The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	45576	89169	3146909	transposase	Moraxella_phage(20.0%)	43	NA	NA
WP_075273371.1|45576_46152_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46097_46463_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036776493.1|46661_47423_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_036779326.1|47724_49251_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49622_50462_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50501_51809_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51783_52953_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|53007_53733_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54011_54401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54588_55494_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55541_55685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047031.1|55732_56329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|56563_57717_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_016210704.1|58611_60558_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|61212_64275_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|64271_65336_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|65691_66645_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|66676_67840_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|67845_68445_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|68632_69133_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|69150_70239_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|70377_71622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|71618_72461_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_036777711.1|72440_73250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|73417_73645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|73645_74596_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|74651_75203_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|75329_75752_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|75744_76491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|76533_77232_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|77242_78067_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|78396_78765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|78759_79821_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|79870_80101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|80230_81445_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|81745_82807_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_036777695.1|82820_84548_+	oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_016211245.1|84581_85313_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|85312_86101_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211251.1|86205_86829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|87148_87361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047032.1|87516_88578_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047033.1|88572_89169_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	127259	181534	3146909	transposase	Staphylococcus_phage(42.86%)	58	NA	NA
WP_054300271.1|127259_128234_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209611.1|128482_128674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047035.1|128753_128933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209580.1|129024_129549_+	ankyrin repeat family protein	NA	NA	NA	NA	NA
WP_016209612.1|129932_130301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209595.1|130338_130611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300576.1|130701_131997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211692.1|132632_133535_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.4	1.6e-18
WP_051307362.1|133591_134443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211694.1|135022_137032_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	3.0e-110
WP_054300271.1|137069_138044_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|138545_139958_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|140450_141458_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|141477_142998_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_016211018.1|143948_145265_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|145368_145752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|145886_148952_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|149020_150124_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|150147_150702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|150816_151386_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211020.1|151505_152261_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_155047036.1|152427_153327_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047037.1|153471_153777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082829.1|154171_154567_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|154588_154954_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|155010_155175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|155164_155464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300544.1|155554_156001_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|156496_157063_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|157074_157860_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|158491_159415_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|159466_160462_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|160493_160988_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_036778333.1|161079_161337_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|161426_161849_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|162167_162884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|162927_163179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778330.1|163183_164620_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|164647_166090_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|166177_166516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|166600_167131_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|167191_169384_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|169426_169912_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|170181_170613_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036778324.1|170630_171461_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|171475_171619_-	lipoprotein	NA	NA	NA	NA	NA
WP_052104672.1|171649_172534_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|172505_172727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|172900_173179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|174149_175055_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_036780891.1|175111_176290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|176286_176862_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|176807_177173_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300541.1|177500_178280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126848.1|178813_179614_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_052104671.1|179832_180591_+	ion transporter	NA	NA	NA	NA	NA
WP_016211859.1|180667_180955_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_075273327.1|180958_181534_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	200550	271835	3146909	protease,transposase,tail,tRNA	Acinetobacter_phage(25.0%)	60	NA	NA
WP_016209871.1|200550_202533_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|202742_204086_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|204352_207022_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|207045_208965_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|209134_210556_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|210701_211676_+	phospholipase A	NA	NA	NA	NA	NA
WP_054300537.1|211707_212115_+	glyoxalase	NA	NA	NA	NA	NA
WP_016209859.1|212393_212615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|212778_214440_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|214512_214803_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_036776911.1|215028_215484_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|215548_216013_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|216105_217452_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|217451_218357_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|218418_219405_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|219397_219640_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|219761_221306_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_036776914.1|221352_222639_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|222681_224076_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|224099_224279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|224275_224455_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_054300181.1|224458_224740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|224796_225162_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210079.1|228167_228665_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|228835_229531_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|229633_231196_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|231511_233305_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|233390_233663_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|233668_234295_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|234281_235712_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|236044_237100_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|237068_237746_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|237735_238572_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|238731_239025_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_122940784.1|239131_239938_-	trfA family protein	NA	NA	NA	NA	NA
WP_016210083.1|240242_241097_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_036776920.1|241251_242301_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_036776924.1|242351_243008_-	DedA family protein	NA	NA	NA	NA	NA
WP_016210097.1|243025_244306_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_016210096.1|244579_245941_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_155046933.1|246214_246892_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_016211802.1|252323_253595_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_036778206.1|253651_254635_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_155067943.1|254631_254967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067945.1|255171_255705_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_032126362.1|256401_256767_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|256712_257288_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300535.1|257291_258011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|258155_258356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|258403_258865_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|259288_260770_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|260832_261942_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|262039_264001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|264530_264935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047045.1|264987_265683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|265659_266634_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_098082809.1|266804_267155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046934.1|267553_267724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|268097_269180_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_129556499.1|270682_271835_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
>prophage 4
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	300688	360548	3146909	transposase	Bodo_saltans_virus(20.0%)	56	NA	NA
WP_054300526.1|300688_300985_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962174.1|301133_301298_-	phosphatase	NA	NA	NA	NA	NA
WP_016211026.1|301396_301801_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075273367.1|302093_302870_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_155047049.1|302878_304960_+	protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	4.0e-17
WP_016211031.1|305124_305604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211032.1|305913_306711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211033.1|306822_308115_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_032126377.1|308280_309282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211034.1|309398_309578_+	rubredoxin	NA	NA	NA	NA	NA
WP_016211023.1|309588_310023_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_016211029.1|310236_310599_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.6e-25
WP_016212102.1|310772_312413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|313923_315076_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556441.1|318504_319731_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126490.1|320079_321045_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_016210868.1|321041_321341_+	pilZ domain protein	NA	NA	NA	NA	NA
WP_036778898.1|321372_322152_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_016210861.1|322177_322408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|322559_322805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210870.1|322956_323748_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016212128.1|324661_325408_+	solute symporter family protein	NA	NA	NA	NA	NA
WP_032126495.1|325498_326383_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_054300397.1|326788_327034_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046705.1|327274_327442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|327387_327963_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047050.1|328015_328753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777815.1|328756_329041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|329764_330583_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|330655_333028_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_036777812.1|333740_335168_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|335202_336225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|336241_336619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|337581_337947_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|337892_338468_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210122.1|338707_339400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|340026_341001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|340990_342763_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|342763_343111_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_036777821.1|343360_344587_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|344676_345975_-	MFS transporter	NA	NA	NA	NA	NA
WP_081007061.1|346008_346758_-	queuosine precursor transporter	NA	A0A1W7AG82	Streptococcus_virus	30.4	3.9e-15
WP_016210137.1|346738_347290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007060.1|347516_348815_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|348931_349222_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_155047051.1|349533_350403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047052.1|350547_351276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777801.1|352138_352357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212044.1|353130_353385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|354107_355094_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|355231_355426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007059.1|356108_357170_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_016211797.1|357331_358735_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|358785_359361_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|359306_359621_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047053.1|359661_360548_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	444780	545540	3146909	integrase,transposase,tRNA	Escherichia_phage(43.75%)	108	511567:511626	525778:525951
WP_054300513.1|444780_445644_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|445860_447420_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|447441_448476_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|448524_449094_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|449229_450201_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|450212_451790_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|451855_452842_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_054300512.1|453173_454283_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|454388_455573_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|455650_457639_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|457847_458003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047055.1|458273_458561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|458598_458964_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|458909_459485_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047056.1|459474_459837_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|460753_462160_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|462177_463164_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|463166_464321_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|464317_465013_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|465147_466638_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_036777447.1|466658_467708_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|467774_469169_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_036777444.1|470047_471979_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.6	1.0e-120
WP_075273353.1|471983_472514_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|472548_472743_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|472785_473145_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|473564_474560_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_036777440.1|474572_476954_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|476959_477247_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|477518_477995_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|478139_478337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|478461_479436_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|480336_480435_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780545.1|480919_481630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047057.1|481793_482210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300575.1|482446_483139_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|483180_483954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|483955_484897_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|485029_486607_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|486816_488574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|489122_489881_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|490088_490661_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|490764_491313_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|491614_491860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|491888_492185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779353.1|492452_493364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300506.1|493854_494262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|494333_495062_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_032126799.1|495142_495955_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_155047058.1|497016_497379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|497381_499121_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046941.1|499522_499786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300500.1|500457_501186_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_016212070.1|501595_502195_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_016212069.1|502169_502337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212066.1|502548_503325_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_054300501.1|503685_504414_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|504425_504818_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|504814_505060_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017375910.1|505220_505949_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211714.1|506023_509368_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|510616_511192_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|511137_511503_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
511567:511626	attL	ATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATAATCTCACCGGAATAATGCT	NA	NA	NA	NA
WP_155047059.1|511781_512696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212159.1|512963_513161_+	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_054300201.1|513520_514249_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_155047060.1|514278_514953_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	45.9	5.2e-27
WP_016212024.1|515097_515346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780881.1|515342_515942_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212022.1|515941_516160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212023.1|516934_517927_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_075273432.1|517923_518658_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_155047061.1|518918_519185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047062.1|519329_519488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047063.1|519510_519762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300477.1|520211_520940_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_051307368.1|521646_522927_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_016211918.1|522926_523895_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211646.1|524266_524506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211642.1|524498_524852_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_017375910.1|525154_525883_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155047064.1|526352_526661_-	hypothetical protein	NA	NA	NA	NA	NA
525778:525951	attR	ATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATAATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTTTTACCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCC	NA	NA	NA	NA
WP_155047065.1|526822_527500_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.1	7.0e-40
WP_155047066.1|527993_528722_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.5e-43
WP_016212269.1|528890_529574_+	Fic family protein	NA	NA	NA	NA	NA
WP_016212268.1|529577_530162_+	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_017375910.1|530318_531047_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155047064.1|531515_531824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556455.1|532074_532677_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054300203.1|532681_533140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781052.1|534516_535119_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211639.1|535498_535801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211644.1|535915_536182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104773.1|536289_536733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|536794_537680_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047067.1|537780_538674_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047259.1|538818_539034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104771.1|539483_539822_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	54.9	5.4e-25
WP_075274739.1|539814_540162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274717.1|540158_540389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274718.1|540392_540863_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	64.3	1.3e-32
WP_075274740.1|541007_541373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780395.1|541805_542060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377363.1|542043_542400_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_075274719.1|542705_543572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047068.1|544057_544258_+	HNH endonuclease	NA	A0A2H4PHY5	Pseudomonas_phage	64.3	3.5e-16
WP_155047069.1|544345_544699_+	hypothetical protein	NA	Q6DMU4	Streptococcus_phage	34.8	8.2e-08
WP_054300202.1|544811_545540_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
>prophage 6
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	553239	601192	3146909	transposase,tRNA	Synechococcus_phage(33.33%)	51	NA	NA
WP_054300202.1|553239_553968_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211663.1|554061_554727_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211661.1|554791_555748_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_032126810.1|556006_556705_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211662.1|556747_557860_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_075273327.1|558464_559040_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|558985_559351_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212580.1|559438_559789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|560524_561586_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210908.1|562797_563613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126716.1|563703_564687_+	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210913.1|564857_565379_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_036779246.1|565412_565667_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.4e-20
WP_016210909.1|565669_566947_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_051307343.1|567639_568167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210906.1|568286_570599_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_032126715.1|570727_571543_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210915.1|571740_572205_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|572334_573396_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211491.1|573656_573953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211493.1|574235_575699_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211489.1|575701_576754_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_036779281.1|576743_577199_+	arginine repressor	NA	NA	NA	NA	NA
WP_155047071.1|577223_577547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|577894_578206_-	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_054300208.1|578335_579127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779278.1|580284_581238_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016212075.1|581351_581549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126198.1|581794_581995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142396463.1|582105_582222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212074.1|582308_582530_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|582556_582922_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|582978_583143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047072.1|583132_583447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046713.1|583584_583749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126195.1|584043_585480_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016210532.1|585521_586973_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016210537.1|587084_587372_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|587561_588605_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210536.1|588620_589520_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210528.1|589516_590035_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210527.1|590104_590722_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_036776217.1|590731_592219_+	ribonuclease G	NA	NA	NA	NA	NA
WP_016210534.1|592228_595909_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_036776215.1|595982_596795_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210530.1|596791_597472_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_155047260.1|598312_598471_-	phosphatase	NA	NA	NA	NA	NA
WP_155047073.1|598663_599221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|599270_599561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300215.1|600364_600859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007066.1|600853_601192_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	622662	725258	3146909	protease,transposase,plate,tRNA	Prochlorococcus_phage(17.65%)	108	NA	NA
WP_016209523.1|622662_624012_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209510.1|624062_624500_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209501.1|624761_626273_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_036778935.1|626278_627505_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|627498_628527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|628504_629197_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_155049805.1|629198_630671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778941.1|630663_631152_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_051307310.1|631157_632630_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032126187.1|632629_633028_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016209524.1|633024_634713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209506.1|634694_635651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|635693_636209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|636313_637246_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209534.1|637465_637852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209530.1|637868_638513_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209504.1|638693_639533_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_016209502.1|639608_640211_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209512.1|640211_641066_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209537.1|641422_641734_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209519.1|641758_643150_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|643305_644037_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_129556465.1|644033_644606_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|644592_645150_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_016209498.1|645155_646136_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209539.1|646275_647076_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_036780687.1|647079_647847_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209535.1|647843_648308_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_016209507.1|648330_648984_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209517.1|648987_649335_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209505.1|649368_649620_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|649696_650965_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209527.1|650967_651726_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209508.1|651787_652678_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|652728_653412_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_075273445.1|653497_653755_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155047218.1|654027_656196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210408.1|656187_657060_-	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_016210409.1|657227_659057_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210411.1|659219_659861_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_075273448.1|660102_660633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|660650_660824_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_016210402.1|660882_661932_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210405.1|661938_662889_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210406.1|662942_663887_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210415.1|663914_664652_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|664740_664983_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|665057_666281_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210400.1|666312_667161_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210401.1|667157_668210_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_032126181.1|668330_668951_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_036780649.1|668966_669953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|670063_670519_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|670478_670817_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|671581_672487_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155047217.1|672561_673623_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212599.1|673672_673882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|675116_675563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|675566_676142_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|676087_676453_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126651.1|676573_676759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209899.1|676862_677897_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|677893_678604_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209923.1|679078_679597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209901.1|679714_680047_-	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_036777003.1|680076_683031_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_054300221.1|683076_683574_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209922.1|683633_684050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209915.1|684141_685002_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126652.1|685084_685651_+	chorismate lyase	NA	NA	NA	NA	NA
WP_016209918.1|685683_686538_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_155047216.1|686579_689486_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|689546_689744_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209903.1|689750_690761_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209910.1|690757_691816_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_032126655.1|691809_692610_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209913.1|692612_693431_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209907.1|693442_694390_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_032126654.1|694397_695699_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209919.1|695877_696981_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_016209906.1|696977_697370_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209924.1|697381_698758_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209900.1|698751_700221_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_032126362.1|700678_701044_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|700989_701565_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300223.1|701659_702631_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	1.3e-34
WP_129556478.1|702867_703754_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|704053_704299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300225.1|705261_705681_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046954.1|705787_705961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126800.1|706187_706922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|707046_708108_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940948.1|708430_709135_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210599.1|709228_709942_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016210601.1|710024_711116_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210603.1|711187_711769_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210606.1|711774_712401_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210609.1|712497_713433_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_129556471.1|713792_714464_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_036778813.1|714605_715265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210607.1|715433_716693_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210611.1|716689_717775_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210605.1|717767_718649_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210612.1|718637_719888_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_054300237.1|721173_722235_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047215.1|722212_723466_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_032126362.1|724371_724737_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|724682_725258_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	760675	808600	3146909	transposase,tRNA	Staphylococcus_phage(42.86%)	37	NA	NA
WP_016209374.1|760675_762127_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209368.1|762162_763692_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_155047212.1|764267_765911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047211.1|766452_767394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209384.1|767744_768560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209395.1|768851_771542_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_081007011.1|771790_773011_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|773178_774885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209398.1|775483_776710_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|777262_778237_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273456.1|778359_778659_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047210.1|778618_778981_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962625.1|779042_779928_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047266.1|781036_781468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|782183_782549_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|782494_783070_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300237.1|783096_784158_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556478.1|784272_785159_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047209.1|785508_786063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211819.1|786281_786512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|786808_787309_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211818.1|787511_788768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777316.1|789124_789538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273460.1|789847_790732_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300240.1|790988_791192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|791491_792466_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047208.1|792768_794241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|794260_795235_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210742.1|795385_795661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|795826_796447_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_054300241.1|796765_798742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210739.1|798897_800355_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210743.1|800423_802004_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_054300242.1|802044_802581_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210746.1|802626_806523_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210741.1|806529_806853_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_054300237.1|807538_808600_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	825281	938695	3146909	protease,integrase,transposase	Staphylococcus_phage(30.3%)	107	887746:887805	908940:910042
WP_033923708.1|825281_826157_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211687.1|826412_827057_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211685.1|827087_828893_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|828916_829492_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_155047207.1|830036_831110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|831219_832194_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046989.1|832426_833491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|833583_834558_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046989.1|834790_835855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|836345_836711_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047206.1|836725_837235_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|837270_838245_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300250.1|838327_838987_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_016209640.1|839405_840425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209649.1|840883_841849_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209646.1|841893_842469_-	VOC family protein	NA	NA	NA	NA	NA
WP_016209651.1|842499_843774_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126159.1|844419_845133_+	aldolase	NA	NA	NA	NA	NA
WP_016209641.1|845212_845950_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016209658.1|846070_847426_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_075273478.1|847602_848274_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209661.1|848389_849265_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_016209645.1|849868_851173_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|851285_851891_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|851972_853274_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_032126161.1|853341_855774_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209655.1|855877_856150_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075273480.1|856232_858131_+	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_016209643.1|858162_859047_+	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_016209657.1|859055_859451_-	CrcB family protein	NA	NA	NA	NA	NA
WP_016209662.1|859878_862026_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209652.1|861997_863347_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209642.1|863343_865464_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209656.1|865460_867164_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209654.1|867282_868425_-	galactokinase	NA	NA	NA	NA	NA
WP_016209659.1|868489_869518_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_036776625.1|869644_871159_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_059372266.1|871248_871734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275067.1|872066_873134_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|874196_875102_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_051307360.1|875218_876148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780074.1|877239_878046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|878388_880281_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_032126157.1|880567_880972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923634.1|881176_881725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|881714_882601_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212436.1|882939_883350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047205.1|883524_883746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|884233_884599_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|884544_885120_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080664862.1|886293_886992_+	P-loop NTPase	NA	NA	NA	NA	NA
WP_016211528.1|886972_887278_+	hypothetical protein	NA	NA	NA	NA	NA
887746:887805	attL	CGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACT	NA	NA	NA	NA
WP_054300271.1|887837_888812_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300253.1|889030_889981_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	34.7	6.9e-09
WP_016211534.1|889967_890477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211530.1|890482_891379_-	Abi family protein	NA	A3QSC6	Clostridium_virus	32.0	5.3e-35
WP_016211531.1|891732_892413_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155047204.1|892476_893034_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0V4T7	Roseobacter_phage	33.3	8.4e-15
WP_054300271.1|893057_894032_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212424.1|894375_894654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|894646_894919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|895036_896119_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036780532.1|896196_897237_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_081007067.1|897748_903223_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_016212302.1|903443_903743_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_155047203.1|904043_905105_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036781361.1|905124_905514_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_155047202.1|905796_906861_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.2	4.7e-139
WP_016211579.1|907365_907851_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211583.1|907918_908827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|909031_910006_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300257.1|910210_911020_+	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.6	1.8e-29
908940:910042	attR	CGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTCTCTAGTTCGCCTTTTGACTTAGAGGGTAGAGATGGTTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGGTTATCAGAGGGAGACTCGCTCAGATCAATTGCTAGAGCACTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
WP_075273486.1|910996_911971_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.2e-29
WP_016211585.1|912205_912763_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_155047201.1|912824_913586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|913661_914636_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211584.1|914808_915162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|915228_915423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211578.1|915438_915783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|915852_916428_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|916373_916739_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155049808.1|916823_917432_+	DNA polymerase	NA	NA	NA	NA	NA
WP_052047108.1|917516_917915_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046984.1|918726_919845_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046716.1|920266_920413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|921110_921665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|922101_922284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376905.1|922348_922576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556629.1|922806_923553_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_026063577.1|923779_924073_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556482.1|924144_924750_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_016210545.1|924898_925876_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_155047199.1|925972_927415_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210553.1|927441_928095_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_036779374.1|928219_928786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307331.1|929140_930919_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_052104721.1|930990_932697_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.7	7.3e-25
WP_054300262.1|932688_932979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|933441_933807_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|933752_934328_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212461.1|934331_934706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|935081_936056_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_054300263.1|936127_936568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047198.1|936555_936723_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300265.1|936867_937128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|937087_937426_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962625.1|937809_938695_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	959237	1004360	3146909	transposase,tRNA	Escherichia_phage(16.67%)	44	NA	NA
WP_054300173.1|959237_960299_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211781.1|960515_961763_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036779112.1|961985_963422_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_129556486.1|963507_963855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273492.1|963945_964065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|964173_965235_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007012.1|965229_965400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|965389_965554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|965610_965976_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300269.1|965997_966366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047196.1|966510_967092_-	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_017375910.1|967162_967891_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016210898.1|968147_968498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|968586_968877_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210894.1|969351_969654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300270.1|969994_970972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556487.1|971050_972388_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210903.1|972506_972878_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_016210904.1|973099_973750_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210896.1|973792_974875_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210899.1|974928_976812_+	APC family permease	NA	NA	NA	NA	NA
WP_033923708.1|977421_978297_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155047195.1|978309_979212_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211091.1|979286_981767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273494.1|982831_983392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|983982_985044_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275207.1|985091_985541_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211036.1|985888_987760_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_036779409.1|987851_989597_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211043.1|989676_990126_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211035.1|990178_990394_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211042.1|990640_991657_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211037.1|991705_992335_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211040.1|992685_993897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126170.1|994124_994397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047067.1|994560_995454_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556557.1|995598_995910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104774.1|995957_996590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047009.1|996734_996908_-	phosphatase	NA	NA	NA	NA	NA
WP_016211450.1|997683_998706_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211448.1|998804_1000013_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211446.1|1000002_1001730_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_036776407.1|1001913_1003050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|1003298_1004360_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	1016868	1054310	3146909	protease,transposase,tRNA	Orpheovirus(20.0%)	40	NA	NA
WP_129556478.1|1016868_1017755_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211932.1|1018165_1019455_-	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_036777061.1|1019650_1020838_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211476.1|1021155_1021365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211473.1|1021348_1021948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211474.1|1022022_1023372_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_032126518.1|1023454_1025656_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211478.1|1025672_1026488_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126519.1|1026467_1027187_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_075273327.1|1027354_1027930_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1027875_1028241_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211265.1|1028415_1029078_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|1029108_1029477_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_032126514.1|1029487_1030804_-	MFS transporter	NA	NA	NA	NA	NA
WP_051307354.1|1031086_1031662_+	DedA family protein	NA	NA	NA	NA	NA
WP_032126515.1|1031737_1031917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|1032089_1032383_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_075273504.1|1032572_1032926_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211262.1|1032980_1035254_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_016211259.1|1035313_1035559_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_054300275.1|1035683_1036559_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211550.1|1036636_1037398_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_016211548.1|1037381_1038338_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211549.1|1038600_1041105_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211553.1|1041108_1041849_+	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_054300209.1|1042188_1042554_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1042610_1042775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1042764_1043064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126933.1|1043067_1044369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1044537_1045512_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209411.1|1045717_1046512_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_016209421.1|1046674_1047463_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_036776605.1|1047459_1048671_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_032126508.1|1048660_1049020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209444.1|1049114_1049543_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_129556555.1|1049673_1050804_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209436.1|1050800_1051529_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_016209412.1|1051586_1052474_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209433.1|1052558_1052933_+	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209424.1|1053032_1054310_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
>prophage 12
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	1086796	1216012	3146909	protease,transposase,tRNA	Staphylococcus_phage(21.43%)	104	NA	NA
WP_016209432.1|1086796_1088506_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016209448.1|1088763_1090095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209449.1|1090536_1092009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|1092724_1093090_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273508.1|1093330_1094197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273512.1|1094709_1095054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776562.1|1095206_1095398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1095641_1096217_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1096162_1096528_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300283.1|1096768_1097410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1097877_1098852_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047193.1|1100065_1101454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780476.1|1101689_1103627_-	histidine kinase	NA	NA	NA	NA	NA
WP_016210517.1|1104640_1105360_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_032126504.1|1105473_1109013_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_016210525.1|1109079_1109898_+	ZipA protein	NA	NA	NA	NA	NA
WP_016210518.1|1109884_1111924_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.8	3.0e-126
WP_016210522.1|1111939_1112992_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_016210524.1|1113002_1113533_+	exsB family protein	NA	NA	NA	NA	NA
WP_016210010.1|1115170_1115347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780418.1|1115522_1115906_+	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_075273518.1|1115981_1116275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155053573.1|1116441_1117413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210020.1|1118131_1118287_+	putative membrane protein	NA	NA	NA	NA	NA
WP_016210025.1|1118551_1119922_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_052104723.1|1119914_1120868_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036779556.1|1120848_1123653_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.0	3.1e-57
WP_016210027.1|1123732_1124329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|1124718_1125474_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155047191.1|1125871_1126603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210021.1|1126863_1128189_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210023.1|1128185_1130243_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210007.1|1130220_1130793_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126616.1|1130848_1131208_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210019.1|1131272_1132307_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_122941592.1|1132564_1133416_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|1133510_1134494_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_016210013.1|1134650_1136318_+	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
WP_155047190.1|1137256_1137574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556556.1|1137592_1138168_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1138113_1138479_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300287.1|1138500_1138830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047175.1|1139238_1140561_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_032126362.1|1141091_1141457_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1141402_1141978_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047189.1|1142037_1142211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047265.1|1142500_1143094_+	reverse transcriptase	NA	A0A0N7AE80	Bacillus_phage	28.9	4.0e-07
WP_105962623.1|1143102_1144256_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_054300290.1|1144389_1144647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007015.1|1144748_1145174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1145385_1145643_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|1145642_1146650_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300292.1|1146904_1147906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007069.1|1148361_1148514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007016.1|1148486_1148660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047188.1|1148649_1148814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300293.1|1148870_1149236_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300294.1|1149507_1150569_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211279.1|1151312_1153781_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_016211277.1|1153794_1154763_+	homoserine kinase	NA	NA	NA	NA	NA
WP_016211278.1|1154749_1156009_+	threonine synthase	NA	NA	NA	NA	NA
WP_129556646.1|1156060_1157446_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_036781047.1|1158763_1159621_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_036778145.1|1160233_1161355_+	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	8.7e-11
WP_016211172.1|1161404_1162601_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_080664856.1|1162789_1163854_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_051307350.1|1163837_1164584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778066.1|1164573_1165302_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211168.1|1165298_1165958_+	wbqC-like family protein	NA	NA	NA	NA	NA
WP_155046736.1|1165935_1166889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|1166888_1167404_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778065.1|1167446_1168880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210393.1|1168973_1171175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210398.1|1171663_1173256_+	B-type flagellin	NA	NA	NA	NA	NA
WP_032126669.1|1173480_1175058_+	B-type flagellin	NA	NA	NA	NA	NA
WP_122940572.1|1175169_1175595_+	flaG family protein	NA	NA	NA	NA	NA
WP_016210394.1|1175705_1177091_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_032126670.1|1177116_1177554_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210390.1|1177558_1177900_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_016210399.1|1177914_1179906_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210388.1|1179931_1180606_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210397.1|1180602_1182777_-	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_016210772.1|1183985_1185539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|1185622_1186432_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_033923762.1|1186559_1186793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210769.1|1187093_1188596_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_016210773.1|1188899_1191593_+	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210771.1|1191589_1194991_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_054300162.1|1195082_1196165_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300297.1|1196227_1197295_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212246.1|1198230_1198887_+	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300162.1|1198990_1200073_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300271.1|1200412_1201387_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212247.1|1202014_1202770_-	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_036779544.1|1203136_1204144_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1204143_1204401_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047187.1|1204764_1205739_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_075273524.1|1205779_1206745_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212058.1|1206900_1208451_+	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_054300299.1|1210652_1211735_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049810.1|1211821_1212001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1212999_1213863_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155047186.1|1213892_1215122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047185.1|1215125_1216012_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	1256684	1432581	3146909	integrase,transposase,tRNA	Staphylococcus_phage(17.65%)	153	1288938:1288997	1365043:1365406
WP_054300304.1|1256684_1256963_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047180.1|1257015_1257219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776195.1|1257861_1259109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923708.1|1259520_1260396_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211947.1|1260510_1261656_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_129556540.1|1261648_1262044_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211946.1|1262262_1263018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212551.1|1264373_1264868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556643.1|1265325_1266690_-	histidine kinase	NA	NA	NA	NA	NA
WP_016211983.1|1266785_1267445_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_155047179.1|1267692_1268037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047178.1|1268105_1268834_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.5e-43
WP_155047177.1|1268880_1269027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300189.1|1269083_1269449_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036779232.1|1269743_1271303_-	APC family permease	NA	NA	NA	NA	NA
WP_016211215.1|1271663_1273634_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211211.1|1273825_1274905_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_052104715.1|1274953_1275160_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211210.1|1275166_1276648_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016211214.1|1276750_1277314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|1279075_1280335_+	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211940.1|1280455_1280788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1280901_1281876_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_155047176.1|1282020_1282173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300312.1|1282390_1283413_+	YHYH protein	NA	NA	NA	NA	NA
WP_036778055.1|1283420_1285103_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.7e-32
WP_016211344.1|1285263_1286082_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211347.1|1286295_1287279_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211340.1|1287271_1287493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211346.1|1287520_1288162_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_033923708.1|1288405_1289281_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
1288938:1288997	attL	TACCTGAAATTGCTCAAGGTCTGACAGGTAAGATTATTGGTGATAAAGGTTACATTTCAC	NA	NA	NA	NA
WP_129556490.1|1291743_1292629_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1292633_1292921_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_036774554.1|1292973_1293252_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126998.1|1293350_1293698_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_032126997.1|1294019_1294259_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075273532.1|1294476_1295064_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300314.1|1295024_1295360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211315.1|1295547_1296192_-	porin family protein	NA	NA	NA	NA	NA
WP_016211316.1|1296526_1297177_-	porin family protein	NA	NA	NA	NA	NA
WP_016211319.1|1297709_1298762_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032126786.1|1298779_1301860_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_054300384.1|1302158_1302974_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047175.1|1303382_1304705_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_155047174.1|1305613_1306258_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.4	1.1e-39
WP_155047173.1|1306313_1306523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209615.1|1307875_1308382_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_016209623.1|1308398_1309898_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016209624.1|1309919_1310531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209622.1|1310536_1311700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777073.1|1311731_1314269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209626.1|1314300_1316193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273639.1|1316560_1317277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777070.1|1317279_1320153_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_016209636.1|1320153_1320558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209614.1|1320572_1322294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209633.1|1322293_1325242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209625.1|1325244_1326642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209630.1|1326655_1327396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209632.1|1327376_1327811_+	lipoprotein	NA	NA	NA	NA	NA
WP_016209618.1|1327855_1328485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209616.1|1328555_1329470_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_033923701.1|1329500_1332803_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_016209627.1|1332799_1334623_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_016209617.1|1334662_1335061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209621.1|1335181_1336186_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209619.1|1336618_1338067_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_036777066.1|1338153_1341210_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_081007073.1|1341192_1341363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046976.1|1341428_1341566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212485.1|1341862_1342396_-	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_032126753.1|1343208_1343673_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_016211466.1|1343742_1345263_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126752.1|1345350_1345953_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211464.1|1345949_1346297_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_016211465.1|1346447_1347431_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_122942160.1|1348058_1349039_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_052047087.1|1349199_1349418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047172.1|1349589_1350615_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300320.1|1351760_1352360_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300321.1|1352577_1352949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212346.1|1353743_1353890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1354123_1354987_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211748.1|1356468_1358073_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211752.1|1358088_1359234_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_075273313.1|1359310_1359649_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1359608_1360064_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212445.1|1360309_1360576_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155047171.1|1360650_1361214_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	39.9	3.2e-30
WP_155047170.1|1361418_1361700_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047169.1|1361734_1362343_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016212534.1|1362755_1363022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1364149_1364515_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1364460_1365036_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047168.1|1365545_1366466_+	hypothetical protein	NA	NA	NA	NA	NA
1365043:1365406	attR	TACCTGAAATTGCTCAAGGTCTGACAGGTAAGATTATTGGTGATAAAGGTTACATTTCACAAGATTTATTTAACAGGCTTTATGAAAAAGGACTGCAATTAATCAATAAAATTCGCAAGAATATGAAAAATAGGCTCATGCCTATCATCGATAAAATTTTACTCAGAAAACGTGGAATTATTGAAAGTGTATTTGATCAACTTAAAAACATCTCACAAATCGAGCACTCTAGGCATCGTAGTGTCAACAACTTTATGGTCAATATTCTTGCTGGATTAGCAGCCTACTGTCTTCAGGAGAAGAAGCCATCGCTTAATATCCAGCGTAATCTATTGACCAGCTGAGTTATATCGAACTCACGTTA	NA	NA	NA	NA
WP_054300322.1|1366504_1368439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211726.1|1368826_1369420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273534.1|1371051_1371933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300325.1|1372126_1372399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300326.1|1372500_1372965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046975.1|1373378_1373828_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_016212459.1|1373947_1374328_+	glycine-zipper containing OmpA-like membrane domain protein	NA	NA	NA	NA	NA
WP_054300328.1|1374465_1375242_-	class I SAM-dependent methyltransferase	NA	R4ZD91	Adoxophyes_honmai_entomopoxvirus	25.5	8.1e-16
WP_155047167.1|1375352_1376870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047166.1|1376919_1377981_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211456.1|1378602_1379181_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_122942091.1|1379208_1379604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211455.1|1379709_1381167_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_016211452.1|1381228_1382716_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211454.1|1383466_1383937_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|1385811_1386084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1386236_1386602_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1386547_1387123_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556641.1|1389205_1390468_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_016210751.1|1390555_1392361_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_016210752.1|1392844_1393642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210749.1|1393811_1394273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1394571_1396527_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1397208_1397394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212185.1|1397727_1398717_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016211834.1|1402090_1402405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307365.1|1402662_1402923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211836.1|1402942_1403431_+	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_155046972.1|1404954_1405545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047040.1|1406133_1407072_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155047165.1|1407097_1408663_-	amino acid permease	NA	NA	NA	NA	NA
WP_036778182.1|1408869_1409697_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_075273540.1|1410063_1410675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556527.1|1410859_1411120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047164.1|1412112_1412535_+	response regulator	NA	NA	NA	NA	NA
WP_036777256.1|1412957_1413158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104738.1|1413532_1414339_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210795.1|1414444_1415416_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210801.1|1415397_1416369_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155047264.1|1416691_1417051_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_054300271.1|1417090_1418065_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007028.1|1418480_1418936_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1418895_1419234_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211352.1|1419407_1419848_-	universal stress protein	NA	NA	NA	NA	NA
WP_032126362.1|1420314_1420680_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1420625_1421201_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211350.1|1421485_1422424_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211349.1|1422487_1424482_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_032127067.1|1424478_1425081_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_036779888.1|1425077_1425416_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_129556640.1|1425491_1426718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300339.1|1427275_1428247_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.2e-25
WP_016211856.1|1428462_1428648_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_016211855.1|1428774_1429242_+	bacterioferritin	NA	NA	NA	NA	NA
WP_016211857.1|1429238_1430117_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_032126602.1|1430367_1431675_+	MFS transporter	NA	NA	NA	NA	NA
WP_081007028.1|1431827_1432283_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1432242_1432581_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	1448196	1554463	3146909	transposase,tRNA	Staphylococcus_phage(14.81%)	102	NA	NA
WP_054300271.1|1448196_1449171_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047162.1|1449190_1449628_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|1449642_1450008_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210855.1|1450161_1451139_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016210849.1|1451256_1452705_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210847.1|1452733_1453738_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210851.1|1453760_1454432_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210850.1|1454416_1455670_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1455918_1456473_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210848.1|1457056_1458241_+	MFS transporter	NA	NA	NA	NA	NA
WP_051307341.1|1458407_1460006_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_155047161.1|1460699_1461671_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300343.1|1461706_1461934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|1461937_1462824_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007031.1|1462911_1463184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209794.1|1463918_1464542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776664.1|1464587_1466531_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1U9WQS3	Geobacillus_phage	23.9	1.1e-05
WP_016209788.1|1466652_1467405_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016209790.1|1467456_1467915_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_129556639.1|1468210_1468621_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209775.1|1468637_1469093_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_016209797.1|1469089_1469581_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_080664822.1|1469577_1470327_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_016209776.1|1470356_1470626_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_036776670.1|1470641_1471427_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_016209786.1|1471440_1472574_+	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_016209770.1|1472608_1474702_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_016209767.1|1474732_1476193_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_129556524.1|1476173_1477061_+	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_016209784.1|1477057_1477780_+	RNA polymerase sigma factor FliA	NA	A0A1B1P7V3	Bacillus_phage	24.1	2.7e-05
WP_017377132.1|1477866_1478250_+	response regulator	NA	NA	NA	NA	NA
WP_036776675.1|1478291_1479035_+	chemotaxis protein CheZ	NA	NA	NA	NA	NA
WP_036776682.1|1479047_1481072_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_051307317.1|1481133_1481427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209791.1|1481563_1482286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209771.1|1482450_1483173_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126436.1|1483879_1484335_+	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_016209793.1|1484350_1485799_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_016209795.1|1485839_1486595_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	1.3e-10
WP_080664823.1|1486575_1487976_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_016209796.1|1487999_1489217_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.0	2.9e-92
WP_016209778.1|1489247_1489622_+	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_016209772.1|1489640_1490192_+	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_054300271.1|1491473_1492448_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1492545_1493607_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1494161_1495136_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212424.1|1495479_1495758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|1495750_1496023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1496140_1497223_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300346.1|1497369_1498245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126678.1|1498255_1499266_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_016211554.1|1499592_1500219_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_016211557.1|1500264_1501494_+	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_032126677.1|1501688_1502252_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211555.1|1502326_1503685_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_016211664.1|1504221_1504950_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211666.1|1505322_1508142_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211669.1|1508296_1508647_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1509471_1510446_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556522.1|1511756_1512989_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211405.1|1513195_1514968_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_016211403.1|1515103_1516147_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_036777261.1|1516160_1516904_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016211398.1|1517050_1517338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|1517942_1518641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047159.1|1519062_1520454_+	protein kinase	NA	NA	NA	NA	NA
WP_016211733.1|1520509_1521334_-	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_054300173.1|1521948_1523010_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046730.1|1523228_1523369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1523636_1524284_-	LysE family translocator	NA	NA	NA	NA	NA
WP_016212267.1|1524564_1524924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|1525090_1525546_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1525505_1525844_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047158.1|1525979_1528253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126823.1|1528241_1528964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104609.1|1529074_1529707_+	MarC family protein	NA	NA	NA	NA	NA
WP_098082850.1|1529742_1529919_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_016211481.1|1529993_1531136_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_155049129.1|1531214_1531352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126825.1|1531368_1532682_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.5e-51
WP_054300349.1|1533233_1534958_+	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	25.6	1.7e-05
WP_155046942.1|1536018_1536904_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046942.1|1537068_1537954_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556521.1|1538488_1538677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1538627_1539781_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047157.1|1539845_1540250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047156.1|1540421_1541045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211631.1|1541303_1542110_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_054300351.1|1542365_1543187_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211632.1|1543222_1544077_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016211627.1|1544302_1544467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007023.1|1544772_1545429_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1545512_1545878_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300181.1|1545934_1546216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|1546219_1546399_+	DDE endonuclease	NA	NA	NA	NA	NA
WP_016210103.1|1546751_1548110_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_016210117.1|1548391_1548751_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210111.1|1549171_1550806_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_017377579.1|1550812_1551649_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210099.1|1551670_1552948_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_016210105.1|1553031_1553352_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210106.1|1553371_1554463_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	1572861	1626482	3146909	protease,integrase,transposase	Staphylococcus_phage(45.45%)	55	1602408:1602467	1626786:1627075
WP_054300353.1|1572861_1573089_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300354.1|1573235_1573754_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	42.9	1.3e-30
WP_155047155.1|1573699_1573849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1573892_1574867_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047154.1|1574939_1575320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1575280_1575646_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1575591_1576167_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300355.1|1576156_1576342_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211563.1|1576552_1576714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211564.1|1576746_1577622_-	ParA family protein	NA	NA	NA	NA	NA
WP_052104693.1|1577787_1581654_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_080728343.1|1581735_1581876_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_081007034.1|1581857_1582142_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_155047153.1|1582406_1583825_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_016211991.1|1584733_1585639_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126537.1|1585879_1586065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211994.1|1586101_1586638_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_155047152.1|1586840_1587563_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1587602_1588577_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047151.1|1588573_1589113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047150.1|1589162_1590389_+	DUF4131 domain-containing protein	NA	NA	NA	NA	NA
WP_155047149.1|1590383_1590599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212012.1|1591639_1592317_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016212013.1|1592332_1592716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212011.1|1592937_1594059_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_054300357.1|1594292_1595168_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211974.1|1595450_1596572_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075273551.1|1596671_1596974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556638.1|1596973_1597654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377865.1|1598998_1599283_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664876.1|1599641_1601504_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_054300359.1|1601728_1602301_+	hypothetical protein	NA	NA	NA	NA	NA
1602408:1602467	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_155047148.1|1602659_1603697_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047147.1|1604226_1605201_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_054300361.1|1605354_1605651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377353.1|1605628_1606294_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1606333_1607308_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211144.1|1607864_1608494_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_036779218.1|1608477_1608900_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211145.1|1608906_1610646_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211153.1|1610646_1611711_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1611714_1612068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1612180_1613137_+	ferrochelatase	NA	NA	NA	NA	NA
WP_016211151.1|1613146_1613458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1613473_1614043_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211148.1|1614306_1615635_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|1615839_1616814_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_148037535.1|1616954_1617161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210839.1|1617219_1617993_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_155046965.1|1618144_1620601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126340.1|1620880_1621642_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_155047263.1|1621722_1623429_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016210844.1|1623643_1624771_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.2	5.7e-10
WP_016210843.1|1624857_1625088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556637.1|1625702_1626482_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1626786:1627075	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTA	NA	NA	NA	NA
>prophage 16
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	1656172	1702011	3146909	transposase,tRNA	Staphylococcus_phage(37.5%)	40	NA	NA
WP_054300276.1|1656172_1657147_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_155047144.1|1657182_1658508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1658952_1659927_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211804.1|1660309_1661695_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
WP_081007037.1|1661701_1663240_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211806.1|1663282_1664008_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_032126804.1|1664172_1665048_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032126790.1|1665207_1666113_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_032126803.1|1666346_1667579_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_016211764.1|1667779_1668601_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_155047143.1|1668908_1669136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211767.1|1669439_1670249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211289.1|1671865_1672138_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211286.1|1672249_1672597_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_036777656.1|1672614_1673394_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_016211280.1|1673393_1673903_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|1673938_1674187_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_016211281.1|1674498_1674834_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_016211282.1|1675137_1676388_+	MFS transporter	NA	NA	NA	NA	NA
WP_032126762.1|1676469_1678497_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_016210148.1|1679332_1679551_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_016210147.1|1680411_1681584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777648.1|1681596_1683594_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_036777645.1|1683574_1684555_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155047142.1|1684614_1685490_-	TonB family protein	NA	NA	NA	NA	NA
WP_016210153.1|1685489_1685894_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075273564.1|1685886_1686306_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016210157.1|1686328_1686958_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_036777643.1|1687500_1689690_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_016210150.1|1689701_1690907_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_081377354.1|1690891_1692742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664835.1|1692729_1693956_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210156.1|1693948_1695817_+	ferric iron reductase FhuF-like transporter family protein	NA	NA	NA	NA	NA
WP_016210149.1|1695850_1697095_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210155.1|1697100_1697910_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.9	3.8e-16
WP_016210154.1|1697948_1698641_-	haloacid dehalogenase	NA	NA	NA	NA	NA
WP_016210146.1|1698762_1699254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1699455_1700517_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046721.1|1700697_1700865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1701036_1702011_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 17
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	1710188	1765797	3146909	protease,transposase,tRNA	Klosneuvirus(25.0%)	52	NA	NA
WP_016209838.1|1710188_1711082_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209836.1|1711081_1712296_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_032126639.1|1712315_1713602_-	GTPase HflX	NA	NA	NA	NA	NA
WP_016209846.1|1713617_1713872_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_036777393.1|1714107_1715475_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209826.1|1715805_1716828_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_155064795.1|1717656_1719114_+	amino acid permease	NA	NA	NA	NA	NA
WP_054300271.1|1719353_1720328_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556633.1|1720436_1721333_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209827.1|1721651_1723211_+	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_075273569.1|1723286_1723493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209831.1|1723700_1724399_+	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209832.1|1724677_1724941_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_036777412.1|1725247_1727842_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209835.1|1727838_1728321_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209844.1|1728298_1729339_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209840.1|1729511_1729997_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_032126641.1|1730104_1732675_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_032126642.1|1732710_1733172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047141.1|1733241_1733448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211648.1|1734651_1735191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067955.1|1735151_1735337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211650.1|1736138_1737623_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211651.1|1737747_1739283_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032126362.1|1739516_1739882_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047140.1|1739827_1740412_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047139.1|1740435_1740840_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047138.1|1740815_1741298_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728346.1|1741315_1741648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300375.1|1742454_1742655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210928.1|1742869_1743175_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_075273327.1|1743225_1743801_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1743746_1744112_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047261.1|1744165_1744525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046724.1|1744521_1744689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210921.1|1744913_1745498_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_016210925.1|1745589_1746276_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.5	9.7e-29
WP_036778116.1|1746399_1747584_-	aminoacetone oxidase family FAD-binding enzyme	NA	NA	NA	NA	NA
WP_016210917.1|1747797_1749240_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.5	5.4e-21
WP_016210927.1|1749364_1750315_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210930.1|1750375_1751149_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210918.1|1751152_1751902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210926.1|1751986_1753456_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_155046963.1|1753715_1754282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273571.1|1754387_1755065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211012.1|1755502_1756075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778113.1|1756183_1757686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047137.1|1757778_1760208_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036778111.1|1760486_1761683_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_036778109.1|1761743_1764110_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_032126362.1|1764910_1765276_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273298.1|1765221_1765797_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	1770333	1831471	3146909	transposase,tRNA	Staphylococcus_phage(12.5%)	59	NA	NA
WP_081007040.1|1770333_1770990_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016210510.1|1771020_1771749_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_016210506.1|1771741_1772980_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210512.1|1773115_1774153_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210515.1|1774206_1775109_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210514.1|1775217_1776471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|1776528_1780026_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_075273576.1|1780085_1780814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778516.1|1780941_1781490_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016210508.1|1781810_1783508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1783516_1784670_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_036781272.1|1785265_1785484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047136.1|1785576_1786008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|1786175_1786541_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047135.1|1786486_1787062_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211467.1|1787136_1787703_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_032126344.1|1787705_1788794_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032126343.1|1788914_1789727_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_054300379.1|1789857_1791843_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211470.1|1791902_1792556_-	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_155047134.1|1793322_1794345_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047133.1|1794616_1795591_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	2.6e-27
WP_016212421.1|1796341_1796524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377879.1|1796875_1797100_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155047132.1|1797244_1797907_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.6	5.3e-32
WP_032126637.1|1798023_1798317_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556508.1|1798378_1798822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047131.1|1799092_1799749_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047130.1|1799936_1800695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1800757_1801819_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211841.1|1802678_1803131_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211839.1|1803248_1804721_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211840.1|1804879_1805344_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211838.1|1805814_1805988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1806697_1807063_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1807008_1807584_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300250.1|1807573_1808233_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_032126143.1|1808332_1809604_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_016211422.1|1809692_1810163_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_051307357.1|1810185_1810779_-	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211417.1|1810915_1811965_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_016211415.1|1811988_1812912_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1812928_1813390_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211414.1|1813497_1814316_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_129556449.1|1814531_1815038_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1815052_1815418_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047129.1|1815621_1816278_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300382.1|1816548_1816971_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300383.1|1817241_1819722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126139.1|1819817_1820747_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_016210804.1|1820753_1822673_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.0	4.5e-84
WP_032126141.1|1822737_1824012_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016210805.1|1824430_1825102_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_036776426.1|1825110_1825962_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_016210803.1|1826139_1827438_+	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_054300162.1|1827512_1828595_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212040.1|1828800_1830150_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_016212039.1|1830326_1830884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133287.1|1831072_1831471_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	1881771	1987548	3146909	transposase,tRNA	uncultured_Mediterranean_phage(21.05%)	95	NA	NA
WP_054300173.1|1881771_1882833_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780082.1|1883376_1884282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212000.1|1884412_1885141_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016212002.1|1885260_1885539_+	DNA-J related family protein	NA	NA	NA	NA	NA
WP_129556478.1|1885542_1886429_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047008.1|1886486_1886801_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016210889.1|1886818_1889665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210887.1|1890174_1891125_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210886.1|1891207_1891987_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_052104770.1|1892055_1892763_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210888.1|1892723_1892975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|1892997_1893294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|1893827_1894601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|1894633_1895230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300398.1|1895287_1896169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300399.1|1896510_1896777_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300400.1|1896921_1897164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|1897220_1897748_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107517381.1|1898413_1898608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1898821_1899175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211827.1|1899506_1900127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211823.1|1900167_1900356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047122.1|1900390_1904482_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211770.1|1904681_1905815_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_016211771.1|1905828_1906017_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_054300276.1|1906309_1907284_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_075273594.1|1907323_1908694_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	4.2e-39
WP_054300404.1|1908766_1909660_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209948.1|1909768_1910686_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_036777569.1|1910737_1911493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209939.1|1911560_1912835_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_036777566.1|1912969_1913647_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_016209944.1|1913847_1915275_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209938.1|1915249_1915888_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209925.1|1916097_1916376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209935.1|1916609_1917554_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_036777561.1|1917575_1919444_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209930.1|1919464_1919818_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_036777579.1|1919856_1920972_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.9	4.8e-94
WP_016209932.1|1921154_1922195_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209945.1|1922197_1923232_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209926.1|1923228_1924290_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209931.1|1924401_1925874_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_052104625.1|1926026_1926470_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209940.1|1926545_1929317_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_036777555.1|1929473_1930703_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1930729_1931392_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_054300405.1|1931913_1932414_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047121.1|1932515_1933619_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	9.5e-10
WP_075274669.1|1933823_1934126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300286.1|1934510_1934975_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105962623.1|1935138_1936291_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047120.1|1936300_1936645_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047119.1|1936929_1938252_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_081007042.1|1938660_1939476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300406.1|1942029_1944765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1945065_1946127_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126856.1|1946187_1946529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1946833_1947987_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_032126362.1|1948621_1948987_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1948932_1949508_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212005.1|1949846_1951607_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_016210592.1|1951996_1952653_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016210586.1|1952665_1954171_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210593.1|1954192_1954723_-	colicin V production protein	NA	NA	NA	NA	NA
WP_016210590.1|1954802_1956065_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210587.1|1956239_1957100_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_032126176.1|1957201_1957984_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210588.1|1958074_1959400_-	fimV domain protein	NA	NA	NA	NA	NA
WP_016210595.1|1959767_1960946_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210594.1|1961122_1961776_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_036778626.1|1961911_1963852_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_129556498.1|1963848_1964457_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054300271.1|1964636_1965611_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080728317.1|1965801_1969167_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211391.1|1969233_1969809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779996.1|1969820_1971377_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_036779999.1|1971396_1971828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780001.1|1971814_1972078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372269.1|1972434_1972806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212466.1|1973010_1973736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212252.1|1974050_1974209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047118.1|1974246_1975689_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_075273327.1|1975678_1976254_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1976199_1976565_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274672.1|1976602_1977196_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211114.1|1977561_1980492_-	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_016211115.1|1980624_1982577_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211112.1|1982769_1983417_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211113.1|1983472_1984798_+	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_032126179.1|1984827_1985079_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_080664854.1|1985036_1985618_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_054300408.1|1985954_1986611_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_032126362.1|1986661_1987027_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1986972_1987548_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	2017282	2126663	3146909	transposase,tRNA	Acinetobacter_phage(18.18%)	112	NA	NA
WP_129556499.1|2017282_2018436_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211588.1|2018603_2019305_-	cyclase family protein	NA	NA	NA	NA	NA
WP_032126329.1|2019380_2020010_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_129556496.1|2020195_2021434_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_036778365.1|2021708_2022371_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_016211589.1|2022360_2023593_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_129556495.1|2023715_2023973_+	VOC family protein	NA	NA	NA	NA	NA
WP_032126637.1|2024953_2025247_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_032126540.1|2025477_2026341_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046995.1|2026474_2027360_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126332.1|2028007_2029207_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_016211366.1|2029459_2029747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779263.1|2029802_2031812_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_032126330.1|2032154_2033114_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_016211367.1|2033261_2034044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273303.1|2034199_2034916_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_016210281.1|2034929_2036321_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_016210270.1|2036362_2039350_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210277.1|2039419_2040253_-	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210279.1|2040306_2041473_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210272.1|2041460_2042171_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210283.1|2042210_2042996_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_129556492.1|2043023_2043767_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|2043864_2046060_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_016210271.1|2046136_2046820_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_032126334.1|2046830_2047262_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_036778186.1|2047301_2047700_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_016210273.1|2048072_2048780_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210275.1|2048844_2049147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210276.1|2049202_2049679_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210284.1|2049733_2050255_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210280.1|2050336_2051431_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_075273327.1|2051842_2052418_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2052363_2052729_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047116.1|2052689_2052941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300415.1|2053530_2054232_+	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	33.0	1.6e-07
WP_032126500.1|2054365_2055082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211118.1|2055218_2056466_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126499.1|2056844_2057456_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211122.1|2057552_2058419_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|2058422_2059184_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_036779309.1|2059347_2060253_+	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211125.1|2060475_2061306_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211126.1|2061475_2061865_+	lipoprotein	NA	NA	NA	NA	NA
WP_032126498.1|2061997_2062558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|2062619_2062985_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2062999_2063506_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047115.1|2063502_2063907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212585.1|2064201_2064522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2064633_2065608_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273327.1|2065977_2066553_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2066498_2066864_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274673.1|2066824_2067823_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780900.1|2067993_2068647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047081.1|2068697_2069135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212519.1|2069405_2069786_-	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_054300173.1|2069860_2070922_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212611.1|2070969_2071290_-	histidine kinase	NA	NA	NA	NA	NA
WP_081377357.1|2071773_2072175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046957.1|2072230_2073082_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_155047114.1|2073583_2073838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211088.1|2073957_2074920_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211087.1|2075127_2076123_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_016211081.1|2076150_2077086_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|2077126_2077588_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080664852.1|2077566_2078610_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_155047113.1|2078622_2080209_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_081007043.1|2080168_2081911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|2082634_2084671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211709.1|2086930_2087077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274676.1|2087235_2087433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777508.1|2087507_2087780_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_155047112.1|2087856_2088396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|2088675_2089561_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047111.1|2089565_2090894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047110.1|2091010_2092072_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126869.1|2092049_2092289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2092809_2093385_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2093330_2093696_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047109.1|2093757_2094171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556488.1|2095351_2096202_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275079.1|2096350_2097412_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126801.1|2097459_2097969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274679.1|2098637_2099699_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212218.1|2101149_2101500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285943.1|2101644_2102481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778728.1|2102534_2103827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104686.1|2104062_2106819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046956.1|2107288_2107453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046955.1|2107974_2108154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|2108395_2109097_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|2109357_2109564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941967.1|2109793_2110099_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126840.1|2110277_2112275_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2112258_2113305_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016212098.1|2114025_2114877_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016212100.1|2114877_2115798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212654.1|2116208_2116493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|2116484_2116940_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2116899_2117238_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212093.1|2117450_2118380_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_129556559.1|2118536_2118965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047107.1|2119045_2119498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2119523_2120429_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|2120625_2121234_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155047106.1|2121274_2122161_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556499.1|2122357_2123510_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211971.1|2123716_2124328_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032126649.1|2124348_2125545_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_017377024.1|2125641_2125782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211968.1|2125794_2126199_-	SufE family protein	NA	NA	NA	NA	NA
WP_075273313.1|2126324_2126663_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	2130679	2178342	3146909	protease,transposase,tRNA	Salinibacter_virus(16.67%)	46	NA	NA
WP_081007045.1|2130679_2131309_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036777096.1|2132411_2133752_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209885.1|2133814_2134528_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016209894.1|2134696_2135188_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209887.1|2135331_2135823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209877.1|2136025_2136916_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_080664826.1|2137115_2137715_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_052104598.1|2137795_2138734_-	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	29.6	1.9e-14
WP_036777110.1|2138785_2139880_-	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_052104599.1|2140004_2141321_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	40.1	3.2e-65
WP_016209893.1|2141663_2146553_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_016209881.1|2146645_2146948_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_016209876.1|2147058_2148981_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_016209888.1|2149002_2150298_+	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_016209898.1|2150294_2151905_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_052104600.1|2152011_2152905_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_016209884.1|2153014_2153638_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036777115.1|2153714_2153915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209891.1|2154056_2154755_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016209896.1|2154901_2155471_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_122940402.1|2155785_2156409_-	porin family protein	NA	NA	NA	NA	NA
WP_032126745.1|2156617_2157220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2157291_2158177_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|2158400_2159287_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273603.1|2159366_2159543_+	phosphatase	NA	NA	NA	NA	NA
WP_016212526.1|2159666_2160200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047105.1|2160370_2161252_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.1	3.4e-50
WP_016212445.1|2161494_2161761_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126686.1|2161819_2162404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274681.1|2162954_2163830_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063519.1|2163878_2164295_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210465.1|2164581_2165424_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_016210463.1|2165474_2165822_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210471.1|2166012_2166900_+	ROK family protein	NA	NA	NA	NA	NA
WP_016210467.1|2167014_2167617_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210468.1|2167613_2168333_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_052104601.1|2168401_2170114_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_036777098.1|2170261_2172199_+	AsmA family protein	NA	NA	NA	NA	NA
WP_032126596.1|2172307_2173360_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_016210461.1|2173359_2173635_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016210458.1|2173715_2174264_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_051307322.1|2174537_2174717_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_155047104.1|2174720_2175002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2175058_2175424_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047103.1|2175539_2176661_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_155049817.1|2177455_2178342_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	2202524	2285200	3146909	transposase,tRNA	Staphylococcus_phage(29.41%)	83	NA	NA
WP_075273327.1|2202524_2203100_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2203045_2203411_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036780787.1|2203609_2204569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2204937_2206020_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_155047098.1|2206035_2207328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047097.1|2207403_2208087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211538.1|2208781_2209705_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_054300443.1|2209943_2210222_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|2210274_2210523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300444.1|2210480_2211542_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212177.1|2212537_2212711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212174.1|2212787_2213045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781320.1|2215263_2215491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|2215477_2215804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|2215805_2216237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2216765_2217827_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300445.1|2217921_2218473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|2218742_2219762_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|2219748_2220171_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|2220172_2220646_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_052133275.1|2220761_2221385_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210836.1|2221414_2222089_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|2222094_2223243_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|2223239_2223701_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210830.1|2223776_2225027_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_016210824.1|2225153_2226833_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|2226942_2227809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2228711_2229686_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_036781250.1|2229781_2230567_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307345.1|2230710_2231397_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211002.1|2231430_2231829_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|2231992_2232298_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_016210998.1|2232375_2232630_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|2232783_2234445_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|2234504_2235188_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|2235187_2236276_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016211004.1|2236324_2238961_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300173.1|2239373_2240435_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300448.1|2240624_2242994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2243037_2244012_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300449.1|2244031_2244811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|2244940_2245279_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2245238_2245694_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211507.1|2246019_2247339_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|2247342_2248059_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211506.1|2248055_2248697_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_081007048.1|2248689_2248788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2249128_2249494_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2249439_2250015_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047096.1|2250046_2250319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047095.1|2250375_2250516_+	phosphatase	NA	NA	NA	NA	NA
WP_155047094.1|2250660_2251128_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211503.1|2251278_2251734_-	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_016211508.1|2251788_2252133_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211502.1|2252162_2253206_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_105962625.1|2254395_2255282_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210192.1|2255594_2256113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210193.1|2256484_2256646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210194.1|2256702_2257050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036778869.1|2257084_2257747_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_036778872.1|2257790_2258396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210201.1|2258625_2259681_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	3.4e-49
WP_016210187.1|2259684_2262870_+	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_016210205.1|2262950_2263907_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.6	5.3e-49
WP_016210206.1|2263955_2264492_+	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	38.4	8.4e-20
WP_016210199.1|2264488_2265250_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_036778866.1|2265355_2267944_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.9	3.3e-122
WP_032126472.1|2268406_2269057_-	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_016210190.1|2269276_2270152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210195.1|2270342_2270744_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_016210198.1|2270760_2271312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210188.1|2271623_2272310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779341.1|2272310_2274521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210196.1|2274874_2275228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300452.1|2275185_2276247_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075285950.1|2276311_2276920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556449.1|2276909_2277416_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300455.1|2277430_2277796_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273329.1|2277756_2279058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2279105_2280167_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556651.1|2280354_2281563_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300173.1|2281804_2282866_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211428.1|2283136_2285200_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.8	3.8e-36
>prophage 23
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	2325470	2387812	3146909	transposase,tRNA	Planktothrix_phage(18.18%)	57	NA	NA
WP_129556571.1|2325470_2326181_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2326209_2326614_+	RidA family protein	NA	NA	NA	NA	NA
WP_036777168.1|2326638_2327598_-	response regulator	NA	NA	NA	NA	NA
WP_016209567.1|2327729_2328347_-	MFS transporter	NA	NA	NA	NA	NA
WP_155046949.1|2328417_2328588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126712.1|2328781_2329240_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209553.1|2329984_2330995_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	42.2	2.9e-58
WP_016209566.1|2331479_2332391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209545.1|2332716_2336211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209551.1|2336248_2337088_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.0	1.8e-45
WP_036777155.1|2337274_2337490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209547.1|2337538_2338114_-	ribonuclease HI	NA	V9M0C8	Vibrio_phage	46.6	1.3e-29
WP_016209540.1|2338110_2338449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209568.1|2338617_2339607_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.7	1.7e-18
WP_016209572.1|2339607_2340570_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-16
WP_054300271.1|2341525_2342500_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212612.1|2342637_2342871_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300455.1|2342964_2343330_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2343344_2343851_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212572.1|2343908_2344301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2344430_2344796_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300461.1|2344852_2345161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2345252_2345828_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2345773_2346139_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|2346291_2346564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126774.1|2347172_2347508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307356.1|2347667_2349200_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_016211407.1|2349232_2350072_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211411.1|2350068_2350566_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_036779082.1|2350569_2351562_-	AAA family ATPase	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_155047091.1|2351676_2353023_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_054300173.1|2353246_2354308_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212287.1|2354386_2355532_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_016211372.1|2361339_2362197_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016211371.1|2362183_2363107_-	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_036778204.1|2363303_2364695_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211369.1|2364741_2365785_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211370.1|2365827_2366271_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211374.1|2366403_2367594_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211373.1|2367648_2367795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|2368345_2369263_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_036794860.1|2369530_2369824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|2369900_2370095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300462.1|2371113_2372031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210876.1|2372496_2373339_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016210873.1|2373406_2374057_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210874.1|2374071_2375112_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210882.1|2375234_2376320_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210872.1|2376346_2377456_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210871.1|2377472_2377790_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210879.1|2377786_2378146_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_080664847.1|2381477_2382431_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_054300173.1|2382503_2383565_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212048.1|2384328_2384886_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_032126664.1|2385079_2385763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126663.1|2386481_2386724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|2386750_2387812_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	2477705	2560416	3146909	transposase,tRNA	Escherichia_phage(37.93%)	82	NA	NA
WP_054300202.1|2477705_2478434_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019244.1|2478523_2479135_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_036779399.1|2479491_2479746_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|2479844_2481629_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_036779389.1|2481717_2482437_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210951.1|2482619_2482826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779393.1|2482825_2483062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|2483074_2483452_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|2483958_2484777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779396.1|2484870_2485068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210946.1|2485162_2486548_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210945.1|2486674_2487265_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_155047083.1|2489456_2490185_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	4.3e-43
WP_016211816.1|2491253_2491607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|2491648_2493262_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_075274932.1|2493483_2493705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2494013_2494742_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211951.1|2495358_2496456_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|2496489_2497740_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_054300202.1|2497879_2498608_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212193.1|2498730_2499069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|2499136_2499523_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|2499519_2499765_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300475.1|2500173_2500902_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016211625.1|2501385_2502255_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_036779883.1|2502251_2503601_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.2	2.1e-75
WP_016211623.1|2503713_2505354_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_054300202.1|2506168_2506897_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300478.1|2507176_2508913_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_155047082.1|2509074_2509254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300477.1|2509416_2510145_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016212214.1|2510303_2510804_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016212213.1|2510778_2511288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2512041_2512770_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300479.1|2512920_2513961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211653.1|2514158_2515184_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_016211652.1|2515291_2516497_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211655.1|2516756_2517170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|2517298_2517868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|2517871_2518204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300480.1|2518196_2519036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047081.1|2519123_2520671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|2521120_2521624_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|2521586_2522294_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|2522362_2523223_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_036777969.1|2523203_2523977_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|2524007_2525261_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|2525260_2526223_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|2526266_2527019_+	ComF family protein	NA	NA	NA	NA	NA
WP_036777977.1|2527072_2528953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210615.1|2529100_2529571_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|2529616_2529856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777984.1|2529874_2530324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|2530544_2531969_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_016210618.1|2532033_2533083_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|2533349_2534129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556587.1|2534180_2535083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047080.1|2535141_2535888_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	4.4e-19
WP_016210616.1|2536136_2538947_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_081007053.1|2539181_2540042_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_155047079.1|2540884_2541127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|2541281_2542434_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047078.1|2542620_2542956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2543048_2543348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2543337_2543502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047077.1|2543733_2544886_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	4.4e-58
WP_155047076.1|2544895_2545171_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066236.1|2545405_2545813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049820.1|2545777_2546233_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273369.1|2546341_2547157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047075.1|2547230_2548151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|2548162_2548891_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_080664881.1|2548980_2549187_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081007054.1|2549349_2550582_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	1.1e-27
WP_054300482.1|2551097_2552387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049821.1|2553545_2553734_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047219.1|2553780_2554509_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032127022.1|2555185_2557372_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_087910645.1|2557433_2558587_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274943.1|2558872_2559397_+	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_129556588.1|2559587_2559755_-	phosphatase	NA	NA	NA	NA	NA
WP_075274944.1|2559699_2560416_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
>prophage 25
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	2575757	2603944	3146909	protease,integrase,transposase,tRNA	Acinetobacter_phage(12.5%)	26	2573146:2573205	2590986:2591274
2573146:2573205	attL	ACGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTT	NA	NA	NA	NA
WP_155047267.1|2575757_2575967_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007057.1|2577294_2577711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|2577768_2578921_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_016212230.1|2578977_2580426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|2581959_2582148_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046946.1|2583549_2583825_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|2583827_2584430_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_016212522.1|2584526_2584781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|2585325_2586405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780431.1|2586723_2588442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2588485_2589391_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155049822.1|2589861_2590017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047221.1|2590408_2590888_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	42.0	1.7e-11
WP_155047222.1|2590996_2591671_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.8	2.2e-09
2590986:2591274	attR	AAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTT	NA	NA	NA	NA
WP_155047223.1|2591714_2591960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210068.1|2592590_2593166_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_036778086.1|2593241_2594117_-	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_052104629.1|2594517_2595543_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047224.1|2595686_2596163_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778088.1|2596147_2597230_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.0e-20
WP_036777829.1|2597470_2597875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210073.1|2598587_2599319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210076.1|2599575_2600877_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210066.1|2601018_2601687_+|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_032126425.1|2602130_2602727_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210052.1|2602747_2603944_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
>prophage 26
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	2633160	2685620	3146909	transposase,tRNA	Microbacterium_phage(12.5%)	56	NA	NA
WP_054300282.1|2633160_2633625_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047228.1|2633681_2634164_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556590.1|2635018_2635414_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_032126312.1|2635410_2636205_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_036778479.1|2636383_2637109_-	D-Ala-D-Ala dipeptidase	NA	NA	NA	NA	NA
WP_016211759.1|2637354_2638542_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_016210935.1|2639118_2639661_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|2639657_2640344_-	acireductone synthase	NA	NA	NA	NA	NA
WP_036778484.1|2640347_2640959_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|2641005_2642025_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|2642126_2642921_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|2642958_2643765_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|2643843_2644893_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|2645090_2646350_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|2646396_2647074_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2647159_2647441_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016210940.1|2647532_2648720_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	6.4e-20
WP_016210820.1|2648956_2649898_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|2650401_2650626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|2650917_2651622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210823.1|2652092_2652731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|2653065_2653596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779158.1|2653592_2655125_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2655121_2656072_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2656492_2657125_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2657367_2657565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2657939_2658305_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2658361_2658526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2658515_2658815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2658862_2659291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300194.1|2659368_2660067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2660044_2661106_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126306.1|2661330_2661627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556591.1|2661731_2662388_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2662611_2663109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047229.1|2664318_2664780_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2664739_2665078_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036778253.1|2665135_2666674_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_098082804.1|2666785_2667884_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_016210987.1|2668121_2669321_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_016210981.1|2669350_2669989_+	ribonuclease T	NA	NA	NA	NA	NA
WP_016210983.1|2670004_2672188_-	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	1.1e-06
WP_032126304.1|2672425_2672770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300193.1|2673815_2674022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104666.1|2674186_2674645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212032.1|2675232_2676360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|2676483_2677146_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|2677237_2677483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211963.1|2678556_2679216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|2679317_2679968_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_054300271.1|2680459_2681434_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126299.1|2681684_2681906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047230.1|2682194_2682617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047231.1|2682617_2683151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300190.1|2683645_2684608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046995.1|2684734_2685620_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	2746499	2804532	3146909	protease,transposase,tRNA	Staphylococcus_phage(37.5%)	57	NA	NA
WP_054300271.1|2746499_2747474_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047235.1|2747493_2748480_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2748570_2749317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275004.1|2749441_2750305_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|2750548_2750911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273422.1|2751097_2751625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556595.1|2751769_2752186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|2754282_2755194_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|2755245_2756094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|2756538_2757249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556596.1|2757340_2758309_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|2758296_2758944_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_036779767.1|2758972_2759824_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|2759838_2761116_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|2761156_2761672_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_054300183.1|2761750_2762812_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|2762833_2763922_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_036777788.1|2763966_2765802_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2765844_2766315_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2766351_2766687_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080664840.1|2766699_2767416_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|2767352_2768369_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|2768365_2768845_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|2768928_2771409_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2771471_2771837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|2772175_2772514_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2772473_2772929_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2772943_2773234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777784.1|2773299_2774898_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2775028_2775364_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_036777781.1|2775391_2777056_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	5.4e-33
WP_016210581.1|2777052_2777697_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|2777696_2778440_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2778498_2778738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2778888_2780256_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|2780266_2780818_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126278.1|2780898_2781882_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|2782003_2783761_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126277.1|2783983_2784574_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_155049840.1|2784662_2785082_-	DksA protein	NA	NA	NA	NA	NA
WP_075273416.1|2785222_2785837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212327.1|2785897_2786683_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075273313.1|2786936_2787275_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007003.1|2787234_2787696_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2788068_2789043_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212084.1|2789324_2790341_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126534.1|2790340_2790856_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212085.1|2790897_2791371_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_155047236.1|2791426_2791969_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212310.1|2791992_2792448_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_155046996.1|2794221_2796735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046997.1|2797669_2800192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2800766_2801828_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2801854_2802430_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2802375_2802741_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046755.1|2802812_2802989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|2803379_2804532_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 28
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	2929400	2993532	3146909	transposase	Staphylococcus_phage(16.67%)	54	NA	NA
WP_054300271.1|2929400_2930375_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211161.1|2930957_2932067_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|2932078_2932723_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|2932741_2933728_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|2933807_2934884_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|2935086_2935911_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|2936227_2937232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|2937440_2938406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047242.1|2938544_2939420_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2939716_2940769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211698.1|2941036_2941465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2941678_2942170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2942225_2943476_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2943578_2943797_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_036777591.1|2944254_2945109_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_016210728.1|2945163_2945634_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2946021_2947401_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2947428_2947887_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2947864_2949082_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2949273_2949510_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2949523_2949679_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2949759_2950722_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2950881_2952198_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2952207_2952876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2953238_2955053_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_054300166.1|2955170_2955959_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211543.1|2956539_2958291_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016211544.1|2958301_2959102_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.6	5.8e-33
WP_016211545.1|2959204_2959693_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.7	2.4e-29
WP_032126435.1|2959866_2960181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375799.1|2961201_2961546_+	DMT family protein	NA	NA	NA	NA	NA
WP_016210038.1|2967239_2968202_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.0	8.8e-20
WP_016210039.1|2968388_2969648_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|2969871_2970198_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_052104566.1|2970392_2971343_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_032126434.1|2971400_2973467_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_016210049.1|2973472_2974468_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_016210042.1|2975053_2976634_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|2976790_2978200_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_016210047.1|2978259_2979393_-	cation transporter	NA	NA	NA	NA	NA
WP_016210033.1|2979532_2980357_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_016210034.1|2980584_2981214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|2981550_2981922_-	isochorismatase	NA	NA	NA	NA	NA
WP_016210046.1|2982225_2982513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126431.1|2982664_2983513_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_016210037.1|2983640_2984681_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_155047244.1|2984753_2986691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300165.1|2986974_2987634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2987788_2988763_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|2988838_2989858_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047000.1|2989905_2990052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556602.1|2990256_2990466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273820.1|2991340_2992423_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.8	1.2e-142
WP_054300161.1|2992470_2993532_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP038947	Piscirickettsia salmonis strain Psal-028 chromosome, complete genome	3146909	3001417	3115337	3146909	transposase,tRNA	Staphylococcus_phage(33.33%)	113	NA	NA
WP_155047053.1|3001417_3002303_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212222.1|3002779_3003253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|3003249_3003645_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|3004574_3005150_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|3005095_3005461_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036778680.1|3005725_3008056_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_129556603.1|3008176_3010192_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300160.1|3010375_3013768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|3013832_3014138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|3014328_3014508_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_155047245.1|3014511_3014700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047246.1|3014723_3015698_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	1.8e-28
WP_032126362.1|3015955_3016321_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047247.1|3016384_3016753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|3016756_3017643_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047248.1|3017706_3018393_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047249.1|3018645_3019746_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556605.1|3020140_3021250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|3022292_3022658_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047002.1|3022672_3023278_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036776867.1|3023648_3025046_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.8e-77
WP_051307313.1|3025165_3026113_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|3026109_3026625_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|3026611_3027811_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|3027807_3028131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|3028132_3029362_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|3029361_3030405_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|3030404_3031088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3031084_3033574_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3033590_3033845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3033845_3034202_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|3034981_3036145_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|3036164_3039272_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|3039273_3040779_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3040806_3041088_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3041236_3041578_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3041697_3043578_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_059372650.1|3043662_3045261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3045278_3046394_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|3046521_3047520_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_052104582.1|3047523_3048282_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3048283_3049483_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3049466_3050138_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3050159_3050936_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3050939_3051938_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3051939_3052518_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3052514_3053984_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3054027_3054315_-	trp operon repressor	NA	NA	NA	NA	NA
WP_155047250.1|3054515_3055112_+	EamA family transporter	NA	NA	NA	NA	NA
WP_054300152.1|3055138_3055504_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|3055560_3055716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273401.1|3055860_3056313_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047251.1|3056350_3056575_+	EamA family transporter	NA	NA	NA	NA	NA
WP_155047003.1|3058170_3059056_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3059242_3059464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047252.1|3059579_3060158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047253.1|3060302_3060497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3060555_3061530_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|3061583_3062645_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776841.1|3063372_3063912_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|3063996_3064533_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|3065184_3065487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|3065936_3066245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556607.1|3066853_3067303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|3067585_3068296_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|3068522_3068921_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_036778156.1|3069788_3070739_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3070738_3072817_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3072964_3073480_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3073488_3074052_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3074032_3074779_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3074918_3075371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|3075794_3076631_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3076627_3077524_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3077556_3078624_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3078642_3079011_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3079036_3080485_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3080494_3081874_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3081914_3083246_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|3083217_3084177_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3084269_3084773_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3084907_3086059_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3086055_3086535_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3086681_3089003_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3088947_3089574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3089578_3090478_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3090550_3091129_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3091429_3091687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556718.1|3091695_3092882_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_155046758.1|3093696_3093828_+	phosphatase	NA	NA	NA	NA	NA
WP_155046759.1|3093972_3094128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777721.1|3094455_3095229_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155047254.1|3096165_3096303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3096346_3097321_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3098415_3098754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007065.1|3098770_3099610_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_081007013.1|3099822_3100122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|3100111_3100276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|3100332_3100698_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3102002_3102698_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3102694_3104122_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3104147_3104411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3104483_3105458_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047005.1|3105516_3106367_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|3106404_3106749_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3106745_3107582_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3107582_3107924_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3107925_3108531_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3108527_3110522_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3110541_3111483_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_052104719.1|3111710_3113135_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|3113647_3114622_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3114680_3115337_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP038948	Piscirickettsia salmonis strain Psal-028 plasmid unnamed1, complete sequence	189008	1943	170497	189008	protease,integrase,tail,transposase,capsid,head	Streptococcus_phage(20.0%)	177	87927:87986	116024:117199
WP_054300202.1|1943_2672_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|2875_5452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|5568_6546_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155047285.1|6564_6822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774631.1|7955_8420_+	hypothetical protein	NA	H6WFS7	Cyanophage	38.2	2.9e-21
WP_080963647.1|8758_8929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|10599_11328_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155047299.1|11511_12870_-	DEAD/DEAH box helicase	NA	D2J050	Enterococcus_phage	50.5	2.6e-126
WP_155047286.1|12959_13526_-	helix-turn-helix domain-containing protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	35.0	1.4e-20
WP_017377658.1|13529_14216_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|14463_15192_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155049831.1|15221_15761_-	helix-turn-helix domain-containing protein	NA	W5R8L2	Staphylococcus_phage	34.9	1.0e-04
WP_032126239.1|16342_16615_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049830.1|16689_17271_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.6	4.2e-33
WP_155049829.1|17326_18061_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_054300202.1|19096_19825_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155047021.1|19848_20004_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_075273760.1|20106_22509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273757.1|22852_23302_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556703.1|25782_26271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211956.1|26328_27057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211955.1|27513_28494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275154.1|28630_29287_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.7	7.6e-31
WP_036771347.1|29649_30627_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046642.1|31256_31748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242576.1|31775_33638_-	AAA family ATPase	NA	A0A088C4M0	Shewanella_sp._phage	30.9	1.0e-56
WP_036771347.1|33830_34808_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155047288.1|34822_34948_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047289.1|34880_35057_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275025.1|35306_37322_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155047291.1|38983_41014_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|41148_42126_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155047292.1|42176_43094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|43883_45037_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273751.1|45386_47117_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155047019.1|47129_47282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047293.1|47771_48497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|48649_49378_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126843.1|49754_49934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126844.1|50152_50449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212118.1|50543_51005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780014.1|51358_52801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780017.1|52961_53336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047014.1|53406_53748_-	hypothetical protein	NA	A0A1B1IQX9	uncultured_Mediterranean_phage	60.3	1.7e-21
WP_054300202.1|53966_54695_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155047294.1|54901_55564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047295.1|55809_56871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|56900_57983_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_155047300.1|58102_58375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047296.1|58483_59119_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	42.5	1.4e-34
WP_155046765.1|60005_60200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047015.1|60580_60904_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212122.1|61780_62482_+	ParA family protein	NA	J9Q7R7	Salmonella_phage	31.8	1.1e-19
WP_016212121.1|62435_63359_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_105962625.1|63792_64678_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.7	4.5e-10
WP_016212151.1|65280_66243_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|66266_66581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|66644_67619_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_033923686.1|67743_68793_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|68901_69942_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|69955_70585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|70675_70975_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_081377909.1|70971_71436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104769.1|72397_73321_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_155067971.1|73663_73834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|74465_75618_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075274741.1|75687_75945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273822.1|76046_76547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|76991_78074_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212255.1|78260_78431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126838.1|78427_78631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212257.1|78967_79192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212260.1|79211_79484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|79641_80616_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_129556717.1|81270_82497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|82822_83659_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_016212398.1|83921_84383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047268.1|84549_84930_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|86018_86384_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|86329_86905_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_105962623.1|87888_89042_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
87927:87986	attL	ATAAATAATCATTAGCTGAGTGAATGCGTTTTCTGTTATAAAAAACTTCGATATACTCAA	NA	NA	NA	NA
WP_075273810.1|89062_89770_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	34.2	1.4e-11
WP_081007042.1|91929_92745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728342.1|93059_93563_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_105962174.1|93706_93871_+	phosphatase	NA	NA	NA	NA	NA
WP_155047269.1|94019_94415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273806.1|94676_95240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|95345_95801_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_075273804.1|95760_96099_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377694.1|96183_96912_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_016212413.1|97245_97674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923775.1|97721_98462_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	4.6e-08
WP_032126346.1|98528_98771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273798.1|98862_99087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307367.1|99195_99720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047270.1|99840_99987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047297.1|100131_100278_-	phosphatase	NA	NA	NA	NA	NA
WP_032126138.1|101486_101750_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_016211871.1|102315_102651_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_129556699.1|102644_102845_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_054300590.1|103152_103377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|103993_105019_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273790.1|105563_105866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049901.1|105855_106377_-	hypothetical protein	NA	A0A222ZGQ4	Arthrobacter_phage	34.4	6.9e-19
WP_016212412.1|106782_106947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|106939_107389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|107636_107810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212499.1|108014_108389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|109387_110540_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_075273786.1|110549_110948_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211913.1|111380_112502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|112827_113100_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_032126795.1|113103_113364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211912.1|113636_114227_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
WP_129556698.1|114316_115018_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_054300249.1|115131_115497_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|115511_116018_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	25.5	1.0e-06
WP_155047271.1|116021_117139_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	3.6e-57
WP_051307374.1|117253_117730_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
116024:117199	attR	ATAAATAATCATTAGCTGAGTGAATGCGTTTTCTGTTATAAAAAACTTCGATATACTCAAAGATCGCTGATTTAGCCTCCTGTCGATTTTTAAAATTCATGTGATGAACTAACTCCGTTTTTAAGGTATGAAAGAAACTCTCTGAAACAGCGTTATCCCAGCAGTCTCCCTTACGACTCATACTTTGCTTAATTTGATGATCTTTAAGAATCTCACGATGACTTTCTGAAGCATATTGGCTTCCGCGATCTGAATGCCAAATTAACCCAGCTTTAGGCTTTCGTTTCCATAAGGCCATCAACAGAGCATCATTGACGAGTGATGCTTCCATATGATCCTCCATGGCCCAGCCAACAACTTTTCGTGAGAATAAGTCAATCACAACAGCCAAGTACAACCAGCCTTGTTGGGTCCGTATGTAGGTAATATCACCAACATATTTTTGGTTAGGGCCTGTTGCTGAAAAATTCCGGTCCAACACGTTTTTCGCAATTGGCAATCGATGTTTAGAATCCGTAGTTACTTTGAATTTACGCTTTATCTTGCAGCAAAGCTGGTTCTGCTTCATTAAACGGCCAACTCGCTTACGGCTTACAGAAATTTCCTGTGTTGCCAACTGTTTTCTAATTCTTCGAGTACCATAGGTTGCACGGCTTTCGATGAATATTTCCTTGATTCGCCTAGCTAATTTTTGGTTCTCTATCATTCGCTTGGAAGGCTGTACCTTTAACCAACTGTAATAACCTGATCGGCTAACACCTAAGATTGAGCACACCCTATCTACTGGAAAAACACATTTATTTTCTTTGATCCAGGCATACTTTACTGTGTTTCGCTTGCAAAGTACGCCGCCGCTTTTTTTAGTATTTCACGTTCCTGTGTCACTCTAGCCAACTCTTTTTTTAACTGTTTTATTTCAGCAGCCATATCACTAACTTCATCTTTAACAGTATTTGGACTGTTTGGATGATATTTATTGACCCAACCATGCAGTGTACTTGAGTGAATACCCAATTCCTGTGCTGTATGACTGATTGCTTGATTTGAATCGACTGCAAGCTTGGCAGATGATTTTTTAAATTCTTCGGTGTACTTGGTGACGTGACGCTTTCCCATTGTGATTCCTCCGGCTCGGATTATTGTAATTTATTTGTCCGGAATAGGGTAGCCTGATCA	NA	NA	NA	NA
WP_016212298.1|117970_118297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|118963_119989_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047272.1|120198_120927_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_054300594.1|121289_122315_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047273.1|122445_122583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046942.1|122721_123608_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.8	2.6e-10
WP_081377350.1|124238_125054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211897.1|125447_125852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|125852_126599_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211895.1|127107_128166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126360.1|128288_129023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211773.1|129609_130284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211775.1|130385_130754_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_016211776.1|130921_132259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556697.1|132741_133134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|133518_134424_-|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
WP_016210664.1|134721_135144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210651.1|135143_135494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210658.1|135490_135886_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210667.1|135878_136202_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210663.1|136198_136510_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	4.3e-08
WP_016210655.1|136828_137425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556716.1|137438_137729_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
WP_052047108.1|137862_138261_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047275.1|138316_138814_-	DNA polymerase	NA	NA	NA	NA	NA
WP_155047276.1|138810_139590_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	31.7	1.8e-18
WP_129556718.1|139618_140804_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_081377350.1|141337_142153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047277.1|142217_142826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067974.1|143040_143184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211936.1|143560_144583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047278.1|145072_145474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|145591_146617_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046767.1|147191_147353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047048.1|147352_147853_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273747.1|148114_148705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|148767_149061_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_155049832.1|149143_150019_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	3.7e-57
WP_052104629.1|150136_151162_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047281.1|151388_151718_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.8	5.5e-06
WP_155047018.1|151785_152589_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.9e-55
WP_075274752.1|152624_152924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|152920_153496_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|153441_153807_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212061.1|154711_156754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|157523_157724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047246.1|157864_158839_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.0	1.9e-25
WP_016212579.1|160335_160533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|161132_162107_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016212456.1|162150_162438_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_036779532.1|162434_162836_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_075273881.1|162845_165032_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.2	9.2e-73
WP_016212404.1|165152_165386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273857.1|166162_166897_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	8.4e-39
WP_155047282.1|167050_167527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556709.1|167601_167691_-	DUF1891 domain-containing protein	NA	NA	NA	NA	NA
WP_052047129.1|167902_169486_-	protein kinase	NA	NA	NA	NA	NA
WP_075274745.1|169768_170497_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	1.2e-37
>prophage 1
NZ_CP038949	Piscirickettsia salmonis strain Psal-028 plasmid unnamed2, complete sequence	58519	2671	47757	58519	integrase,portal,tail,transposase,protease,capsid,head	Streptococcus_phage(13.64%)	57	NA	NA
WP_052104629.1|2671_3697_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047304.1|3967_4099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047313.1|4825_5179_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_016211142.1|6767_7034_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075274761.1|7090_7414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047305.1|7415_7838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274762.1|7837_8188_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_075274763.1|8184_8580_-	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	39.1	6.0e-07
WP_075274764.1|8572_8896_-|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	41.7	5.4e-14
WP_075274765.1|8892_9204_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	31.7	2.5e-08
WP_036778347.1|9523_10105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047306.1|10140_11307_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	38.7	1.2e-66
WP_081007077.1|11362_12034_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	45.8	5.5e-45
WP_054300593.1|11981_13223_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	43.6	2.7e-85
WP_155047307.1|13219_13816_-	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.3	2.0e-38
WP_155047308.1|13859_14834_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	8.3e-26
WP_155047309.1|14853_15783_-	hypothetical protein	NA	A0A1W6JP18	Morganella_phage	52.0	1.5e-85
WP_155047310.1|16011_16494_-	hypothetical protein	NA	Q9B019	Phage_GMSE-1	33.3	1.1e-13
WP_032126915.1|16580_16964_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	4.7e-25
WP_052047121.1|17142_17544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126916.1|17688_18159_-	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	48.8	1.5e-33
WP_155047311.1|18146_18449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923627.1|18445_18733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210963.1|18828_19068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047315.1|19064_19412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047314.1|19404_19767_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.9e-24
WP_036780304.1|19735_20272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211080.1|20312_21299_-	helix-turn-helix domain-containing protein	NA	A0A0S2MVA0	Bacillus_phage	45.4	4.3e-14
WP_036780299.1|21337_21640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211079.1|21794_22100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211067.1|22309_23053_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211077.1|23185_23971_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300594.1|24403_25429_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_036780005.1|25576_26224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211069.1|26207_26639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047030.1|26663_26807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211075.1|27021_28263_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211068.1|28266_29079_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080664851.1|29075_29885_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|30087_31062_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047312.1|31097_31439_-	toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.7	2.0e-11
WP_027242955.1|31431_31692_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211925.1|32182_32968_+	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	28.7	9.7e-17
WP_016211928.1|32960_33401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126138.1|33951_34215_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_054300276.1|35145_36120_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.8	2.4e-25
WP_016212188.1|37209_37950_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_155047301.1|38127_38400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|39020_39596_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	6.0e-08
WP_032126136.1|39661_40207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|41240_42266_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047302.1|42919_43999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212274.1|44529_44994_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_032126154.1|45004_45199_-	addiction module toxin, HicA family	NA	A0A1X9I5T5	Streptococcus_phage	48.4	2.8e-10
WP_032126152.1|45414_46005_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.8	1.4e-20
WP_081007075.1|46068_46410_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155047303.1|46755_47757_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.3e-29
>prophage 1
NZ_CP038950	Piscirickettsia salmonis strain Psal-028 plasmid unnamed3, complete sequence	38376	6445	19646	38376	transposase,terminase,tail,protease,portal,capsid,head	Erysipelothrix_phage(25.0%)	15	NA	NA
WP_054300271.1|6445_7420_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047317.1|7554_8391_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_016211139.1|8470_8866_-	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211132.1|8858_9182_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211137.1|9178_9490_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_155047318.1|9680_11015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211140.1|11135_12329_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_080664855.1|12386_13058_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.8	3.0e-43
WP_155047319.1|13005_13626_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	50.9	5.5e-39
WP_052104629.1|13828_14854_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047320.1|14984_15707_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	40.8	2.6e-40
WP_155047321.1|15703_17386_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	45.7	6.9e-137
WP_016212234.1|17388_17868_-|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_155047322.1|17944_18337_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	4.4e-26
WP_054300271.1|18671_19646_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
>prophage 1
NZ_CP038951	Piscirickettsia salmonis strain Psal-028 plasmid unnamed4, complete sequence	33277	10315	26969	33277	tail,transposase	Indivirus(18.18%)	20	NA	NA
WP_036781073.1|10315_10576_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	A0A1S5NR91	Burkholderia_phage	48.8	2.1e-13
WP_081007079.1|10646_10919_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_129556478.1|11130_12017_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.4	5.8e-10
WP_016212315.1|13555_13990_+	DUF29 domain-containing protein	NA	A0JC30	Ralstonia_phage	39.7	9.1e-25
WP_032126346.1|14089_14332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047334.1|14398_14839_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	37.6	1.1e-06
WP_054300249.1|14799_15165_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047335.1|15179_15623_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	25.5	5.1e-07
WP_054300271.1|16632_17607_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047336.1|17603_17888_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047337.1|17906_18269_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211141.1|18268_18691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275196.1|18692_19016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|19072_19339_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075275195.1|19342_21421_+	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	33.4	2.5e-56
WP_036776958.1|21413_21755_+|tail	phage minor tail family protein	tail	NA	NA	NA	NA
WP_016210666.1|21751_22423_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|22391_23138_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_054300696.1|23127_23685_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_075275194.1|23681_26969_+	host specificity protein J	NA	A0A0R6PIC0	Moraxella_phage	33.2	5.2e-112
