132003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377402.1|132004_132334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377403.1|132330_133530_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_144420824.1|133642_134032_+	signal peptidase, peptidase S26 family protein	NA	NA	NA	NA	NA
WP_026063632.1|134031_134976_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_017377406.1|135095_136493_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	3.9e-77
WP_017377407.1|136818_137340_+	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	46.2	1.7e-30
WP_017377408.1|137463_137772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875847.1|137786_143009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242717.1|143399_145406_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377568.1|145536_147867_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_144420823.1|148042_148873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773453.1|148989_149385_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_027242719.1|149381_149915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242720.1|149911_150313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875848.1|150707_151028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377563.1|151037_151994_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.5	1.0e-12
WP_017377562.1|152503_153028_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_017377561.1|153128_154127_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_027242721.1|154215_155112_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080963593.1|155185_156472_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377557.1|156931_158248_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377556.1|158361_158532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|158551_159526_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377551.1|159652_159913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377550.1|160180_160471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377545.1|163009_164050_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_048875849.1|164152_165124_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377543.1|165246_166095_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_017377542.1|166246_166534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|166844_167216_+	isochorismatase	NA	NA	NA	NA	NA
WP_017377540.1|168267_168501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|168638_168776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377539.1|168789_169002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377537.1|169525_170350_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377536.1|170488_171622_+	cation transporter	NA	NA	NA	NA	NA
WP_016210041.1|171681_173091_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_027242724.1|173238_174819_-	APC family permease	NA	NA	NA	NA	NA
WP_017377534.1|175576_176572_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242725.1|176577_178644_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_048875850.1|178701_179652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210045.1|179846_180173_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_026063646.1|180395_181655_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_036772663.1|181914_182790_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377528.1|182828_183791_+	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_017375799.1|189485_189830_-	DMT family protein	NA	NA	NA	NA	NA
WP_047927156.1|189926_190850_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375796.1|191349_191838_+	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_017375795.1|191940_192741_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375794.1|192751_194503_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_081000012.1|195392_195635_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420737.1|195638_196037_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|197317_197545_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_081078121.1|197576_198377_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375951.1|199095_199554_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420736.1|199735_199921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|200636_202451_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_017375948.1|202861_203530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375947.1|203539_204856_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375945.1|205015_205978_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210730.1|206058_206214_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375944.1|206227_206464_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_036773720.1|206656_207874_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375942.1|207851_208310_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_017375941.1|208337_209717_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_075275379.1|209753_209972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|210291_211587_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|211791_211983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|212181_213057_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|213244_214510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875854.1|214543_215419_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378152.1|215540_215999_-	NfeD family protein	NA	NA	NA	NA	NA
WP_017378151.1|216022_216943_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378150.1|217070_217853_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378149.1|217943_219443_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_027242686.1|219756_221640_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_027242685.1|221899_222562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242684.1|222628_223738_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_017378146.1|223749_224394_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_017378145.1|224412_225399_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378144.1|225483_226560_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378143.1|226761_227586_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378142.1|227888_228854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378141.1|229172_230225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|230283_231258_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027242682.1|231593_232022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|232258_232741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378138.1|232796_234047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378137.1|234149_234368_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378136.1|234839_235694_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378135.1|235748_236219_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_026063709.1|236515_236752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063708.1|236898_237279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|237337_238213_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063707.1|238979_239891_+	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_017378132.1|240007_240856_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_065653735.1|240922_241933_+	lipase	NA	NA	NA	NA	NA
WP_017378129.1|241956_242280_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_017375571.1|242290_242692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875856.1|242962_243982_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	318065	360424	3220407	transposase	Chrysochromulina_ericina_virus(20.0%)	54	NA	NA
WP_036772169.1|318065_318941_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378046.1|319021_319654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378045.1|319607_321053_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_051929544.1|321087_321507_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017378043.1|322280_322649_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_017378042.1|322658_323198_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_017378041.1|323358_323790_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_017378040.1|323793_324492_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_017378039.1|324739_325246_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_017378038.1|325288_325657_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_017378037.1|325927_330004_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.6	1.2e-22
WP_017378036.1|330067_334276_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_016209765.1|334437_334812_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_016209732.1|334916_335390_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_017378035.1|335405_337517_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209759.1|337544_338735_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_016209760.1|338741_339053_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_017378034.1|339175_339814_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_016209735.1|339829_340447_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_016209744.1|340443_340740_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_017378033.1|340754_341579_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_017378032.1|341595_341871_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_016209755.1|341876_342209_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_017378031.1|342221_342956_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_017378030.1|342969_343383_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_016209750.1|343382_343583_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_017378029.1|343582_343840_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_017378028.1|343961_344330_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_016209734.1|344347_344659_+	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_016209761.1|344674_345217_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_026063699.1|345229_345535_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_016209763.1|345563_345956_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_017378025.1|345968_346502_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_016209757.1|346511_346865_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_016209764.1|346875_347376_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_017378024.1|347381_347564_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_017378023.1|347566_348001_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_016209749.1|348001_349324_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_016209752.1|349380_349494_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_017378021.1|349637_349994_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_016209730.1|350019_350409_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_017378020.1|350418_351039_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_016209739.1|351060_352038_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_017378019.1|352086_352485_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_017378018.1|352597_353845_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_027242670.1|353831_354488_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_036772490.1|354572_354851_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375625.1|355093_355321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875859.1|355453_356248_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053856770.1|356556_357771_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|358168_358348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420732.1|358358_358970_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376985.1|359345_359594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771653.1|359683_360424_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
>prophage 4
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	378442	428125	3220407	transposase,tRNA	Staphylococcus_phage(25.0%)	54	NA	NA
WP_017376964.1|378442_380923_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_017376963.1|381009_381489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772771.1|381461_382502_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080963574.1|382438_383155_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|383167_383503_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|383539_384010_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_017376959.1|384052_385888_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_036818645.1|385932_387021_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376957.1|387042_388104_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_017376956.1|388181_388697_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376955.1|388737_390015_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376954.1|390029_390881_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376953.1|390909_391557_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026063584.1|391553_392513_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_036774534.1|392604_393030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376950.1|393034_393904_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875862.1|394048_394303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856769.1|394447_395014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|395119_395560_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_027242664.1|396071_397274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|397557_398532_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_155046563.1|399001_399139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910653.1|399155_399371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|399575_400187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376943.1|400183_400441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376942.1|400691_401084_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016210000.1|401213_401762_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_026063583.1|401761_402589_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_017376940.1|402638_404324_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_017376939.1|404401_404863_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_026063582.1|404899_405463_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209991.1|405689_406019_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_017376937.1|405999_406224_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_017376936.1|406368_406959_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376935.1|406983_408255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|408272_409526_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376933.1|409522_410167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376932.1|410239_411289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376931.1|411390_413028_+	response regulator	NA	NA	NA	NA	NA
WP_017376930.1|413062_413392_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376929.1|413548_413836_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376927.1|414262_414400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046565.1|414362_414656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376925.1|414905_416126_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376924.1|416184_418983_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376923.1|419288_420455_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_036772950.1|420553_421090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376921.1|421151_421484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|421741_422644_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|422713_423211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|423356_424760_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377694.1|424960_425689_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963630.1|425858_426716_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_048875864.1|427099_428125_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	499051	546019	3220407	transposase	Streptococcus_phage(33.33%)	44	NA	NA
WP_048875872.1|499051_500335_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|500507_500645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875873.1|500641_502045_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927246.1|502158_502596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242638.1|502716_503145_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017375827.1|503392_503830_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|504261_505650_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_017375825.1|506096_507590_+	amino acid permease	NA	NA	NA	NA	NA
WP_036773936.1|507784_508540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420725.1|509039_509270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|510374_511385_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375821.1|511381_511603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242636.1|512321_513263_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026063480.1|513790_514189_+	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_075275366.1|514128_514983_+	MFS transporter	NA	NA	NA	NA	NA
WP_017375815.1|515074_515356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242634.1|515441_516119_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_026063478.1|516164_517445_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_017375812.1|517620_518670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375811.1|518748_519549_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375810.1|519562_520357_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375809.1|520459_521479_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375808.1|521525_522137_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375807.1|522140_522827_+	acireductone synthase	NA	NA	NA	NA	NA
WP_017375806.1|522823_523366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375805.1|523658_524846_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375804.1|525090_525816_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_144420816.1|526001_526790_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_047927106.1|526786_527182_-	YchJ family protein	NA	NA	NA	NA	NA
WP_017375801.1|527574_528615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|528611_530015_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|532430_532688_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420723.1|532727_534113_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242633.1|534442_535540_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_017377120.1|535573_536824_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_017377119.1|536824_537457_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017377118.1|537746_538199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063598.1|538244_539087_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377116.1|539121_539613_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_017377115.1|539808_541776_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377113.1|542003_542408_+	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_047927448.1|542385_543414_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_027242632.1|543400_544189_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053856766.1|544615_546019_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	585525	719485	3220407	plate,tRNA,transposase	Staphylococcus_phage(13.64%)	109	NA	NA
WP_036772726.1|585525_586074_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
WP_017377077.1|586826_588206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|588565_590029_+	nuclease	NA	NA	NA	NA	NA
WP_017377075.1|590212_591025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377074.1|591489_593484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377073.1|593878_595258_+	MFS transporter	NA	NA	NA	NA	NA
WP_036774567.1|595295_595733_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774569.1|595775_596492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|598038_598569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|598635_600456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|601020_601527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242613.1|601611_603015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|603129_603384_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_017377065.1|603536_603809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420722.1|604384_604567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|604683_605259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155048025.1|605240_605426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242612.1|606326_606569_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_027242611.1|606871_607963_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377060.1|607943_608897_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_017377059.1|609120_610605_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_027242610.1|610644_611148_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_051929897.1|611407_612583_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_051929903.1|612730_613135_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_036772169.1|613291_614167_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242609.1|614201_614555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|617884_618310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|618540_619677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242608.1|619663_620986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377048.1|620978_622097_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377047.1|622217_622751_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377046.1|622889_624527_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377045.1|624531_624753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377044.1|624861_625875_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377043.1|626137_628366_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_017377041.1|629284_629614_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377039.1|631014_631233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|631291_632167_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377037.1|632159_633026_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_017377036.1|633093_634413_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036772137.1|634882_635443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856764.1|635761_636688_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376601.1|637583_638492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|642188_643028_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376604.1|643214_643430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|643478_644054_-	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376606.1|644050_644389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376607.1|644557_645547_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_051929685.1|646536_647439_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048875984.1|647698_648235_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420814.1|648379_649297_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376610.1|649731_650742_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_155049733.1|651549_652041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376613.1|653298_653646_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275357.1|653790_654750_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376616.1|654851_655634_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243116.1|655766_656726_+	response regulator	NA	NA	NA	NA	NA
WP_017376619.1|656750_657155_-	RidA family protein	NA	NA	NA	NA	NA
WP_026063546.1|657183_657858_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_027243117.1|657957_659673_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016209558.1|659669_660032_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_026063550.1|660046_661201_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_017376622.1|661204_662212_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_017376623.1|662214_663231_+	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376624.1|663446_664532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376625.1|664638_665031_-	RidA family protein	NA	NA	NA	NA	NA
WP_027243118.1|665163_666447_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_027243119.1|666462_667764_+	aspartate kinase	NA	NA	NA	NA	NA
WP_144420721.1|669876_670869_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376630.1|670949_672026_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017376631.1|672123_673098_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_144420813.1|673165_674137_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376633.1|674320_674590_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_017376634.1|675191_676478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|676542_677223_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376024.1|682878_683127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816881.1|683204_683423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062365741.1|684106_684709_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.0e-10
WP_027242570.1|684922_686062_-	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_017376020.1|686270_687641_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_017376019.1|688019_689012_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376018.1|689015_689531_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376017.1|689527_690367_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_027242569.1|690399_691950_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376015.1|692057_692429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376011.1|693649_693811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|694391_695795_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375660.1|695829_696267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|696290_697265_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036774104.1|697323_697752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376321.1|697939_698746_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_017376322.1|698820_699213_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376323.1|699257_700079_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376324.1|700091_701075_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376325.1|701076_702345_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_048876074.1|702351_704856_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376328.1|704986_706012_+	phosphotransferase	NA	NA	NA	NA	NA
WP_017376329.1|706008_706719_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_080963653.1|706643_707474_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376331.1|707623_708007_+	response regulator	NA	NA	NA	NA	NA
WP_027242863.1|708041_708941_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_027242862.1|708986_709658_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_017376334.1|709740_710316_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_017376335.1|710414_711215_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376336.1|711356_712214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|713076_714213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242860.1|714279_717450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242859.1|717462_718173_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242858.1|718177_719485_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 7
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	728127	774434	3220407	plate,transposase	Staphylococcus_phage(21.43%)	52	NA	NA
WP_017376356.1|728127_728526_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_027242851.1|728522_730211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242850.1|730192_731149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|731191_731707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|731811_732744_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_017376360.1|732963_733350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376361.1|733367_734012_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_017376362.1|734162_735002_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.6	3.9e-16
WP_017376363.1|735077_735680_+	signal peptidase I	NA	NA	NA	NA	NA
WP_017376364.1|735680_736535_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_017376365.1|736892_737204_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017376366.1|737228_738617_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|738772_739504_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_027242849.1|739500_740028_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|740059_740617_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_027242848.1|740622_741603_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	3.5e-32
WP_016209539.1|741742_742543_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_017376369.1|742546_743314_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_017376370.1|743310_743775_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_017376371.1|743797_744451_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376372.1|744454_744802_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017376373.1|744835_745087_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|745164_746433_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027242847.1|746435_747194_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_017376376.1|747255_748146_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|748196_748880_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_017376377.1|748889_749237_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155049734.1|749509_751231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556468.1|751317_751620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376379.1|751611_752484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376380.1|752651_754481_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_017376381.1|754648_755290_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_144420811.1|755614_756061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|756078_756252_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_017376383.1|756310_757360_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_017376384.1|757366_758317_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_017376385.1|758371_759316_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_017376386.1|759343_760081_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|760169_760412_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|760486_761710_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_017376387.1|761741_762590_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_017376388.1|762586_763639_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_017376389.1|763775_764396_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	43.7	2.7e-38
WP_087910645.1|764621_765774_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_036771330.1|766794_767769_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046570.1|767765_767936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971647.1|768904_769501_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876071.1|769469_770630_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_017377691.1|771140_771482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377690.1|771585_772620_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|772616_773327_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_036771330.1|773459_774434_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 8
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	782594	839323	3220407	protease,tRNA,transposase	Prochlorococcus_phage(30.0%)	51	NA	NA
WP_017377942.1|782594_783101_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_155046572.1|783182_783605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243057.1|783690_784551_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420810.1|784648_785194_+	chorismate lyase	NA	NA	NA	NA	NA
WP_017377937.1|785276_786128_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_048876070.1|786169_789076_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|789136_789334_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_017377935.1|789340_790351_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_017377934.1|790347_791406_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_087910662.1|791420_792200_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027243055.1|792202_793015_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_017377933.1|793026_793974_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_144420809.1|793984_795277_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377931.1|795455_796559_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_017377930.1|796555_796948_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_027243054.1|796960_798337_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377929.1|798330_799800_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_053856762.1|799993_800428_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_087910651.1|800723_800900_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_027243053.1|801934_802960_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	30.5	4.5e-30
WP_155046573.1|803422_803854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774583.1|805246_805897_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046574.1|806595_807390_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876067.1|807569_808214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|808388_809363_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377920.1|809763_810021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420808.1|811698_812376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243155.1|812609_813434_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377914.1|813527_814241_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_017377913.1|814330_815422_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377912.1|815493_816075_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377911.1|816080_816707_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_026063691.1|816803_817751_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_065653730.1|818097_818760_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017377908.1|818930_819590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377907.1|819758_821018_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377906.1|821014_822100_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377905.1|822092_822974_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_027243154.1|822962_824213_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_144420719.1|825598_825919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|826177_826444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|826934_827153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420718.1|828138_828360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|828356_829439_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063690.1|829449_829821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773050.1|829817_829997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|832700_832976_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065653755.1|833811_835269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049735.1|835696_836332_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049736.1|837702_838311_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|838348_839323_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 9
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	886410	949287	3220407	tRNA,transposase	Staphylococcus_phage(28.57%)	52	NA	NA
WP_048875904.1|886410_887286_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376744.1|887542_887980_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_017376743.1|888040_888673_-	endonuclease III	NA	NA	NA	NA	NA
WP_017376742.1|888688_889336_-	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_027242971.1|889338_891402_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_027242972.1|891728_893021_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242973.1|893409_895620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242974.1|895636_896293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242975.1|898678_899554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420805.1|899812_900424_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_027242976.1|900851_903440_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
WP_017375712.1|903542_904304_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242977.1|904300_904837_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375710.1|904885_905842_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242978.1|905919_909105_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_017375707.1|909108_910164_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	1.5e-49
WP_027242979.1|910393_910996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375705.1|911039_911702_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017375704.1|911736_912084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375702.1|912552_913584_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|914046_915450_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242980.1|916568_916913_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027242981.1|917004_917460_+	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_144420715.1|917708_917843_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377756.1|917835_918477_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|918473_919190_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377754.1|919193_920513_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_155046577.1|921194_921356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377751.1|922317_924954_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	6.9e-99
WP_036773645.1|924995_926081_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377749.1|926080_926764_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_017377747.1|928926_929181_+	LapA family protein	NA	NA	NA	NA	NA
WP_017377746.1|929259_929577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377745.1|929729_930128_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242983.1|930209_930848_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_036771330.1|931004_931979_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420804.1|932351_932627_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|933176_933461_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772261.1|935277_935871_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243172.1|937027_937909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376527.1|938020_939700_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_017376526.1|939826_941077_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376525.1|941152_941614_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376524.1|941610_942759_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376523.1|942764_943439_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376522.1|943435_944092_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376521.1|944217_944691_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376520.1|944692_945115_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_047927196.1|945101_946121_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_155046578.1|946280_946460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243174.1|946678_946960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|948411_949287_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	953189	1020152	3220407	protease,tRNA,transposase	Bacillus_phage(20.0%)	57	NA	NA
WP_062365735.1|953189_954593_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|954951_955719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|955832_957236_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046579.1|957232_957394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|957709_958684_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376505.1|958924_960208_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376506.1|960274_961198_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376509.1|963393_965538_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_016210310.1|965559_965766_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376510.1|965826_966447_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_017376511.1|966487_967381_-	YicC family protein	NA	NA	NA	NA	NA
WP_016210308.1|967466_968192_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210305.1|968253_968658_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_027243115.1|968820_970929_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_017376514.1|971052_972102_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376515.1|972098_973565_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376516.1|973707_975045_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_047927029.1|975112_976603_-	nuclease	NA	NA	NA	NA	NA
WP_017376518.1|976831_977203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|977353_978181_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_027243112.1|978483_979140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927028.1|979087_980011_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036774751.1|980024_980948_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144420713.1|981177_981879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|983578_983806_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_016210338.1|983873_984011_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376989.1|984130_984679_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_017376990.1|984759_985035_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_027242882.1|985034_986084_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376991.1|986196_988134_-	AsmA family protein	NA	NA	NA	NA	NA
WP_080963631.1|988281_989994_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376994.1|990062_990782_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_017376995.1|990778_991381_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376996.1|991495_992383_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|992573_992921_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376997.1|992971_993811_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_017376998.1|993906_994653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063589.1|994849_995476_+	porin family protein	NA	NA	NA	NA	NA
WP_017377000.1|995791_996361_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017377001.1|996504_997203_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377003.1|997909_998533_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052106204.1|998642_999536_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377006.1|999642_1001253_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_027242880.1|1001249_1002545_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_027242879.1|1002566_1004489_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_017377007.1|1004599_1004902_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_017377008.1|1004996_1009883_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_047927528.1|1009930_1011253_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_036771855.1|1011377_1012472_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_027242877.1|1012523_1013462_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_026063591.1|1013542_1014127_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242876.1|1014511_1015402_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_017377014.1|1015604_1016096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242875.1|1016235_1016727_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1016895_1017609_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065653747.1|1017671_1019012_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_048875904.1|1019276_1020152_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	1025765	1087507	3220407	transposase	Burkholderia_virus(18.18%)	51	NA	NA
WP_017377787.1|1025765_1025993_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377021.1|1026019_1027060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377022.1|1027126_1027696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|1027926_1028331_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1028343_1028484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929560.1|1028578_1029778_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_016211971.1|1029798_1030410_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_027242871.1|1030611_1031373_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080963583.1|1031668_1032595_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_144420803.1|1032755_1033712_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999998.1|1033856_1034126_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1034392_1035367_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375625.1|1035520_1035748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420711.1|1035864_1036290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|1036446_1037376_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_027242870.1|1037822_1038353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420710.1|1038674_1038980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|1039457_1039769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963609.1|1040108_1041275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|1043462_1044434_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046581.1|1045036_1045210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376283.1|1045605_1046523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376284.1|1046523_1047375_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1047815_1048862_+	glutathione synthase	NA	NA	NA	NA	NA
WP_144420802.1|1048851_1050843_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_036773579.1|1050952_1051327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420801.1|1051580_1051763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|1052024_1052726_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420709.1|1052726_1053146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619460.1|1054799_1057583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376294.1|1057818_1059111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|1059597_1060503_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376296.1|1061280_1061997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1062282_1063044_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_048876053.1|1063076_1064480_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1064476_1064641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|1064700_1064988_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017375910.1|1065732_1066461_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017378201.1|1066542_1067214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|1068292_1069696_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242788.1|1071283_1074685_-	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_017378193.1|1074681_1077375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378192.1|1077678_1079178_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_027242789.1|1079844_1080666_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_155049741.1|1080737_1081181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1081371_1082775_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378188.1|1082771_1083842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242790.1|1084087_1086262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|1086284_1086965_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_036774233.1|1086993_1087227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1087279_1087507_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 12
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	1098543	1164241	3220407	transposase	Escherichia_phage(23.08%)	56	NA	NA
WP_075275340.1|1098543_1099152_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|1099682_1100558_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929548.1|1100798_1101473_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999996.1|1101501_1101990_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_080999997.1|1103035_1103470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375685.1|1103675_1104140_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049742.1|1104085_1104670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875941.1|1104753_1105065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927811.1|1105312_1106824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876046.1|1107784_1108078_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_144420706.1|1108035_1108614_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876047.1|1108699_1109575_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378015.1|1109567_1109924_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_017378014.1|1109932_1110328_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082300708.1|1111652_1112213_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046583.1|1113335_1115237_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_027243106.1|1115259_1116465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420707.1|1116467_1117766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243104.1|1117746_1118970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243103.1|1119019_1119820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155048038.1|1119816_1120179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243102.1|1120211_1120520_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|1120913_1121642_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377851.1|1121682_1122327_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377852.1|1122339_1122807_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1122861_1123836_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963625.1|1123865_1124483_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|1124461_1124923_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_017377856.1|1124966_1125902_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377857.1|1125929_1126925_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377858.1|1127138_1128101_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377694.1|1129240_1129969_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963626.1|1130019_1131654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|1131924_1133112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377863.1|1133713_1134151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|1136684_1136957_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_036772457.1|1137032_1137341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772454.1|1139816_1140134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1140290_1141265_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046685.1|1141261_1141681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876052.1|1141731_1142478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|1142446_1143175_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_036771639.1|1146143_1147118_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378207.1|1147826_1148582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378208.1|1148876_1150427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929877.1|1151209_1151833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929892.1|1152229_1155352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242785.1|1155784_1156801_+	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_146619548.1|1156819_1157374_+	chorismate mutase	NA	NA	NA	NA	NA
WP_036771347.1|1157392_1158370_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771342.1|1158532_1159633_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_027242782.1|1159678_1160761_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.4	4.5e-73
WP_080963651.1|1160753_1161314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771345.1|1161304_1162609_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027242784.1|1162662_1163211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|1163263_1164241_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
>prophage 13
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	1174087	1216314	3220407	transposase	Staphylococcus_phage(28.57%)	41	NA	NA
WP_053093677.1|1174087_1174807_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_155046584.1|1175034_1175211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375975.1|1175459_1175783_+	YqcC family protein	NA	NA	NA	NA	NA
WP_036771316.1|1175871_1177890_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375977.1|1177912_1178866_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375978.1|1179031_1180219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876036.1|1180932_1181571_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_036771312.1|1181868_1182864_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_155049763.1|1184363_1185173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|1185165_1186191_+	FUSC family protein	NA	NA	NA	NA	NA
WP_017375766.1|1186257_1188288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1189594_1189822_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375561.1|1191165_1191309_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062365727.1|1191305_1191998_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420703.1|1192258_1192582_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_027242770.1|1192724_1193135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242769.1|1193291_1193618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963649.1|1193764_1194802_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242767.1|1194843_1195089_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_129556541.1|1195213_1195528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242765.1|1195535_1197110_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_027242764.1|1197264_1197834_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242763.1|1198143_1199946_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_087910649.1|1199942_1200884_+	signal peptidase I	NA	NA	NA	NA	NA
WP_036771308.1|1200911_1201133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242761.1|1201295_1201970_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_144420798.1|1201975_1202875_+	GTPase Era	NA	NA	NA	NA	NA
WP_027242759.1|1202888_1203632_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_027242758.1|1203634_1204366_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242757.1|1204362_1204746_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242756.1|1204883_1206131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242755.1|1206541_1207687_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242754.1|1207679_1208033_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242753.1|1208313_1208856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927692.1|1209500_1209689_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1209708_1210683_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420702.1|1210726_1211602_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036815628.1|1211955_1212783_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080963648.1|1212882_1213044_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375762.1|1213694_1215035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1216086_1216314_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 14
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	1228138	1288788	3220407	tRNA,transposase	Staphylococcus_phage(40.0%)	56	NA	NA
WP_048876031.1|1228138_1229542_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242999.1|1230508_1231603_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_027242998.1|1231684_1232206_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	3.8e-25
WP_027242997.1|1232259_1232736_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_027242996.1|1232777_1233074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242995.1|1233138_1233846_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_027242994.1|1234222_1234621_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_027242993.1|1234666_1235098_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_027242992.1|1235108_1235792_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_016210285.1|1235866_1238062_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_027242991.1|1238166_1238904_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_027242990.1|1238931_1239717_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_027242989.1|1239762_1240467_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_087910648.1|1240454_1241642_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_027242987.1|1241696_1242530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242986.1|1242599_1245587_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_027242985.1|1245628_1247020_+	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_080963581.1|1247033_1247495_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_047927184.1|1247504_1247849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1247845_1248721_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876030.1|1248790_1249894_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774087.1|1249961_1250285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242984.1|1250441_1251224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063491.1|1251359_1252337_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_047927375.1|1252410_1254402_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_017375900.1|1254457_1254739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1254992_1256192_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_051929862.1|1258623_1259136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1259322_1260198_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375562.1|1260234_1260399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1261607_1262021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774270.1|1262031_1262367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420796.1|1262511_1263630_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876026.1|1263859_1264126_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1265408_1265636_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773258.1|1265646_1266153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243127.1|1266230_1266848_-	VOC family protein	NA	NA	NA	NA	NA
WP_017376680.1|1266979_1268212_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_017376681.1|1268201_1268864_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_026063554.1|1269138_1270395_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_087910647.1|1270532_1271192_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376683.1|1271266_1271968_+	cyclase family protein	NA	NA	NA	NA	NA
WP_036771330.1|1272715_1273690_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376688.1|1274898_1275252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1275465_1275660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1275727_1276240_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376691.1|1276377_1277232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1277280_1277925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1277958_1278603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653744.1|1279143_1279419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376695.1|1279517_1280300_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_017376696.1|1280382_1281333_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_027243124.1|1283375_1286216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376700.1|1286238_1286820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376701.1|1286939_1287668_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_036771330.1|1287813_1288788_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 15
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	1294199	1360599	3220407	transposase	Staphylococcus_phage(20.0%)	56	NA	NA
WP_080999995.1|1294199_1295570_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376714.1|1296254_1296908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242970.1|1296967_1298947_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_026063557.1|1299077_1299896_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_087910646.1|1299980_1301105_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_026063558.1|1301107_1301674_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	2.8e-74
WP_017375873.1|1302865_1303027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875857.1|1303698_1304673_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017375871.1|1304897_1305446_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_144420795.1|1305573_1306251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242968.1|1306367_1309859_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_017375867.1|1309916_1311170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375866.1|1311279_1312182_-	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	3.2e-56
WP_017375865.1|1312236_1313274_-	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_017375864.1|1313411_1314650_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_047927270.1|1314642_1315368_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	6.4e-31
WP_017375862.1|1315471_1317199_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016211829.1|1317499_1317853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375861.1|1318549_1319050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876023.1|1319389_1320493_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_087910645.1|1320583_1321736_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876022.1|1322149_1323001_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420700.1|1323138_1323288_-	phosphatase	NA	NA	NA	NA	NA
WP_017377952.1|1323912_1326279_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_017377953.1|1326326_1327523_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_027242965.1|1328091_1330524_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036773041.1|1330845_1332345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242964.1|1332453_1333026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|1333340_1334810_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017377960.1|1334882_1335632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876021.1|1335635_1336409_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_027242961.1|1336507_1337458_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017377963.1|1337597_1339040_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242960.1|1339255_1340440_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377966.1|1340563_1341250_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_026063694.1|1341385_1341970_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_144420699.1|1342059_1342389_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017377969.1|1342724_1342964_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_017377970.1|1343012_1343204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275334.1|1343978_1344272_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420698.1|1344420_1344582_-	phosphatase	NA	NA	NA	NA	NA
WP_017378162.1|1345096_1345636_-	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1345974_1346619_-	porin family protein	NA	NA	NA	NA	NA
WP_017378160.1|1346952_1347603_-	porin family protein	NA	NA	NA	NA	NA
WP_017378159.1|1348126_1349179_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378158.1|1349196_1352277_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242571.1|1352442_1352691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|1352756_1353632_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772025.1|1354554_1355061_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027243218.1|1355078_1355276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1355294_1355438_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155046586.1|1355505_1355679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1355883_1357197_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000010.1|1357206_1357470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1357528_1358503_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377787.1|1360371_1360599_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 16
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	1391816	1440715	3220407	tRNA,transposase	Bacillus_thuringiensis_phage(25.0%)	39	NA	NA
WP_155049743.1|1391816_1392692_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242912.1|1392796_1396099_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_017376668.1|1396095_1397919_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_017376669.1|1397958_1398357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242911.1|1398465_1399482_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_027242910.1|1399916_1401371_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376672.1|1401452_1404509_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_017376673.1|1404505_1404742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376676.1|1406403_1406868_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075275332.1|1406940_1407942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771585.1|1410834_1411167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420693.1|1411528_1411672_-	phosphatase	NA	NA	NA	NA	NA
WP_048876152.1|1411659_1412604_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420692.1|1412607_1412997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275328.1|1412815_1413154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376273.1|1413528_1414128_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017376274.1|1414127_1414475_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_026063520.1|1414625_1415609_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376276.1|1416518_1416833_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_144420691.1|1416981_1417140_-	phosphatase	NA	NA	NA	NA	NA
WP_144420690.1|1417111_1418041_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_026063521.1|1418955_1419372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1420500_1421217_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376099.1|1421965_1422124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1422172_1422748_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_075275424.1|1422892_1423171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376100.1|1423235_1424111_-	ParA family protein	NA	NA	NA	NA	NA
WP_048876018.1|1424276_1428143_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376103.1|1428298_1429108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376104.1|1429157_1429979_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376105.1|1430178_1431411_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376106.1|1431581_1432307_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376107.1|1432349_1433888_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376108.1|1433894_1435280_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_048876011.1|1435593_1436643_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1437202_1437580_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155049744.1|1437771_1438680_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1439916_1440144_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876149.1|1440196_1440715_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	1445013	1631931	3220407	protease,tRNA,integrase,transposase	Staphylococcus_phage(19.51%)	167	1552681:1552740	1580434:1581191
WP_048875984.1|1445013_1445550_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876016.1|1445694_1446105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375877.1|1446375_1446624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876014.1|1446984_1447320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375878.1|1447657_1447930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243180.1|1448001_1449261_-	phosphoesterase	NA	NA	NA	NA	NA
WP_017375881.1|1449345_1450611_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	1.2e-48
WP_026063485.1|1450769_1451252_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_036772592.1|1451329_1452790_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.4	2.3e-56
WP_155046587.1|1452912_1453053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063486.1|1453466_1453967_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_017375698.1|1460081_1461275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243221.1|1461618_1463247_+	cytochrome d terminal oxidase subunit I	NA	NA	NA	NA	NA
WP_027243222.1|1463262_1464411_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_051929845.1|1464485_1465310_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1465713_1466688_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927610.1|1466873_1467467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1467647_1468112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910660.1|1468506_1468788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1468784_1470188_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377324.1|1470839_1471220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1471459_1472116_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_036773200.1|1472260_1472557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1472616_1472904_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_036772296.1|1474093_1474471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1474670_1475720_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377209.1|1475696_1477514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1477784_1478363_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_065653751.1|1478390_1478855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377206.1|1478891_1480349_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_027243048.1|1480410_1481898_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377202.1|1482667_1483270_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_017377201.1|1483831_1484302_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_036772316.1|1485949_1486693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275422.1|1486844_1487276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243044.1|1489913_1491260_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_036772310.1|1491347_1493153_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_017378301.1|1493618_1494416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378302.1|1494800_1495262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1495484_1496459_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963614.1|1496501_1496624_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376833.1|1496695_1498651_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1499040_1499226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376832.1|1499547_1500537_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_027243043.1|1500949_1502575_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376830.1|1502683_1502998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1503293_1504679_+	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376829.1|1504843_1505071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1505211_1505670_-	amino acid permease	NA	NA	NA	NA	NA
WP_144420685.1|1505870_1506056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1506124_1506952_-	DsbA family protein	NA	NA	NA	NA	NA
WP_144420792.1|1507406_1507931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420684.1|1508113_1508362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243041.1|1508531_1509485_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_036771330.1|1509679_1510654_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876009.1|1510781_1511807_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1512459_1512747_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929542.1|1512806_1513139_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081377820.1|1513343_1513904_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
WP_017376814.1|1516498_1517224_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_026063564.1|1517598_1520418_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	5.2e-312
WP_048876146.1|1521267_1522401_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	2.6e-15
WP_017376809.1|1522625_1524395_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_017376808.1|1524533_1525577_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376807.1|1525590_1526334_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_027243093.1|1526446_1526764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|1526825_1527005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243094.1|1527067_1527775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420791.1|1528558_1529770_+	protein kinase	NA	NA	NA	NA	NA
WP_017376801.1|1529825_1530650_-	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_017376798.1|1531837_1532473_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017376797.1|1532754_1533114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|1533387_1535673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420683.1|1535661_1536318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243096.1|1536494_1537127_+	MarC family protein	NA	NA	NA	NA	NA
WP_155049745.1|1537162_1537339_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_027243098.1|1537413_1538559_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_027243099.1|1538794_1540108_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
WP_155046588.1|1541223_1541433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420682.1|1541967_1542129_-	phosphatase	NA	NA	NA	NA	NA
WP_017376785.1|1543535_1544441_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376784.1|1544681_1544867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242578.1|1544903_1545440_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_027242577.1|1545457_1546759_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_048876008.1|1546755_1547730_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_144420681.1|1547773_1547959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046590.1|1548138_1548303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1548304_1549180_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046590.1|1549470_1549635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1549636_1550512_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420680.1|1550827_1551748_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_017375696.1|1551763_1552147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1552473_1553430_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
1552681:1552740	attL	ATTGAAGAGCTTCAGCTTTATCGGCGCTGTAAGGAGCTTTTTAAAGAAAGTCGCGGCAGC	NA	NA	NA	NA
WP_027243017.1|1554186_1555530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046591.1|1555703_1555847_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1555926_1556901_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927346.1|1557048_1558920_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_075275322.1|1558952_1559051_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017378518.1|1559286_1559916_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017378517.1|1559899_1560322_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378516.1|1560328_1562068_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378515.1|1562068_1563133_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1563136_1563490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1563622_1564591_+	ferrochelatase	NA	NA	NA	NA	NA
WP_017378513.1|1564600_1564912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1564927_1565497_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378512.1|1565760_1567089_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_036771639.1|1567129_1568104_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420677.1|1568690_1569092_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_146619459.1|1569611_1572068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773893.1|1572270_1573122_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275420.1|1573167_1574874_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_069971648.1|1576345_1577320_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_047927336.1|1577682_1577928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653736.1|1578291_1579320_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017375591.1|1579450_1579654_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155049746.1|1580406_1581183_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	3.2e-44
WP_047927838.1|1581475_1581721_+	hypothetical protein	NA	NA	NA	NA	NA
1580434:1581191	attR	ATTGAAGAGCTTCAGCTTTATCGGCGCTGTAAGGAGCTTTTTAAAGAAAGTCGCGGCAGCTTAGGATCACGAATGATGGCATATAAACTTCAAGAAGAAGGCTTTCAAGTAGGCCGTTATCGGGCGAGAAGCCTAATGCAAAAACTCGGTTTAAAGGTGCTGCAACGTAAAGCTTATAAAGTGACAACTAAGCGTAAGCACCATCACGCTGTTGCAGATAACGTATTGAATCAGCAGTTTAATCCAGTCATTGCAAATCACTCATGGGCAGGTGACATTACCTACCTTAGAACTGCTGAAGGCTGGTTGTATCTTGCGGTCGTTATTGATTTATACTCTCGAAAAGTGATTGGCTGGGCGATGAATAAGAGAATGAGCGAAAATCTAGTTTGTCGTGCAATGGATATGGCGATTCACTTGCGGCAGCCGACAGAACACTTGTTATTTCACAGTGATCGTGGTTCGCAGTATACCAGTAAAAAATATCGAAAACTGTTGAAGAAGCATAAAATCACCGCTTCTATGAGCAGTGTCGGTGCTTGCGTTGACAATGCGGTTGTCGAGCGTTTTTTTGGCAGCCTAAAGCACGAATGGCTGTTGAATGTGATTCACTTAACCCGTGATACTATGAAGGAGGATGTTGAGGCCTATATTCGATATTACAATCATGATCGGTTGCATACAGCCAATGGTAACCTATCGCCTATTAATTTTGAAAAGTCTCAATTAAAAGTGTCCAATATGACTTGACCAGAACA	NA	NA	NA	NA
WP_016212018.1|1581717_1582017_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_036774927.1|1582239_1582710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1583320_1583548_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036772851.1|1584770_1585088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243023.1|1585081_1585324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243024.1|1585674_1586775_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_017377328.1|1586943_1588245_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_047927520.1|1588321_1588825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1589000_1590404_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772872.1|1590591_1591449_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243025.1|1591573_1592209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1592257_1592509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243027.1|1592764_1593664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1593800_1594874_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017375995.1|1594974_1595388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375994.1|1595408_1596122_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_027243028.1|1596309_1597722_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243029.1|1597931_1598900_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_075275321.1|1599633_1600002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420675.1|1600005_1600323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1600398_1601373_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375989.1|1601892_1602393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243163.1|1602463_1603792_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036773519.1|1603927_1605316_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243165.1|1605463_1606774_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|1607114_1608398_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_017375982.1|1608471_1609092_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_051929832.1|1609290_1609551_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155046592.1|1609753_1609900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876006.1|1609875_1610469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816364.1|1612332_1612551_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772303.1|1613803_1614574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420790.1|1614660_1614876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376496.1|1614972_1616094_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_036771330.1|1616360_1617335_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771628.1|1617597_1618719_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_017376491.1|1619011_1619299_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1619271_1619775_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_053093673.1|1619855_1620515_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876005.1|1620856_1621774_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_075275317.1|1621903_1622077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1622742_1624101_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_144420789.1|1624292_1624739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376485.1|1624933_1626163_-	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_017376484.1|1626208_1626835_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_027242833.1|1626984_1628172_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_048876004.1|1628180_1628873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910642.1|1628994_1630147_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876002.1|1630947_1631931_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
>prophage 18
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	1690554	1781157	3220407	protease,tRNA,transposase	Burkholderia_phage(14.29%)	82	NA	NA
WP_036774017.1|1690554_1691430_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377182.1|1691819_1692158_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_026063604.1|1692154_1692751_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_027242821.1|1692753_1694748_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_017377185.1|1694811_1695750_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_036771332.1|1696098_1697073_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_080999986.1|1697276_1697474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000007.1|1697635_1698040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816928.1|1699623_1700064_+	universal stress protein	NA	NA	NA	NA	NA
WP_048875996.1|1700390_1701266_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420669.1|1701278_1701521_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275315.1|1701927_1702182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1703393_1704359_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420668.1|1704451_1704763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1704963_1705740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816899.1|1706569_1706761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377573.1|1707489_1708539_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_017377574.1|1708709_1709483_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377575.1|1709543_1711133_-	APC family permease	NA	NA	NA	NA	NA
WP_017377576.1|1711323_1712415_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377577.1|1712437_1712755_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377578.1|1712841_1714119_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377579.1|1714140_1714977_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377580.1|1714983_1716618_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_026063647.1|1717049_1717409_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377583.1|1717690_1719049_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_017377584.1|1719074_1719317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|1719810_1719990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|1720245_1721502_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377585.1|1721615_1721873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420667.1|1722017_1723028_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_144420786.1|1723404_1724259_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|1724288_1725122_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420666.1|1725695_1726472_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_047927606.1|1726553_1726874_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_144420665.1|1727092_1727998_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_048875992.1|1728083_1728482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049748.1|1728626_1729181_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047927093.1|1731072_1732176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929549.1|1732274_1732652_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1732731_1733706_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_080999985.1|1735250_1735970_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1736053_1736341_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420664.1|1736625_1737498_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_048875990.1|1737454_1738231_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036816484.1|1738435_1738771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963600.1|1739169_1739526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377440.1|1739687_1739963_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_017377441.1|1740072_1740420_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377442.1|1740437_1741217_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377443.1|1741216_1741726_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|1741761_1742010_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377444.1|1742321_1742657_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_017377445.1|1742956_1744207_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242820.1|1744288_1746316_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377447.1|1746861_1747080_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242819.1|1747251_1747614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|1747762_1749166_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242818.1|1749447_1750623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377453.1|1750640_1752638_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242817.1|1752618_1753599_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075275308.1|1753654_1754497_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_027242816.1|1754496_1754901_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275307.1|1754893_1755313_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017377459.1|1755335_1755965_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017377460.1|1756533_1758723_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377461.1|1758734_1759940_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_080963599.1|1759924_1761772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106215.1|1761756_1762995_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242814.1|1762981_1764850_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_027242813.1|1764883_1766137_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017377465.1|1766142_1767000_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_017377694.1|1767018_1767747_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_081078114.1|1768885_1769677_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017376231.1|1770042_1770330_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017376477.1|1772452_1772842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376476.1|1773018_1773777_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_036772166.1|1773773_1776173_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_027242812.1|1776186_1777464_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_017376475.1|1777553_1778852_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_017376474.1|1779049_1779943_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_027242811.1|1779942_1781157_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 19
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	1791856	1842341	3220407	tRNA,transposase	Vibrio_phage(14.29%)	46	NA	NA
WP_069971651.1|1791856_1792732_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376461.1|1793104_1793368_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_017376460.1|1793674_1796269_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376459.1|1796265_1796748_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_017376458.1|1796725_1797766_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376457.1|1797940_1798426_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376456.1|1798533_1801104_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376455.1|1801137_1801599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773947.1|1801935_1802811_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376452.1|1803088_1804849_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_017376451.1|1804942_1805608_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376450.1|1805620_1807126_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376449.1|1807147_1807678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376448.1|1807751_1809014_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376447.1|1809200_1810073_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_026063532.1|1810174_1810963_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376445.1|1811055_1812381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376444.1|1812734_1813910_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376443.1|1814078_1814732_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376442.1|1814887_1816828_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_036773538.1|1816824_1817448_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036773116.1|1817612_1818587_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_075275305.1|1818858_1819479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1819475_1820879_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910640.1|1820946_1821363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875986.1|1821770_1822268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1822264_1823239_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046598.1|1823318_1823888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1824032_1824569_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375549.1|1824573_1824870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1824878_1825484_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017378212.1|1825669_1826068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1826258_1826462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046599.1|1826606_1826762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378213.1|1826886_1827339_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017378214.1|1827455_1828928_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_016211840.1|1829366_1829831_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_144420785.1|1830519_1831770_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_017378219.1|1831879_1832350_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_047927040.1|1832372_1832966_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_027242798.1|1833103_1834153_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_017378221.1|1834176_1835100_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1835116_1835578_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378223.1|1835685_1836504_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155046600.1|1837113_1837257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378228.1|1841420_1842341_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 20
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	1912722	1989258	3220407	tRNA,transposase	uncultured_Mediterranean_phage(14.29%)	64	NA	NA
WP_017378288.1|1912722_1912944_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1913002_1913977_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046582.1|1914175_1914340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|1914336_1914972_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420659.1|1915248_1916028_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420658.1|1916060_1916822_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_075275303.1|1916798_1917788_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378290.1|1917923_1918799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|1918817_1919477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927801.1|1919718_1920165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1920161_1921565_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378294.1|1921678_1922524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1922668_1924318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378296.1|1924408_1925194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875980.1|1926634_1928038_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927313.1|1928843_1931774_-	peptidase M16	NA	NA	NA	NA	NA
WP_027242809.1|1931917_1933876_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.2	2.5e-45
WP_144420783.1|1934069_1934717_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377496.1|1934772_1936098_+	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.3e-37
WP_075275301.1|1936132_1936402_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_017375667.1|1936672_1937158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036817939.1|1937646_1937835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777920.1|1938144_1938378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242807.1|1938819_1939308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242806.1|1939437_1940406_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_027242805.1|1941112_1944439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377489.1|1944497_1945535_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377488.1|1945739_1947653_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.6	1.8e-117
WP_017377487.1|1947704_1948352_-	hypothetical protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_017377486.1|1948463_1949588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377485.1|1949584_1950181_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_016209821.1|1950211_1950544_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_027242804.1|1950646_1952500_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	2.2e-43
WP_027242803.1|1952946_1954659_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	2.5e-25
WP_036772905.1|1954867_1955221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420657.1|1956711_1957773_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420656.1|1958484_1958646_+	phosphatase	NA	NA	NA	NA	NA
WP_017376418.1|1959562_1960102_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_017376419.1|1960484_1960901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|1960996_1961812_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376421.1|1961944_1963438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|1963623_1964049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376423.1|1964045_1966106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376424.1|1966389_1967205_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376425.1|1967305_1968124_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_027242802.1|1968120_1968489_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_075275409.1|1968670_1969498_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|1969561_1970290_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1970692_1971421_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017376428.1|1971810_1972536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875975.1|1972570_1976443_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376430.1|1976643_1977777_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_026063530.1|1977790_1977979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376433.1|1978202_1979561_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_081078111.1|1981167_1981920_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875973.1|1982842_1983478_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999981.1|1983490_1983964_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_155046603.1|1983891_1984044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929627.1|1984237_1984588_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1984647_1984935_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420654.1|1984987_1985767_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376415.1|1986191_1987109_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376414.1|1987160_1987916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242801.1|1987983_1989258_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
>prophage 21
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	1996415	2059457	3220407	transposase,tRNA	Klosneuvirus(18.18%)	55	NA	NA
WP_026063528.1|1996415_1997531_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376405.1|1997715_1998756_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_027242800.1|1998758_1999793_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_017376402.1|1999789_2000851_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_017376401.1|2000962_2002435_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
WP_017376400.1|2002587_2003031_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017376399.1|2003099_2005871_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
WP_017376398.1|2006027_2007260_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|2007501_2008164_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_017376397.1|2008623_2010105_+	MFS transporter	NA	NA	NA	NA	NA
WP_036773116.1|2010302_2011277_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376395.1|2011800_2014527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|2015414_2016389_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_051929562.1|2016639_2017344_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377436.1|2018583_2019102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242883.1|2020069_2021554_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_017377433.1|2021678_2023214_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017377432.1|2023236_2023566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963636.1|2023462_2023678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910639.1|2025661_2026861_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017377428.1|2027070_2027931_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_155049757.1|2028046_2028541_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_017377426.1|2029069_2029711_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	3.3e-07
WP_017377425.1|2029749_2029971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377424.1|2029963_2030947_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	6.2e-53
WP_080963565.1|2031340_2031838_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026063633.1|2031982_2032258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377423.1|2032409_2034092_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.1e-24
WP_017377422.1|2034099_2035122_-	YHYH protein	NA	NA	NA	NA	NA
WP_017377421.1|2035290_2036292_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_017377420.1|2036405_2036744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377419.1|2037219_2038479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2038687_2038915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420653.1|2038943_2039162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772807.1|2039299_2039665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772810.1|2039732_2039975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242887.1|2039989_2040325_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_017377418.1|2040329_2040767_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_017377417.1|2040792_2042178_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_036772815.1|2042288_2042720_-	flaG family protein	NA	NA	NA	NA	NA
WP_144420782.1|2042825_2044337_-	B-type flagellin	NA	NA	NA	NA	NA
WP_017377414.1|2044627_2046220_-	flagellin	NA	NA	NA	NA	NA
WP_027242888.1|2046420_2048616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242889.1|2048709_2050143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927084.1|2050185_2050701_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036772822.1|2050700_2051648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242892.1|2051631_2052297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242893.1|2052293_2053022_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047927085.1|2053011_2053758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963566.1|2053741_2054806_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_017377789.1|2055010_2056198_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377788.1|2056254_2057373_-	hypothetical protein	NA	A0A1V0SIK8	Klosneuvirus	29.3	1.0e-11
WP_047927086.1|2057820_2058078_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
WP_144420652.1|2058357_2059035_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_017375591.1|2059253_2059457_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	2079157	2128980	3220407	protease,tRNA,transposase	Burkholderia_virus(20.0%)	42	NA	NA
WP_017377787.1|2079157_2079385_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377765.1|2079474_2080230_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377764.1|2080643_2081240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377763.1|2081319_2084124_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377762.1|2084104_2085058_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377761.1|2085050_2086421_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_080999971.1|2086591_2087995_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275295.1|2088766_2089093_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420651.1|2089297_2089951_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_017376600.1|2090270_2090450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|2090705_2091962_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999979.1|2092200_2092347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081049196.1|2092429_2092786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|2093281_2093641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375623.1|2093650_2094034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|2094922_2095063_+	phosphatase	NA	NA	NA	NA	NA
WP_048875965.1|2095207_2096128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377998.1|2098285_2098816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243145.1|2098826_2099882_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_036773465.1|2099897_2101937_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_017378003.1|2101923_2102754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378004.1|2102820_2106360_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378005.1|2106473_2107193_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378006.1|2107431_2108061_+	response regulator	NA	NA	NA	NA	NA
WP_048875961.1|2108180_2109584_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378007.1|2109729_2111673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|2112190_2113051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|2113486_2115232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420648.1|2115634_2117107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|2117289_2117889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|2118026_2118224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|2118424_2118565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875964.1|2118632_2119412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|2119976_2120378_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773793.1|2120522_2120900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|2121359_2122667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155048058.1|2123215_2123398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619530.1|2123703_2123961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2124012_2125416_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377869.1|2125656_2127366_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377870.1|2127535_2127898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2128005_2128980_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 23
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	2143549	2185307	3220407	protease,transposase,tRNA	unidentified_phage(18.18%)	40	NA	NA
WP_017377892.1|2143549_2144971_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_026063687.1|2145060_2146659_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377894.1|2146815_2147442_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_027242839.1|2147522_2150195_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377896.1|2150677_2151634_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_017377897.1|2151686_2152106_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_048875958.1|2152132_2152996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377899.1|2152985_2153777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|2154081_2155053_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375746.1|2155401_2155710_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_048875957.1|2155706_2156363_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375749.1|2156496_2156982_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_017375750.1|2157059_2157581_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375751.1|2157626_2158520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|2158516_2159338_-	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_155046605.1|2159532_2159682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|2159909_2160740_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046606.1|2162145_2162316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242841.1|2162468_2163872_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_048875956.1|2163981_2165223_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080963644.1|2165209_2165941_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_017376088.1|2165952_2167230_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_017376087.1|2167329_2167704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376086.1|2167788_2168676_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376085.1|2168733_2169462_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_036771725.1|2169458_2170568_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376083.1|2170719_2171148_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_144420777.1|2171242_2171599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376081.1|2171591_2172803_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376080.1|2172799_2173588_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376079.1|2173750_2174545_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376078.1|2174994_2175735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376077.1|2175738_2178237_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376076.1|2178499_2179456_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_036771709.1|2179439_2180201_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_048875955.1|2180408_2181383_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_048875954.1|2181491_2182247_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2182371_2182617_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_017376072.1|2182676_2184950_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_036772670.1|2185004_2185307_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
>prophage 24
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	2191367	2256706	3220407	tRNA,transposase	Burkholderia_virus(16.67%)	57	NA	NA
WP_036772169.1|2191367_2192243_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876123.1|2192312_2194493_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_017376060.1|2194596_2195946_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_036772012.1|2196019_2196709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|2196841_2198029_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376055.1|2198547_2199192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|2199188_2200502_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|2200706_2200880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|2201149_2201623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420642.1|2201767_2201962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|2202226_2203102_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016210558.1|2203288_2204044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376051.1|2204117_2205770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376050.1|2205809_2207348_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	2.1e-71
WP_087910638.1|2207347_2209048_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_075275404.1|2209136_2210312_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_017376046.1|2210350_2211313_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_017376045.1|2211590_2212013_-	universal stress protein	NA	NA	NA	NA	NA
WP_017376044.1|2212318_2212960_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017376043.1|2213088_2214423_+	dihydroorotase	NA	NA	NA	NA	NA
WP_048875952.1|2214537_2215173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771517.1|2215917_2217054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771498.1|2217237_2218968_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_017376037.1|2218957_2220166_+	MFS transporter	NA	NA	NA	NA	NA
WP_075275290.1|2220264_2221266_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420641.1|2221509_2222145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2222164_2223139_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875951.1|2223182_2224019_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376035.1|2224164_2224584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|2224860_2225541_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875949.1|2225506_2225857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376032.1|2225889_2227101_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376031.1|2227441_2228071_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376030.1|2228119_2229136_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_016211035.1|2229382_2229598_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376029.1|2229650_2230100_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_027243175.1|2230179_2231925_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376026.1|2232016_2233888_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_053093667.1|2234332_2235049_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378197.1|2236486_2237356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2237312_2237540_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378198.1|2238508_2239423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875948.1|2239468_2240491_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_048875947.1|2240559_2241609_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046689.1|2242231_2242408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243219.1|2242692_2243001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2243167_2244571_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046608.1|2244663_2244828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771959.1|2245149_2245374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|2245384_2246596_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_155049758.1|2247095_2247890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375571.1|2248063_2248465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|2248711_2249755_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376859.1|2249874_2250111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376860.1|2250899_2252453_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_082300723.1|2254633_2254861_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971648.1|2255731_2256706_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
>prophage 25
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	2263511	2392432	3220407	integrase,protease,transposase	Staphylococcus_phage(23.08%)	104	2290822:2290881	2341243:2342003
WP_144420638.1|2263511_2264594_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2264590_2264902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2265947_2266922_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999976.1|2267640_2268420_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|2268881_2270099_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275285.1|2270274_2271711_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211781.1|2271933_2273181_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036773927.1|2273692_2274328_-	peroxiredoxin C	NA	NA	NA	NA	NA
WP_017377683.1|2274879_2276382_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_144420775.1|2276440_2280205_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_017377681.1|2280353_2281532_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.6	7.7e-50
WP_027243160.1|2281819_2282350_-	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_017377679.1|2282447_2282654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2282969_2284052_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2284048_2284360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243152.1|2285857_2286793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774146.1|2287385_2288531_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_048875940.1|2290773_2291937_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
2290822:2290881	attL	GTCTTAGAGGTCATTGAAGGAGATCAGACGCTCAACCAAATATGCTCGAAATATGAGCTA	NA	NA	NA	NA
WP_144420637.1|2291965_2292190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|2293537_2294713_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420636.1|2295058_2297569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|2297627_2298440_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377669.1|2298880_2299585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2299634_2300609_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420634.1|2300713_2302045_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420774.1|2302243_2302312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375857.1|2302443_2303886_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420773.1|2304277_2305690_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375855.1|2306379_2306826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|2307420_2308269_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017376916.1|2308522_2309581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927497.1|2309572_2311279_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_036774028.1|2311350_2313084_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_017376912.1|2313380_2313947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376911.1|2314071_2314725_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_027243158.1|2314751_2316212_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376909.1|2316308_2317286_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_048875878.1|2317755_2319159_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063577.1|2319684_2319978_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_026063576.1|2320204_2320969_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_017376905.1|2321176_2321404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|2321467_2321650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376903.1|2322212_2322392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376902.1|2322455_2322767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|2323621_2324326_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376899.1|2324523_2324664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772665.1|2325068_2325593_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069971672.1|2325739_2326996_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|2327063_2327543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2327983_2329387_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243186.1|2329801_2332183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377475.1|2332689_2334582_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_036771639.1|2334753_2335728_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377472.1|2336031_2336838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377471.1|2336906_2337518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377467.1|2338999_2339296_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_075275282.1|2339292_2340135_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|2340525_2341311_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_080999974.1|2341315_2342719_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2341243:2342003	attR	TAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCCTTCAATGACCTCTAAGACTAATGGCACTACCTTAAGGAGCGGATGAACATTTTTTATTGCTATTTTTCTTCATTCTTTTAGTTATTTCTGCCTTTTCCAATTCCCTGCTTTTATTCAGTCGCCTGAATGCTTTGGGACGTTTTTTAACAGCCCGAGGTTCAATCCGTCCAGGCCTATTCCCAACCTTGTTTTTTATGATTGCATGCAACAATATTGCATGGGCTTTATTACAGTCTGCCGAGAAACTGAGTAATGACACAAAGCTATTAAATAACTGTATTACATCCTTGAAACTAACCTGTATAGGAAGGCGTTCAGTATTACGACAAGCTTCTGCAATAAGCGTTCTAATTAAGTTGTATGCTAAAAAGTGTACTGCAATTTCTTTATGTACCATGTCAGGTGTCTTACTTCTTAAATGATCCATTGACATAATGGTTTTTAAGCTGTTGAAATTGATTTCAATGTGCCACCTTTGTTTGTAATGATTAGCCAATGCAACTTTATTGTATTTTTTATGATCTTGAAAAGTTGTTACATAAACCTCCCCTTTGATTTTGAACTCTCTTACCGTCATTTGATCAGGATAACTATCGTATGTTTCTTGTGTCATCCAGTCAGGTTTGTGAGGCTTTTTCCAAATGACAAGGTGATTTTTTGAACCCAACTTCCTTCCTTTACGAAAGTCATACTTCCTCTGTGAATGTGCTTTAAAAATA	NA	NA	NA	NA
WP_048875933.1|2342992_2343937_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420772.1|2344573_2345452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275281.1|2345722_2345959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420630.1|2346103_2346439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377319.1|2346583_2346784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063623.1|2346890_2348405_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_017377317.1|2348531_2349560_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_017377316.1|2349616_2350759_+	galactokinase	NA	NA	NA	NA	NA
WP_017377315.1|2350893_2352597_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.0	3.4e-22
WP_017377314.1|2352593_2354714_+	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_017377313.1|2354710_2356060_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_048875932.1|2356031_2358179_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.2	3.1e-25
WP_017377309.1|2358602_2358998_+	CrcB family protein	NA	NA	NA	NA	NA
WP_017377308.1|2359006_2359891_-	hypothetical protein	NA	A0A1W6JP29	Morganella_phage	35.7	2.2e-41
WP_075275280.1|2359922_2361821_-	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_016209655.1|2361903_2362176_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_017377306.1|2362279_2364712_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	1.2e-219
WP_017377305.1|2364779_2366081_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_016209647.1|2366162_2366768_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377304.1|2366880_2368185_-	trigger factor	NA	NA	NA	NA	NA
WP_017377303.1|2368785_2369661_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_075275279.1|2369776_2370448_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377301.1|2370627_2371983_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_017377300.1|2372103_2372841_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_144420629.1|2372919_2373636_-	aldolase	NA	NA	NA	NA	NA
WP_036771756.1|2374284_2375559_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2375589_2376165_+	VOC family protein	NA	NA	NA	NA	NA
WP_017377295.1|2376209_2377175_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_027243030.1|2377638_2378547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046610.1|2378859_2379186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377293.1|2379330_2379759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|2379744_2380689_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046611.1|2380893_2381046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910637.1|2381074_2381809_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_017377288.1|2381903_2382164_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999973.1|2382382_2383348_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_146619452.1|2383324_2383621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|2383811_2384261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|2384520_2384949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|2385044_2385545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|2385481_2385643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420627.1|2386523_2386745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093666.1|2388243_2388921_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_081377824.1|2390235_2390574_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2391457_2392432_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 26
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	2431479	2464928	3220407	tRNA,transposase	Burkholderia_virus(33.33%)	23	NA	NA
WP_080999971.1|2431479_2432883_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377224.1|2432996_2433572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|2434817_2435045_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377221.1|2435334_2435874_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_027243151.1|2436183_2437671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300719.1|2437722_2438148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2438366_2439770_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377217.1|2439766_2440144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243150.1|2440103_2440649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|2441044_2442271_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377214.1|2442871_2444524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046613.1|2444460_2444655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963645.1|2444987_2446178_-	MFS transporter	NA	NA	NA	NA	NA
WP_027243147.1|2446426_2449099_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_027243146.1|2449387_2450224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420769.1|2450884_2451775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2452243_2453218_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876012.1|2453702_2455106_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|2455251_2456655_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155049759.1|2456739_2458560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999970.1|2460465_2461869_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376197.1|2461902_2463432_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_017376198.1|2463467_2464928_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 27
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	2500379	2553050	3220407	tRNA,transposase	Burkholderia_virus(33.33%)	52	NA	NA
WP_036773116.1|2500379_2501354_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|2501406_2502402_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2502444_2503419_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376319.1|2504043_2504724_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_017376318.1|2504723_2505533_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027242903.1|2505606_2509287_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_026063524.1|2509296_2510784_-	ribonuclease G	NA	NA	NA	NA	NA
WP_017376313.1|2510793_2511411_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_017376312.1|2511480_2511999_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376311.1|2511995_2512895_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2512910_2513954_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376309.1|2514151_2514439_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_017376308.1|2514559_2516020_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_027242902.1|2516099_2517536_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_036771325.1|2517660_2518635_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420621.1|2520825_2521587_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2522744_2522972_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377706.1|2523925_2524138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|2524155_2524473_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242901.1|2524499_2525189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377709.1|2525529_2525733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420768.1|2525864_2526800_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047927332.1|2526812_2527595_-	lipoprotein	NA	NA	NA	NA	NA
WP_017377712.1|2527724_2528036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242900.1|2528379_2528706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377714.1|2528730_2529186_-	arginine repressor	NA	NA	NA	NA	NA
WP_017377715.1|2529175_2530228_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377716.1|2530230_2531694_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377787.1|2531828_2532056_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377706.1|2533009_2533222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|2533239_2533557_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242901.1|2533583_2534273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377709.1|2534613_2534817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420768.1|2534948_2535884_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047927332.1|2535896_2536679_-	lipoprotein	NA	NA	NA	NA	NA
WP_017377712.1|2536808_2537120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242900.1|2537463_2537790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377714.1|2537814_2538270_-	arginine repressor	NA	NA	NA	NA	NA
WP_017377715.1|2538259_2539312_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377716.1|2539314_2540778_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377787.1|2540912_2541140_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377718.1|2542556_2543021_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036773913.1|2543277_2544093_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377721.1|2544221_2546534_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_017377722.1|2546650_2547178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377723.1|2547869_2549147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377724.1|2549157_2549409_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377725.1|2549442_2549964_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377726.1|2550133_2551120_-	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377727.1|2551210_2552026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773915.1|2552454_2552850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2552822_2553050_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 28
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	2562731	2612974	3220407	tRNA,transposase	Bacillus_phage(33.33%)	50	NA	NA
WP_155048063.1|2562731_2563727_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875916.1|2563730_2564135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2565102_2565330_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971647.1|2566298_2566895_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875914.1|2566863_2568024_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_017375625.1|2568728_2568956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875913.1|2568952_2569723_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_017377194.1|2569719_2571033_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_027243130.1|2571957_2572827_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	9.3e-69
WP_017377197.1|2572823_2574173_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	3.0e-74
WP_017377198.1|2574285_2575926_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_027243131.1|2576311_2576578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377200.1|2576707_2576896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2577460_2578864_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963580.1|2578969_2579194_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|2579376_2580198_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377842.1|2580343_2580598_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377841.1|2580986_2582771_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_017377840.1|2582859_2583579_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_027243134.1|2583740_2583947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243135.1|2583946_2584183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|2584195_2584549_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243136.1|2585086_2585920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377835.1|2586012_2586210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063682.1|2586307_2587693_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377833.1|2587819_2588410_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_017377223.1|2589441_2589729_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2589788_2589953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|2589949_2591320_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|2591686_2593099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|2593168_2593939_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_027243138.1|2594431_2594719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|2596195_2596489_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_144420618.1|2596446_2597268_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_026063680.1|2597412_2597637_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155046618.1|2597891_2598419_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_080999968.1|2598595_2598856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420617.1|2598774_2598930_+	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|2599028_2600003_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999967.1|2601331_2601481_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377700.1|2601597_2601891_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017376598.1|2602699_2603275_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|2603352_2604228_-	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376596.1|2604292_2604913_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027243040.1|2604897_2605980_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376593.1|2606213_2606618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376591.1|2608108_2609410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376590.1|2609556_2610225_+	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_144420764.1|2611157_2611721_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376588.1|2611777_2612974_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
>prophage 29
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	2627899	2660884	3220407	tRNA,transposase	Staphylococcus_phage(30.0%)	32	NA	NA
WP_036771330.1|2627899_2628874_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376571.1|2629040_2631365_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.7	7.6e-25
WP_017376570.1|2631539_2632256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063542.1|2632335_2632950_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_017376568.1|2632942_2634325_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_017376567.1|2634333_2634807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376566.1|2634939_2636199_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_144420761.1|2636722_2636902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376564.1|2637046_2637757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046619.1|2637824_2638082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999966.1|2638168_2639518_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242585.1|2639815_2640373_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376558.1|2640466_2640973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376557.1|2641477_2642173_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_144420615.1|2642303_2643092_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_048876031.1|2643125_2644529_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875857.1|2644952_2645927_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017377787.1|2646183_2646411_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377821.1|2647498_2648029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377820.1|2648025_2649558_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2649554_2650505_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2650925_2651558_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2651800_2651998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2652347_2652776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|2652853_2653849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856754.1|2653993_2654245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|2654349_2654994_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2655229_2655727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2656238_2657213_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017377700.1|2657583_2657877_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017375632.1|2658689_2659025_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377815.1|2659345_2660884_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
>prophage 30
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	2680908	2740893	3220407	tRNA,transposase	Staphylococcus_phage(41.67%)	53	NA	NA
WP_036771639.1|2680908_2681883_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376009.1|2683237_2683528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376008.1|2683850_2684888_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376007.1|2684918_2686373_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376006.1|2686382_2687567_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376005.1|2687640_2688648_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376004.1|2688716_2690720_-	transketolase	NA	NA	NA	NA	NA
WP_017376003.1|2691171_2692332_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_017376001.1|2692568_2693684_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376000.1|2693846_2694371_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_017375999.1|2694370_2694901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2696560_2697436_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420759.1|2697556_2698057_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376501.1|2698053_2698320_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_048875903.1|2698485_2699460_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_075275269.1|2699639_2700260_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|2700566_2701970_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771922.1|2702804_2703995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377263.1|2704561_2705029_-	DoxX family protein	NA	NA	NA	NA	NA
WP_017377264.1|2705530_2705785_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377265.1|2705986_2706490_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_036771941.1|2706706_2707312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2707472_2708156_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|2708231_2709011_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_017377269.1|2708997_2709858_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377270.1|2709981_2710347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377271.1|2710732_2711062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|2711472_2712447_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017377273.1|2712981_2713221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377274.1|2713214_2714567_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	3.2e-36
WP_017377275.1|2715628_2716351_+	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377276.1|2716342_2716711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243089.1|2716973_2718275_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377277.1|2718370_2718814_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_017377278.1|2718817_2719327_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377279.1|2719319_2722133_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_048875900.1|2722629_2723562_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377282.1|2723666_2724593_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_017377283.1|2724771_2726310_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2726483_2726744_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377686.1|2728018_2728627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2728673_2729402_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_155046620.1|2729648_2729786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619438.1|2730936_2731488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|2731722_2732634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377698.1|2732893_2733190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910634.1|2733534_2734688_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377702.1|2735284_2735833_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_144420757.1|2735936_2736500_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377704.1|2736717_2737476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|2738751_2738979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|2739201_2739381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971672.1|2739636_2740893_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	2794407	2847448	3220407	transposase	Staphylococcus_phage(50.0%)	45	NA	NA
WP_048875857.1|2794407_2795382_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378343.1|2795538_2797113_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_017378342.1|2797337_2797616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378341.1|2797685_2798561_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_016210208.1|2798570_2799731_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_017378340.1|2799845_2800994_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_017378339.1|2801004_2803806_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_017378338.1|2803912_2804611_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_017378337.1|2804623_2806387_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_016210223.1|2806390_2806738_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_017378336.1|2806731_2807106_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_017378335.1|2808053_2809337_+	citrate synthase	NA	NA	NA	NA	NA
WP_017378334.1|2809746_2811042_+	MFS transporter	NA	NA	NA	NA	NA
WP_017378333.1|2811397_2811943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046622.1|2812536_2813052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420607.1|2813063_2814443_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_017378329.1|2814690_2815125_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_017378328.1|2815121_2816474_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_027242734.1|2816473_2817589_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_017378326.1|2817589_2818606_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_017378325.1|2818595_2820266_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_017378324.1|2820285_2820621_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_036772382.1|2820648_2822088_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_047927447.1|2822084_2823131_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017378320.1|2823273_2824770_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017378319.1|2825065_2826067_+	glucokinase	NA	NA	NA	NA	NA
WP_080963617.1|2826172_2826784_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_144420755.1|2826904_2827282_-	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_027242736.1|2827332_2828739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378315.1|2828732_2829800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378314.1|2829906_2831508_-	APC family permease	NA	NA	NA	NA	NA
WP_027242737.1|2831756_2832674_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242738.1|2832742_2834437_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.3e-20
WP_017378310.1|2834671_2835601_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048876031.1|2835631_2837035_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378308.1|2837265_2837970_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_017378307.1|2838036_2838693_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_036774478.1|2838703_2839585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242739.1|2839755_2842425_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036771639.1|2842785_2843760_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_036771744.1|2843839_2844811_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2844864_2845839_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772729.1|2845958_2846180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420754.1|2846243_2846552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|2846476_2847448_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	2862014	2899201	3220407	transposase	Staphylococcus_phage(50.0%)	36	NA	NA
WP_026063658.1|2862014_2862743_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_027243070.1|2863052_2863307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2864020_2866675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378171.1|2866713_2867004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2867120_2868419_+	MFS transporter	NA	NA	NA	NA	NA
WP_036772686.1|2868989_2869478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420604.1|2869458_2869761_+	VUT family protein	NA	NA	NA	NA	NA
WP_075275265.1|2870007_2870496_+	VUT family protein	NA	NA	NA	NA	NA
WP_027243073.1|2870529_2871168_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243074.1|2871289_2871829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2871918_2873145_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_155046619.1|2873757_2874015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420603.1|2874101_2875001_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420602.1|2875145_2875412_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2875403_2875553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2875780_2876656_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2876785_2877013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815640.1|2877079_2877274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2877332_2878307_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963634.1|2878344_2878533_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_017376778.1|2878533_2880306_-	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_144420601.1|2880295_2881288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376776.1|2881895_2882588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376774.1|2883074_2883644_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_036771639.1|2883640_2884615_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_080999963.1|2884654_2885158_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856766.1|2885248_2886652_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2887350_2887536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|2887641_2889045_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420599.1|2889049_2889622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375939.1|2889655_2891083_-	amino acid permease	NA	NA	NA	NA	NA
WP_036772717.1|2892368_2894738_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.4	3.7e-160
WP_017375937.1|2894813_2895632_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_027243188.1|2895983_2896529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971669.1|2897011_2898250_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2898226_2899201_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 33
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	2915135	2974117	3220407	tRNA,transposase	Lake_Baikal_phage(12.5%)	51	NA	NA
WP_080999962.1|2915135_2916563_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376537.1|2917286_2918912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376536.1|2919081_2919441_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	4.4e-25
WP_017376535.1|2919653_2920085_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_017376534.1|2920096_2920276_-	rubredoxin	NA	NA	NA	NA	NA
WP_144420597.1|2920392_2921379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243034.1|2921559_2922849_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_017376531.1|2922960_2923758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312049.1|2924149_2925517_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243033.1|2926009_2926489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875888.1|2926668_2928732_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_144420751.1|2928740_2929466_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_017375919.1|2930093_2930807_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017375920.1|2930811_2931342_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375921.1|2931576_2931810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971668.1|2931922_2932171_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_144420596.1|2932978_2935171_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_017375924.1|2935188_2935497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2936150_2937860_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017378284.1|2938053_2938209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2939611_2940487_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243077.1|2940812_2941574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2941798_2942530_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_017376852.1|2942526_2943063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376851.1|2943116_2943881_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376850.1|2943883_2945461_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376849.1|2945467_2945944_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2945919_2946351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376847.1|2946383_2947139_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|2947313_2947601_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_027243078.1|2947983_2948208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2948547_2949711_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243079.1|2949745_2950723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2950716_2951403_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017376843.1|2951341_2952457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2952736_2953342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420595.1|2953579_2954059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2955881_2956535_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_027243083.1|2956647_2957199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2957298_2958273_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243084.1|2958558_2959083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376838.1|2959780_2960605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875886.1|2960860_2961217_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053856766.1|2961213_2962617_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243085.1|2962736_2963297_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_017376236.1|2963454_2964021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243087.1|2967108_2967804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376234.1|2967844_2968057_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376229.1|2969629_2970739_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376228.1|2970794_2972276_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_048876031.1|2972713_2974117_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP038927	Piscirickettsia salmonis strain Psal-013 chromosome, complete genome	3220407	3101799	3167048	3220407	protease,transposase	Hokovirus(14.29%)	56	NA	NA
WP_017376170.1|3101799_3102900_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
WP_017376171.1|3103257_3104232_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771588.1|3104368_3105247_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_016209597.1|3105254_3105485_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771607.1|3105538_3106543_-	OmpA family protein	NA	NA	NA	NA	NA
WP_036771589.1|3106761_3107589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420747.1|3107670_3109059_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_017376176.1|3109346_3110747_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_017376177.1|3110841_3111768_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_027242699.1|3111764_3112901_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_027242700.1|3112897_3113905_-	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242701.1|3113901_3115065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376183.1|3115074_3115926_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242702.1|3115957_3117130_-	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_065653741.1|3117126_3118515_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_017376186.1|3118543_3118951_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_017376187.1|3118970_3119978_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376188.1|3119974_3120847_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_036771610.1|3120843_3121704_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_065653742.1|3121705_3123976_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_017376192.1|3123977_3125123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376193.1|3125169_3125655_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_027242703.1|3125694_3126318_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376237.1|3131997_3132750_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155046626.1|3133352_3133520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243062.1|3134081_3134705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243063.1|3134809_3135598_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243064.1|3135597_3136329_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376241.1|3136362_3138090_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_017376242.1|3138103_3139165_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376243.1|3139479_3140694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376244.1|3140826_3141351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063518.1|3141968_3142817_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376247.1|3142803_3143502_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_017376248.1|3143556_3144318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376249.1|3144310_3144733_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376250.1|3144862_3145414_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376251.1|3145469_3146432_-	TonB family protein	NA	NA	NA	NA	NA
WP_144420746.1|3146432_3146648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376253.1|3146834_3147644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|3147623_3148466_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376255.1|3148462_3149707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376256.1|3149845_3150934_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376257.1|3150951_3151452_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376258.1|3151639_3152239_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376259.1|3152244_3153408_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376260.1|3153440_3154394_+	glutathione synthase	NA	NA	NA	NA	NA
WP_017376261.1|3154757_3155822_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027243065.1|3155818_3158881_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_144420745.1|3159033_3159486_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243066.1|3159517_3159874_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772645.1|3160292_3161066_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376269.1|3163689_3163980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|3164204_3165080_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|3165076_3165634_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|3165644_3167048_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP038928	Piscirickettsia salmonis strain Psal-013 plasmid unnamed1, complete sequence	159159	0	41340	159159	terminase,transposase,portal	Streptococcus_phage(34.78%)	45	NA	NA
WP_017377655.1|1412_1658_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|1654_2041_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772434.1|2128_2857_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_080963659.1|2835_3456_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377658.1|3801_4488_+	Fic family protein	NA	NA	NA	NA	NA
WP_082304501.1|5437_5800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|5802_7542_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155049764.1|8123_8675_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	36.8	4.9e-15
WP_036771347.1|8737_9715_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_081000019.1|9790_9961_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|10001_10730_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_036771293.1|11275_11542_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772437.1|11837_13736_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017377694.1|14157_14886_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_144420842.1|14947_15106_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046630.1|15522_15687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375754.1|15707_16994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771359.1|17176_17905_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_036771347.1|18032_19010_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155049765.1|19039_19501_-	hypothetical protein	NA	A0A1B0VFY5	Salmonella_phage	38.7	6.5e-21
WP_069971704.1|19608_20100_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|20181_21159_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155049766.1|21173_21791_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	35.6	2.5e-20
WP_155048088.1|21791_22622_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	35.8	4.9e-35
WP_027243212.1|23116_23404_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_027243211.1|23393_23648_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_155046636.1|23865_24027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|24041_25019_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_062365770.1|25037_25271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|25352_26330_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_144420849.1|26795_27776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|28007_28517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242596.1|28556_28919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275482.1|29232_30207_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_129556588.1|30488_30656_-	phosphatase	NA	NA	NA	NA	NA
WP_155049767.1|30600_31317_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.1e-38
WP_027243190.1|31497_34842_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_144420848.1|34845_35031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876202.1|36409_37123_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_036771649.1|37169_37904_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_087910668.1|37941_38328_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_047927581.1|38414_38849_-	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_048876205.1|39053_40385_-|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_075278733.1|40387_40870_-|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_027242929.1|40956_41340_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
>prophage 2
NZ_CP038928	Piscirickettsia salmonis strain Psal-013 plasmid unnamed1, complete sequence	159159	45476	50247	159159		Vibrio_phage(25.0%)	7	NA	NA
WP_081078123.1|45476_45839_-	HigA family addiction module antidote protein	NA	A0A2I7RIN6	Vibrio_phage	46.6	3.5e-06
WP_146619517.1|45868_46021_+	phosphatase	NA	NA	NA	NA	NA
WP_017375959.1|46158_46392_-	hypothetical protein	NA	A0A0M3LQB1	Mannheimia_phage	45.2	5.1e-06
WP_017375960.1|46693_47737_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.0	2.2e-77
WP_036817201.1|47844_48252_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_036817204.1|48555_49551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375964.1|49821_50247_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
>prophage 3
NZ_CP038928	Piscirickettsia salmonis strain Psal-013 plasmid unnamed1, complete sequence	159159	56486	113323	159159	integrase,transposase,portal	Streptococcus_phage(54.17%)	54	72798:72857	112440:113360
WP_048876229.1|56486_57458_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048876208.1|58322_59150_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_036771289.1|60003_60474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046633.1|61367_61511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242940.1|62717_63317_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_017375850.1|63670_64447_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_036771279.1|64807_65536_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_155046634.1|65605_65806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876229.1|65724_66696_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|67265_67994_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036772441.1|68069_68342_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_032126795.1|68345_68606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929764.1|69964_70456_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.1	6.9e-21
WP_036772450.1|71127_72255_-	hypothetical protein	NA	NA	NA	NA	NA
72798:72857	attL	TTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTA	NA	NA	NA	NA
WP_027243215.1|74068_75091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774350.1|75573_76302_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_048876194.1|77541_78075_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_155049768.1|78255_78756_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	55.1	5.7e-39
WP_027243206.1|78828_80694_-	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_047927778.1|80861_81146_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|81489_82218_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046637.1|82299_82791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|83523_83751_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876191.1|85302_85731_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_081000015.1|85666_86053_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|86082_86811_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|86822_86972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|87218_87947_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036774388.1|89324_90287_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027242592.1|90310_90640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|90706_91747_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_144420833.1|91760_91952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774378.1|92156_92726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774316.1|92768_93068_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774376.1|93064_93493_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774373.1|93802_94531_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_048876188.1|94704_95478_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_027243202.1|96191_97127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|97401_98130_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243201.1|98295_98535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049769.1|98598_99681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049770.1|99951_102228_+	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	1.8e-50
WP_036772541.1|102385_103114_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_144420834.1|103407_103803_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036815648.1|103855_104584_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772541.1|105067_105796_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_027243197.1|105966_106536_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_087910667.1|106540_107224_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_036772541.1|107375_108104_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_080963627.1|108122_108341_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774644.1|109320_110382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|110890_111637_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_027243200.1|111637_112042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|112348_113323_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
112440:113360	attR	TTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGCGCACAAGAAAAACGAGCTAACGCTAAGCAAGGACAAGCTTTTCAACAAATTTCAGAAGAGGAAAAAATGTTGATTCATCAGCGGTTAAGCACTCATACATCCCCCGATGTTATCAGTCAAGAACTTATACGTGAGCATAATATTCAGGTGAGTGAGAGCACGATTTACCGTTATATTTATGATGATAGAGAGCGGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCAGGAAAACCTTATAAGAAGAAGGTGAGTCGTGGTGATCAAACAAAAATACCTAATCGCGTTGGTATTGAACAACGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGTGACCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACTTCTGACAACGGAACAGAGTTTGCCGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAACACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACGGATTTTAATGAAGTTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATCGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCGT	NA	NA	NA	NA
>prophage 4
NZ_CP038928	Piscirickettsia salmonis strain Psal-013 plasmid unnamed1, complete sequence	159159	119273	120895	159159	transposase	Acinetobacter_phage(50.0%)	3	NA	NA
WP_017375632.1|119273_119609_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017375836.1|119803_120007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243203.1|120100_120895_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
>prophage 5
NZ_CP038928	Piscirickettsia salmonis strain Psal-013 plasmid unnamed1, complete sequence	159159	127679	130097	159159	transposase,portal	unidentified_phage(50.0%)	2	NA	NA
WP_048875857.1|127679_128654_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.2e-26
WP_048876221.1|129641_130097_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
>prophage 6
NZ_CP038928	Piscirickettsia salmonis strain Psal-013 plasmid unnamed1, complete sequence	159159	134815	141783	159159	transposase	Streptococcus_phage(100.0%)	7	NA	NA
WP_017377509.1|134815_135544_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_144420837.1|135685_136618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377511.1|136647_137376_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|137378_137651_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|138501_139230_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|139285_139906_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|141054_141783_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 7
NZ_CP038928	Piscirickettsia salmonis strain Psal-013 plasmid unnamed1, complete sequence	159159	150650	156541	159159	transposase	Staphylococcus_phage(25.0%)	9	NA	NA
WP_036773116.1|150650_151625_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
WP_017375692.1|151768_152002_+	hypothetical protein	NA	Q7Y5W4	Haemophilus_phage	42.6	1.3e-06
WP_017375691.1|152025_152727_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	37.6	9.6e-32
WP_036773107.1|152710_153028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|153315_154020_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_036772541.1|154031_154760_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|154789_155179_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|155201_155930_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|155932_156541_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
>prophage 1
NZ_CP038929	Piscirickettsia salmonis strain Psal-013 plasmid unnamed2, complete sequence	53269	40550	48483	53269	tail,transposase	Moraxella_phage(33.33%)	8	NA	NA
WP_036773116.1|40550_41525_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
WP_017375786.1|42032_42374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375787.1|42370_43042_+|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_144420832.1|42971_43757_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375789.1|43746_44304_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_027242568.1|44300_46991_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375652.1|47049_47478_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|47505_48483_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
>prophage 1
NZ_CP038930	Piscirickettsia salmonis strain Psal-013 plasmid unnamed3, complete sequence	33555	3402	19424	33555	head,integrase,tail,capsid,terminase,transposase	unidentified_phage(35.71%)	21	NA	NA
WP_036771330.1|3402_4377_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212329.1|4912_5503_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_027242955.1|5733_5994_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211078.1|5986_6340_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_069971681.1|6516_7491_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_027242954.1|8023_8389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242953.1|8533_8788_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_080963620.1|8771_9128_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_036771330.1|9225_10200_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242951.1|10825_11692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242950.1|11904_12288_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242949.1|12374_12857_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242948.1|12859_13045_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_036771330.1|13064_14039_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_075275490.1|14135_14528_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242946.1|14563_15145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|15525_16500_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_144420855.1|16573_16789_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027242945.1|17592_18108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242944.1|18453_19011_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242943.1|19007_19424_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
