The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	45566	89679	3113959	transposase	Moraxella_phage(16.67%)	46	NA	NA
WP_129556427.1|45566_46142_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46087_46453_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211193.1|46651_47413_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_016211195.1|47714_49241_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49612_50452_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50491_51799_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51773_52943_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|52997_53723_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54001_54391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54550_55456_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55531_55675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274979.1|55722_56562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375632.1|56554_56890_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_155046698.1|57068_57230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|57346_57640_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_016210704.1|58534_60481_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|61135_64198_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|64194_65259_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|65614_66568_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|66599_67763_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|67768_68368_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|68555_69056_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|69073_70162_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|70588_71833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|71829_72672_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_016211096.1|72651_73461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|73639_73867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|73867_74818_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|74873_75425_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|75551_75974_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|75966_76713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|76755_77454_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|77464_78289_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|78618_78987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274980.1|78981_80043_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|80092_80323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|80452_81667_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|81967_83029_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_016211249.1|83042_84770_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_016211245.1|84803_85535_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|85534_86323_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211251.1|86427_87051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|87370_87583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273383.1|87738_88311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046699.1|88515_89088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274981.1|89082_89679_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	136473	178470	3113959	transposase	Staphylococcus_phage(50.0%)	46	NA	NA
WP_054300271.1|136473_137448_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|137949_139362_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|139854_140862_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|140881_142402_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_129556430.1|142458_142665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211018.1|143640_144957_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|145060_145444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|145578_148644_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|148712_149816_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|149839_150394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|150508_151078_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211020.1|151197_151953_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_054300545.1|152119_153181_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_098082829.1|153575_153971_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|153992_154358_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|154414_154579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|154568_154868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|155120_155486_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|155431_156007_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212607.1|156007_156364_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|156452_157028_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|156973_157339_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|157818_158385_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|158396_159182_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|159813_160737_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|160788_161784_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|161815_162310_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_032126724.1|162401_162659_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|162748_163171_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|163489_164206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|164249_164501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556431.1|164514_165942_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|165969_167412_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|167499_167838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|167922_168453_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|168513_170706_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|170748_171234_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|171503_171935_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_016210245.1|171952_172783_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|172797_172941_-	lipoprotein	NA	NA	NA	NA	NA
WP_016210239.1|172971_173856_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|173827_174049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|174222_174501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|175471_176377_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016212383.1|176779_177898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|177894_178470_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	182276	239530	3113959	tail,protease,transposase,tRNA	Escherichia_phage(12.5%)	56	NA	NA
WP_075273327.1|182276_182852_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|182797_183163_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728339.1|183226_183499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212441.1|183766_183991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372761.1|185006_185456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|185519_186248_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016210779.1|186290_187220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210775.1|187512_188106_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_017377589.1|188074_188728_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016210784.1|188905_189877_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210782.1|189899_190796_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_016210786.1|190954_191401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210787.1|191397_192039_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016210789.1|192148_192727_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_016210776.1|193202_193640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047085.1|193964_195305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210785.1|195568_196963_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_075274986.1|198411_199479_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209863.1|199531_199954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209853.1|200194_200638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209873.1|200692_200950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209868.1|200927_201554_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_016209871.1|201631_203614_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|203823_205167_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|205433_208103_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|208126_210046_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|210215_211637_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|211782_212757_+	phospholipase A	NA	NA	NA	NA	NA
WP_016209855.1|212788_213184_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209859.1|213186_213408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|213571_215233_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|215305_215596_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_016209861.1|215821_216277_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|216341_216806_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|216898_218245_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|218244_219150_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|219211_220198_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|220190_220433_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|220554_222099_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_032126611.1|222145_223432_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|223474_224869_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|224892_225072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|225068_225644_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|225589_225955_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274988.1|226016_228251_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_016210079.1|228672_229170_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|229340_230036_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|230138_231701_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|232016_233810_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|233895_234168_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|234173_234800_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|234786_236217_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|236549_237605_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|237573_238251_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|238240_239077_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|239236_239530_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
>prophage 4
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	256927	301858	3113959	transposase,tRNA	Acinetobacter_phage(40.0%)	49	NA	NA
WP_075274991.1|256927_257503_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377888.1|257506_258067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556436.1|258122_259009_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046701.1|259035_259185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|259329_259530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|259577_260039_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|260462_261944_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|262006_263116_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|263213_265175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|265704_266109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|266161_267223_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046702.1|267348_267504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|270449_271602_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556437.1|271644_272067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049804.1|272336_273779_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_032126861.1|273982_274297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046703.1|274490_274628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|274631_275518_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212538.1|275689_276130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210630.1|276659_277775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664846.1|277713_278400_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_032126366.1|278393_279371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210638.1|279409_280573_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210640.1|281037_281262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|281647_281935_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_016210633.1|282109_282865_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556439.1|282870_283326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210637.1|283301_283778_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210636.1|283784_285362_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_032126367.1|285365_286130_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016210629.1|286183_286720_+	tim44-like domain protein	NA	NA	NA	NA	NA
WP_016210634.1|286716_287448_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_032126368.1|287556_288711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275120.1|288855_289167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664872.1|289490_290471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211898.1|290712_291336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211899.1|291663_291957_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_105962625.1|292053_292940_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046704.1|293551_293704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212296.1|293719_294448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126374.1|294556_295528_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664866.1|295559_295976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211609.1|296590_296899_+	double zinc ribbon family protein	NA	NA	NA	NA	NA
WP_032126373.1|296931_299118_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.0	2.7e-141
WP_016211605.1|299221_299455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211606.1|299671_300202_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_016211607.1|300230_300455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273369.1|300637_301453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300526.1|301561_301858_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	329433	374988	3113959	transposase	Hokovirus(33.33%)	46	NA	NA
WP_075273298.1|329433_330009_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210127.1|330061_331087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210128.1|331180_331444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|331810_332629_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|332701_335074_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_016210125.1|335786_337214_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|337248_338271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|338287_338665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126491.1|339022_339340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210122.1|339506_340199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|340825_341800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|341789_343562_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|343562_343910_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_032126493.1|344159_345386_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|345475_346774_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664834.1|346807_347167_-	VUT family protein	NA	NA	NA	NA	NA
WP_080664833.1|347212_347557_-	VUT family protein	NA	NA	NA	NA	NA
WP_016210137.1|347537_348089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664832.1|348315_349614_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|349730_350021_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_016212281.1|350332_351787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|351986_352562_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|352507_352873_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212359.1|353608_353827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|354194_355169_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212044.1|355707_355962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|356684_357671_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|357808_358003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664870.1|358685_359333_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_129556444.1|359325_359748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211797.1|359909_361313_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|361363_361939_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|361884_362199_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556445.1|362239_363126_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126227.1|363764_364055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212008.1|364092_364791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212010.1|364807_365104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212007.1|365227_366373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273619.1|366645_367221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211273.1|367278_368112_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	29.0	3.5e-17
WP_016211268.1|368227_369412_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211271.1|369430_370375_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016211269.1|370679_371465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211272.1|371582_371951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211270.1|372178_373756_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_054300173.1|373926_374988_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	447600	550003	3113959	transposase,tRNA	Escherichia_phage(33.33%)	103	NA	NA
WP_075275004.1|447600_448464_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|448680_450240_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|450261_451296_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|451344_451914_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|452049_453021_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|453032_454610_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|454675_455662_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016210646.1|455993_457103_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|457208_458393_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|458470_460459_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|460667_460823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300511.1|461080_461380_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_075275005.1|461538_461874_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|462790_464197_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|464214_465201_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|465203_466358_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|466354_467050_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|467184_468675_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210494.1|468695_469745_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|469811_471206_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210489.1|472084_474016_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_075273353.1|474020_474551_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|474585_474780_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|474822_475182_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|475601_476597_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_032126132.1|476609_478991_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|478996_479284_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|479555_480032_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|480176_480374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|480498_481473_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|483581_483680_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210477.1|484164_485454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126626.1|485690_486383_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|486424_487198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|487199_488141_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|488273_489851_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|490060_491818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|492366_493125_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|493332_493905_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|494008_494557_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|494858_495104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|495132_495429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300307.1|495633_496362_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_016212268.1|497006_497591_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_016212269.1|497594_498278_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|498560_499289_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_052104629.1|499625_500651_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046711.1|500794_501151_-	hypothetical protein	NA	A0A222Z017	Rhodococcus_phage	55.7	7.5e-09
WP_054300201.1|501100_501829_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_075275021.1|501896_502838_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556625.1|503052_503610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126478.1|503602_503941_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.7e-24
WP_032126479.1|503927_504281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212114.1|504277_504508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212110.1|504511_504982_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	62.5	7.6e-33
WP_054300201.1|505628_506357_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_016212024.1|506752_507001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212021.1|506997_507597_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212022.1|507596_507815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212023.1|508301_509294_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_075273432.1|509290_510025_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_129556453.1|510444_510876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047116.1|511020_511200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|511901_512630_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_051307368.1|513287_514568_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_016211918.1|514567_515536_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_144019154.1|515911_516184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126737.1|516239_516968_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_032126150.1|517048_517282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|517380_518355_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_075275025.1|519870_521886_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_016211807.1|522135_522357_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728351.1|522244_522403_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556454.1|522666_524679_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_075275029.1|524847_525576_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	9.6e-43
WP_075275032.1|526319_527129_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	1.1e-15
WP_032126239.1|527179_527452_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|527463_528300_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_016211646.1|528669_528909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211642.1|528901_529255_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_129556455.1|529555_530158_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211641.1|530162_530618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211645.1|530640_531390_+	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	28.2	2.4e-09
WP_016211640.1|531421_532024_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126808.1|532186_532396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211639.1|532403_532706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211644.1|532820_533087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|533228_533957_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211235.1|534451_534889_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|535318_536707_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211238.1|537149_538643_+	amino acid permease	NA	NA	NA	NA	NA
WP_129556456.1|538844_539594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556457.1|539637_540576_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_016211244.1|540559_541255_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_036776715.1|541656_542385_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211663.1|542478_543144_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211661.1|543208_544165_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_032126810.1|544423_545122_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211662.1|545164_546277_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_075273327.1|546881_547457_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|547402_547768_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212580.1|547855_548206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|548941_550003_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	561040	592835	3113959	transposase,tRNA	Synechococcus_phage(33.33%)	35	NA	NA
WP_075275036.1|561040_562102_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211491.1|562362_562659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211493.1|562941_564405_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211489.1|564407_565460_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_016211494.1|565449_565905_+	arginine repressor	NA	NA	NA	NA	NA
WP_016211487.1|565929_566253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|566600_566912_-	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_032126201.1|567041_567788_+	lipoprotein	NA	NA	NA	NA	NA
WP_054300148.1|567809_568871_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|568981_569956_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126197.1|570096_571050_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016212075.1|571163_571361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126198.1|571606_571807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212072.1|571836_572034_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212074.1|572120_572342_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|572368_572734_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275038.1|572679_573270_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046713.1|573407_573572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126195.1|573866_575303_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016210532.1|575344_576796_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016210537.1|576907_577195_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|577384_578428_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210536.1|578443_579343_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210528.1|579339_579858_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210527.1|579927_580545_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016210531.1|580554_582042_+	ribonuclease G	NA	NA	NA	NA	NA
WP_016210534.1|582051_585732_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_016210535.1|585805_586618_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210530.1|586614_587295_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_081007010.1|588135_588756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|588805_589096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275039.1|589899_590394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007066.1|590388_590727_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962625.1|591106_591992_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556462.1|591989_592835_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.8	1.4e-24
>prophage 8
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	613156	666968	3113959	transposase,plate	Bacillus_thuringiensis_phage(12.5%)	60	NA	NA
WP_016209523.1|613156_614506_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209510.1|614556_614994_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209501.1|615255_616767_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_032126188.1|616772_617999_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|617992_619021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|618998_619691_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_016209516.1|619695_621165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556464.1|621154_621646_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_051307310.1|621651_623124_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032126187.1|623123_623522_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016209524.1|623518_625207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209506.1|625188_626145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|626187_626703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|626807_627740_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209534.1|627959_628346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209530.1|628362_629007_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209504.1|629187_630027_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_016209502.1|630102_630705_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209512.1|630705_631560_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209537.1|631916_632228_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209519.1|632252_633644_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|633799_634531_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_129556465.1|634527_635100_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|635086_635644_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_016209498.1|635649_636630_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209539.1|636769_637570_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_033923645.1|637573_638341_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209535.1|638337_638802_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_016209507.1|638824_639478_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209517.1|639481_639829_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209505.1|639862_640114_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|640188_641457_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209527.1|641459_642218_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209508.1|642279_643170_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|643220_643904_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_075273445.1|643989_644247_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_075275046.1|644519_646733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210408.1|646724_647597_-	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_016210409.1|647764_649594_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210411.1|649757_650399_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_075273448.1|650640_651171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|651188_651362_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_016210402.1|651420_652470_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210405.1|652476_653427_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210406.1|653480_654425_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210415.1|654452_655190_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|655278_655521_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|655595_656819_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210400.1|656850_657699_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210401.1|657695_658748_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_032126181.1|658868_659489_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_016210407.1|659504_660491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080743011.1|660601_661057_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556469.1|661016_661325_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|662118_663024_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075275050.1|663099_663795_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275052.1|663939_664449_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212599.1|664498_664708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|665942_666389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|666392_666968_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	692446	833680	3113959	protease,transposase,tRNA	Staphylococcus_phage(15.0%)	119	NA	NA
WP_129556470.1|692446_693333_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|693632_693878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126800.1|694426_695161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|695285_696347_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940948.1|696669_697374_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210599.1|697467_698181_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016210601.1|698263_699355_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210603.1|699426_700008_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210606.1|700013_700640_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210609.1|700736_701672_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_129556471.1|702031_702703_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210598.1|702844_703504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210607.1|703672_704932_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210611.1|704928_706014_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210605.1|706006_706888_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210612.1|706876_708127_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_075275125.1|709718_710762_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|712898_713264_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|713209_713785_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209387.1|713922_714807_-	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_016209373.1|714936_715758_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_016209389.1|715759_716797_-	asparaginase	NA	NA	NA	NA	NA
WP_016209367.1|716797_719455_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_016209375.1|719532_720342_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_032126579.1|720764_721532_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_016209372.1|721706_722585_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_016209399.1|722588_723326_+	UMP kinase	NA	NA	NA	NA	NA
WP_016209396.1|723329_723887_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_032126580.1|723903_724641_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.5	7.2e-22
WP_016209379.1|724648_725455_+	cytidylyltransferase	NA	NA	NA	NA	NA
WP_016209397.1|725542_726418_+	bacterial lipid A biosynthesis acyltransferase family protein	NA	NA	NA	NA	NA
WP_155097786.1|726538_728203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209400.1|728673_730635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209393.1|731179_731719_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_016209364.1|731715_732744_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_016209394.1|732733_733798_-	GHMP kinase	NA	NA	NA	NA	NA
WP_080664815.1|733785_735999_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_051307309.1|736000_737041_-	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_129556472.1|737379_739773_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_016209381.1|739853_740387_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_016209391.1|740438_741488_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_016209390.1|741514_741952_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_016209377.1|741951_742725_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_016209376.1|742743_743898_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_032126583.1|744110_744680_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	42.9	5.7e-27
WP_016209365.1|744703_748210_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.5	4.9e-193
WP_016209366.1|748287_749247_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_016209374.1|749221_750673_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209368.1|750708_752238_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_016209380.1|752813_753236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556473.1|753368_754457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126585.1|754998_755919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209384.1|756269_757085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209395.1|757376_760067_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_080664814.1|760315_761536_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|761703_763410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209398.1|764008_765235_+	MFS transporter	NA	NA	NA	NA	NA
WP_075274832.1|765799_766774_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_075273456.1|766896_767196_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|767155_767611_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212416.1|767612_768143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212417.1|768266_768512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|768562_768928_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|768873_769449_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052047106.1|769522_769999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|770714_771080_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|771025_771601_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300173.1|771627_772689_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556627.1|772741_773347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211819.1|773565_773796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|774092_774593_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211818.1|774795_776052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211822.1|776408_776822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|777131_778193_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275065.1|778492_779167_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.9e-10
WP_016212172.1|780057_781530_+	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_054300271.1|781549_782524_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210742.1|782674_782950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|783115_783736_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_016210737.1|784054_786031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210739.1|786186_787644_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210743.1|787712_789293_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_016210744.1|789333_789819_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210746.1|789915_793812_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210741.1|793818_794142_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_054300173.1|794827_795889_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210303.1|795938_796178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307327.1|796453_797485_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.7e-35
WP_016210294.1|797802_798147_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_075273633.1|798284_798911_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_016210301.1|798960_799788_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_032126460.1|799964_800402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126457.1|801309_801729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210293.1|802773_804054_+	outer membrane beta-barrel domain protein	NA	NA	NA	NA	NA
WP_016210287.1|804174_805038_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_016210290.1|805126_805921_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_129556475.1|806143_807166_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_032126458.1|807171_808698_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_032126463.1|808778_810035_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210297.1|810091_811471_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_129556628.1|811556_812372_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.5e-32
WP_033923708.1|812576_813452_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211687.1|813707_814352_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211685.1|814382_816188_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|816211_816787_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556476.1|817331_818342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|818437_819412_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016209640.1|819830_820850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209649.1|821308_822274_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209646.1|822318_822894_-	VOC family protein	NA	NA	NA	NA	NA
WP_016209651.1|822924_824199_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126159.1|824825_825539_+	aldolase	NA	NA	NA	NA	NA
WP_016209641.1|825618_826356_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016209658.1|826476_827832_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_075273478.1|828008_828680_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209661.1|828795_829671_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_016209645.1|830274_831579_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|831691_832297_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|832378_833680_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
>prophage 10
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	852472	894242	3113959	integrase,transposase	Staphylococcus_phage(20.0%)	42	854741:854800	882923:884026
WP_075275067.1|852472_853540_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273512.1|854295_854640_-	hypothetical protein	NA	NA	NA	NA	NA
854741:854800	attL	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAA	NA	NA	NA	NA
WP_054300271.1|854776_855751_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126362.1|855922_856288_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051307360.1|857127_858057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211512.1|859148_859955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|860297_862190_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_032126157.1|862476_862881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923634.1|863085_863634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|863623_864510_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212436.1|864848_865259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556479.1|865472_865655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274918.1|866142_866508_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|866453_867029_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080664862.1|868202_868901_+	P-loop NTPase	NA	NA	NA	NA	NA
WP_016211528.1|868881_869187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211532.1|869833_870784_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	35.8	1.8e-09
WP_016211534.1|870770_871280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211530.1|871285_872182_-	Abi family protein	NA	A3QSC6	Clostridium_virus	32.0	5.3e-35
WP_016211531.1|872535_873216_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_032126152.1|873279_873870_-|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016212424.1|874072_874351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|874343_874616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|874760_875843_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211300.1|875893_876934_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_129556480.1|877445_882935_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|882958_883933_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212302.1|884246_884546_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
882923:884026	attR	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCTGCTCTCTATCATCATAAATATAACGGTAAATCGTGCTTTCACTCACCTGGATATCATGCTCTCGTATAAGTTCCTGACTGATAACATCGGGGGATGTATGGGTGCTTAACCGTTGATGGATCAACATTTTTGCCTCCTCTGAAATTTGTCGAAAAGCTTGACCTTGCTTAGCGTTAGCTCGTTTTTCTTGTGCACAGCGAGAAGTAAGCCGGTGACAATAAAGACCTTTAAAATCGATTGGGGTGTGCCGTTTAATCTCACGGCTAATCGTGCTAGGAGAAAAGCCAAGTGCTCTAGCAATTGATCTGAGCGAGTCTCCCTCTGATAACCGTTGTTCGATATAAAAACGATCTTTTTCATTTAAGTGCCGATAAACCATCTCTACCCTCTAAGTCAAAAGGCGAACTAGAGAGTTTATCTGTATGAATATGAACTCTCTACTGAGTGTTGCACTTCAGATGACGGAGGGCGT	NA	NA	NA	NA
WP_129556481.1|884730_885162_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_054300162.1|885419_886502_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211579.1|886725_887211_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211583.1|887278_888187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211581.1|888463_889234_+	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.9	8.9e-31
WP_016211585.1|889352_889910_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016211582.1|889971_890751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|890848_891202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|891268_891463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211578.1|891478_891823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|892180_892756_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|892701_893067_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275068.1|893151_893742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047108.1|893843_894242_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	910080	1009636	3113959	transposase,tRNA	unidentified_phage(25.0%)	99	NA	NA
WP_075273371.1|910080_910656_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212461.1|910659_911034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275071.1|911409_912384_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_054300264.1|912486_912825_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_054300265.1|912969_913230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556469.1|913189_913498_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556484.1|913999_915460_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_016211426.1|915803_917246_+	MFS transporter	NA	NA	NA	NA	NA
WP_075273490.1|918228_919521_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_054300148.1|919761_920823_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556485.1|920975_923534_+	HAD-IC family P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	30.6	6.3e-73
WP_032126554.1|923553_924639_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_016210417.1|925080_925518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210423.1|925514_926399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210416.1|926488_927019_+	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_016210420.1|927089_928268_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.1	2.0e-50
WP_016210425.1|928416_932265_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_016210422.1|932251_933754_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_016210418.1|934304_934940_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_081377899.1|935252_936116_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211781.1|936530_937778_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_129556630.1|938087_939437_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_129556486.1|939522_939870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273492.1|939960_940080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275075.1|940188_941250_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007012.1|941244_941415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|941404_941569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274902.1|941633_941990_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300269.1|942011_942380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210898.1|943291_943642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|943730_944021_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210894.1|944495_944798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210897.1|945138_946119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556487.1|946197_947535_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210903.1|947653_948025_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_016210904.1|948245_948896_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210896.1|948938_950021_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210899.1|950074_951958_+	APC family permease	NA	NA	NA	NA	NA
WP_032126790.1|952457_953363_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075275077.1|953447_954284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212218.1|954428_954779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|956229_957291_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|957416_958499_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_032126801.1|959169_959679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275079.1|959726_960788_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556488.1|960936_961786_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126540.1|962935_963799_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|964679_965045_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|964990_965566_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|965796_966162_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|966107_966683_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126869.1|967203_967443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|967420_968482_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556489.1|968727_969924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|969927_970814_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212326.1|971039_971237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122941816.1|971323_971632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212323.1|971708_971981_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_075274676.1|972055_972253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046717.1|972411_972561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|974817_976854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664853.1|977577_979320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211090.1|979279_980914_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_080664852.1|980926_981970_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|981948_982410_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_016211081.1|982450_983386_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211087.1|983413_984409_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_016211088.1|984628_985591_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126778.1|985769_985964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075285940.1|986178_987000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377357.1|987084_987486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212611.1|987969_988290_+	histidine kinase	NA	NA	NA	NA	NA
WP_075275084.1|988337_989399_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212519.1|989473_989854_+	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_052047081.1|990124_990562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212356.1|990612_991458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275086.1|991435_992434_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|992394_992760_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|992705_993281_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155097787.1|993650_994625_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.2e-27
WP_016212585.1|994736_995057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212621.1|995351_995756_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_075273327.1|995752_996328_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|996273_996639_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126498.1|996700_997261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211126.1|997393_997783_-	lipoprotein	NA	NA	NA	NA	NA
WP_016211125.1|997952_998783_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211128.1|999005_999911_-	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211119.1|1000074_1000836_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_016211122.1|1000839_1001706_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032126499.1|1001802_1002414_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211118.1|1002792_1004040_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126500.1|1004176_1004893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275089.1|1005026_1005359_-	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	37.3	8.0e-05
WP_129556631.1|1005503_1005671_-	phosphatase	NA	NA	NA	NA	NA
WP_075275091.1|1006679_1007165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273307.1|1007435_1007846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300412.1|1007990_1008305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210280.1|1008541_1009636_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	1025763	1132798	3113959	transposase,tRNA	Bacillus_phage(16.67%)	94	NA	NA
WP_075273327.1|1025763_1026339_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080664860.1|1026302_1026740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211367.1|1026895_1027678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126330.1|1027825_1028785_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_032126331.1|1028839_1030849_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_016211366.1|1030904_1031192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126332.1|1031444_1032644_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_075273327.1|1033290_1033866_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1033811_1034177_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|1034310_1035174_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|1035404_1035698_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556495.1|1036678_1036936_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211589.1|1037058_1038291_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_016211592.1|1038280_1038943_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_129556496.1|1039217_1040456_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_032126329.1|1040641_1041271_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211588.1|1041346_1042048_+	cyclase family protein	NA	NA	NA	NA	NA
WP_105962623.1|1042215_1043368_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212343.1|1043607_1044414_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_016209806.1|1045226_1045376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209808.1|1045718_1046087_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_016209824.1|1046083_1046902_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_016209813.1|1047002_1047818_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_016209801.1|1048102_1050157_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_032126324.1|1050156_1050579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209805.1|1050757_1052251_-	neurotransmitter symporter family protein	NA	NA	NA	NA	NA
WP_016209818.1|1052383_1053199_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_016209799.1|1053294_1053711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209815.1|1054096_1054636_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_032126326.1|1055403_1056666_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	3.1e-25
WP_016209812.1|1057118_1058942_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	9.7e-44
WP_016209821.1|1059031_1059364_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016209800.1|1059394_1059991_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_016209802.1|1059987_1061112_+	D-isomer specific 2-hydroxyacid dehydrogenase catalytic domain protein	NA	NA	NA	NA	NA
WP_016209822.1|1061247_1061895_+	methyltransferase domain protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_016209810.1|1061956_1063870_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	6.9e-117
WP_016209803.1|1064074_1065112_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209820.1|1065170_1068470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209817.1|1069171_1070140_-	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_016209809.1|1070246_1070735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209823.1|1071159_1071603_+	response regulator	NA	NA	NA	NA	NA
WP_075275095.1|1071647_1072424_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075275097.1|1072825_1073401_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1073346_1073712_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300408.1|1073762_1074419_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_080664854.1|1074755_1075337_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_032126179.1|1075294_1075546_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_016211113.1|1075575_1076901_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_016211112.1|1076956_1077604_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211115.1|1077796_1079749_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211114.1|1079881_1082812_+	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_075274672.1|1083177_1083771_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1083942_1084308_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1084253_1084829_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1084842_1085133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1085078_1085654_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212254.1|1085643_1087086_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016212252.1|1087123_1087282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212466.1|1087596_1088322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372269.1|1088526_1088898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211395.1|1089254_1089590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779999.1|1089505_1089937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211393.1|1089956_1091513_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_016211391.1|1091524_1092100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728317.1|1092166_1095532_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275098.1|1095722_1096652_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.1e-24
WP_129556498.1|1097164_1097773_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210596.1|1097769_1099710_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	3.1e-72
WP_016210594.1|1099845_1100499_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_016210595.1|1100675_1101854_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210588.1|1102221_1103547_+	fimV domain protein	NA	NA	NA	NA	NA
WP_032126176.1|1103637_1104420_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210587.1|1104521_1105382_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_016210590.1|1105556_1106819_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210593.1|1106898_1107429_+	colicin V production protein	NA	NA	NA	NA	NA
WP_016210586.1|1107450_1108956_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210592.1|1108968_1109625_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016212005.1|1110014_1111775_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_155049815.1|1112340_1112493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1112675_1113828_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_032126856.1|1114133_1114475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377901.1|1114535_1115246_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275102.1|1115426_1115885_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211525.1|1116473_1119209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|1121508_1122324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046719.1|1124542_1124701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1124719_1124992_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377862.1|1125003_1125840_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126803.1|1126326_1127559_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_016211764.1|1127759_1128581_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211767.1|1129131_1129941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211289.1|1131269_1131542_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211286.1|1131653_1132001_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_016211285.1|1132018_1132798_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 13
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	1169870	1222550	3113959	protease,transposase,tRNA	Klosneuvirus(28.57%)	48	NA	NA
WP_016209838.1|1169870_1170764_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209836.1|1170763_1171978_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_032126639.1|1171997_1173284_-	GTPase HflX	NA	NA	NA	NA	NA
WP_016209846.1|1173299_1173554_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016209830.1|1173789_1175157_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209826.1|1175487_1176510_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_016209845.1|1177032_1178508_+	APC family permease	NA	NA	NA	NA	NA
WP_129556633.1|1178724_1179621_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209827.1|1179939_1181499_+	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_016209841.1|1181574_1181769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209831.1|1181988_1182687_+	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209832.1|1182965_1183229_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209848.1|1183535_1186130_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209835.1|1186126_1186609_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209844.1|1186586_1187627_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209840.1|1187799_1188285_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_032126641.1|1188392_1190963_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_075278621.1|1190998_1191340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126643.1|1191528_1191735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211648.1|1192938_1193478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211650.1|1194137_1195622_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211651.1|1195746_1197282_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032126362.1|1197515_1197881_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556501.1|1197826_1198402_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_059372539.1|1198434_1199298_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080728346.1|1199315_1199648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046723.1|1200555_1200711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210928.1|1200869_1201175_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_016210929.1|1201209_1201566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046724.1|1201562_1201730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210921.1|1201954_1202539_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_016210925.1|1202630_1203317_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.5	9.7e-29
WP_032126561.1|1203440_1204625_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210917.1|1204838_1206281_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.5	5.4e-21
WP_016210927.1|1206405_1207356_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210930.1|1207416_1208190_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210918.1|1208193_1208943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210926.1|1209027_1210497_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_129556502.1|1210756_1211320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273571.1|1211428_1212106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211012.1|1212255_1212828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211008.1|1212936_1214439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211010.1|1214531_1216961_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_016211011.1|1217239_1218436_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_016211013.1|1218496_1220863_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_032126565.1|1221180_1221453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1221663_1222029_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1221974_1222550_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	1227086	1283946	3113959	transposase,tRNA	Acinetobacter_phage(12.5%)	57	NA	NA
WP_081007040.1|1227086_1227743_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016210510.1|1227773_1228502_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_016210506.1|1228494_1229733_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210512.1|1229868_1230906_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210515.1|1230959_1231862_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210514.1|1231970_1233224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|1233281_1236779_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_075273576.1|1236838_1237567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210507.1|1237694_1238243_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016210508.1|1238563_1240261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556503.1|1240269_1241136_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	5.6e-58
WP_032126637.1|1242197_1242491_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_032127044.1|1243392_1243593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1243796_1244858_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047029.1|1244930_1245272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|1245439_1245805_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273298.1|1245750_1246326_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211467.1|1246400_1246967_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_032126344.1|1246969_1248058_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032126343.1|1248178_1248991_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_016211471.1|1249121_1251107_+	sodium/hydrogen exchanger family protein	NA	NA	NA	NA	NA
WP_016211470.1|1251166_1251820_-	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_129556505.1|1252586_1253552_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1253592_1254567_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212421.1|1255317_1255500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1255991_1256357_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1256302_1256878_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556507.1|1256867_1257554_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	48.3	5.5e-48
WP_032126637.1|1257670_1257964_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556508.1|1258025_1258469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300380.1|1258739_1259396_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1259497_1259863_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1259808_1260384_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212483.1|1260380_1261178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1261188_1262271_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300173.1|1262573_1263635_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211841.1|1264494_1264947_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211839.1|1265064_1266537_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211840.1|1266695_1267160_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211838.1|1267630_1267804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274832.1|1268115_1269090_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_032126143.1|1269189_1270461_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_016211422.1|1270549_1271020_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_051307357.1|1271042_1271636_-	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211417.1|1271772_1272822_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_016211415.1|1272845_1273769_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1273785_1274247_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211414.1|1274354_1275173_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_129556449.1|1275387_1275894_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1275908_1276274_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081377858.1|1276477_1277188_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300382.1|1277406_1277829_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046725.1|1278045_1278186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1278229_1279204_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075274829.1|1279227_1279500_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1279511_1280348_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126139.1|1283016_1283946_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	1290702	1467689	3113959	integrase,protease,transposase,tRNA	Leptospira_phage(18.52%)	174	1398151:1398210	1411856:1412144
WP_054300162.1|1290702_1291785_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212040.1|1291988_1293338_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_016212039.1|1293514_1294072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133287.1|1294260_1294659_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075274828.1|1294760_1296083_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	1.2e-11
WP_054300384.1|1296491_1297307_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212251.1|1297468_1298005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212250.1|1298166_1298817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126600.1|1298939_1299461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126789.1|1299732_1299915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1300264_1301542_-	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_080664858.1|1301538_1301676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211223.1|1302187_1303789_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211221.1|1303805_1304948_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211218.1|1305200_1305938_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211224.1|1305962_1307234_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_075274826.1|1307490_1308396_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211680.1|1308626_1311026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211682.1|1311073_1312756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209976.1|1313625_1313859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126209.1|1314059_1314680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209969.1|1314646_1315612_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_016209951.1|1315602_1316013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209957.1|1316019_1316355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556634.1|1316355_1316898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209950.1|1317202_1317994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209973.1|1318030_1321135_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_016209965.1|1321164_1321962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209956.1|1321966_1324957_-	ATPase AAA	NA	NA	NA	NA	NA
WP_016209975.1|1324962_1325394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209972.1|1325444_1326011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126210.1|1326010_1327054_-	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_016209954.1|1327059_1327584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209953.1|1327605_1329912_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_016209962.1|1329963_1330203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209958.1|1330204_1331332_-	type II/IV secretion system family protein	NA	NA	NA	NA	NA
WP_016209964.1|1331331_1332084_-	dotC-like type IV secretion system protein	NA	NA	NA	NA	NA
WP_051307320.1|1332076_1332583_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_016209959.1|1332607_1333015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556635.1|1333042_1334050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209971.1|1334108_1335014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209955.1|1335020_1336214_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_032126212.1|1336210_1337119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209960.1|1337736_1337889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211310.1|1338365_1339079_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SEW9	Cyanophage	39.1	2.2e-39
WP_016211308.1|1339154_1339433_-	lipoprotein	NA	NA	NA	NA	NA
WP_032126213.1|1339462_1340353_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_016211307.1|1340437_1340911_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_016211313.1|1341046_1341568_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_016211309.1|1341608_1342403_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_016211305.1|1342405_1342687_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211306.1|1342683_1343637_-	pentapeptide repeats family protein	NA	NA	NA	NA	NA
WP_016211312.1|1344342_1345089_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075274825.1|1345210_1346272_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126239.1|1346549_1346822_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1346833_1347670_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_016211999.1|1348049_1348403_+	ras family protein	NA	NA	NA	NA	NA
WP_016211998.1|1348392_1348956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212000.1|1349086_1349815_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016212002.1|1349934_1350213_+	DNA-J related family protein	NA	NA	NA	NA	NA
WP_129556636.1|1351166_1351475_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016210889.1|1351492_1354339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210887.1|1354848_1355799_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210886.1|1355881_1356661_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_016210883.1|1356729_1357437_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210888.1|1357397_1357649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|1357671_1357968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|1359306_1359903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210885.1|1359960_1360842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300399.1|1361183_1361450_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300400.1|1361594_1361837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|1361893_1362421_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107517381.1|1363086_1363281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1363494_1363848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211827.1|1364179_1364800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211823.1|1364840_1365029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274823.1|1365063_1369074_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211770.1|1369273_1370407_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_016211771.1|1370420_1370609_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_075274822.1|1370901_1371876_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016209929.1|1373334_1374228_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209948.1|1374336_1375254_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_016209943.1|1375305_1376061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209939.1|1376128_1377403_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209927.1|1377537_1378215_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209944.1|1378415_1379843_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209938.1|1379817_1380456_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209925.1|1380665_1380944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209935.1|1381177_1382122_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_032126634.1|1382143_1384012_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209930.1|1384032_1384386_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_016209936.1|1384424_1385540_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.6	1.4e-93
WP_016209932.1|1385722_1386763_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209945.1|1386765_1387800_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209926.1|1387796_1388858_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209931.1|1388969_1390442_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_016209937.1|1390594_1391038_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209940.1|1391113_1393885_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_016209946.1|1394041_1395271_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1395297_1395960_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_054300405.1|1396481_1396982_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_129556510.1|1397083_1398187_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	7.3e-10
1398151:1398210	attL	GCGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGC	NA	NA	NA	NA
WP_033923779.1|1398710_1399547_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1399558_1399831_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1399915_1400890_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210841.1|1401103_1401475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210839.1|1401533_1402307_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_129556514.1|1402458_1404915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126340.1|1405194_1405956_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556513.1|1406036_1407782_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016210844.1|1407957_1409085_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.2	5.7e-10
WP_016210843.1|1409171_1409402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556637.1|1410016_1410796_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016212589.1|1411270_1411708_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300363.1|1412131_1412479_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
1411856:1412144	attR	GCGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_129556512.1|1412424_1413000_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212275.1|1412989_1413973_-	MFS transporter	NA	NA	NA	NA	NA
WP_051307372.1|1414088_1414478_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036774189.1|1414525_1415533_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1415532_1415790_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664859.1|1415958_1416546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211335.1|1416655_1416973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126267.1|1416966_1417209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211330.1|1417556_1418657_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_098082827.1|1418831_1420133_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.9	4.1e-28
WP_016211328.1|1420240_1420702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126265.1|1421025_1421943_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016211336.1|1422008_1422623_-	chorismate mutase	NA	NA	NA	NA	NA
WP_016211334.1|1422671_1422860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210322.1|1423477_1424374_+	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016210320.1|1424510_1425584_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_032126606.1|1425733_1426255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210323.1|1426166_1426877_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.7	6.3e-39
WP_129556511.1|1427059_1428496_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210321.1|1428692_1429661_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_016210329.1|1429709_1430228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210327.1|1430288_1431620_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210325.1|1431755_1433132_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210326.1|1433285_1434584_-	ankyrin repeats family protein	NA	NA	NA	NA	NA
WP_032126607.1|1434923_1436207_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_016210333.1|1436280_1436910_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_016210330.1|1437113_1437497_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210332.1|1437594_1438338_+	ribonuclease T2 family protein	NA	NA	NA	NA	NA
WP_075273555.1|1438468_1439002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212498.1|1439279_1439963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126599.1|1440602_1441946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211804.1|1442640_1444026_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
WP_016211805.1|1444032_1445571_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211806.1|1445613_1446339_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_032126239.1|1447128_1447401_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1447412_1448249_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_081377864.1|1448262_1448502_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211148.1|1448583_1449912_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|1450175_1450745_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211151.1|1450760_1451072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1451081_1452038_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1452150_1452504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211153.1|1452507_1453572_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211145.1|1453572_1455312_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211152.1|1455318_1455741_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211144.1|1455724_1456354_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075273474.1|1456910_1457885_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_075274844.1|1458065_1458317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1458325_1459162_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1459173_1459446_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556515.1|1459464_1459824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046727.1|1460649_1460994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1461237_1462212_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075275108.1|1462188_1462794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556516.1|1463152_1463656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1463750_1464023_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1464034_1464871_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_080664876.1|1465183_1467046_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_081377865.1|1467404_1467689_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	1471519	1531065	3113959	transposase,tRNA	Staphylococcus_phage(18.75%)	52	NA	NA
WP_075274847.1|1471519_1472395_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212011.1|1472628_1473750_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_016212013.1|1473971_1474355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212012.1|1474370_1475048_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_054300271.1|1475284_1476259_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300271.1|1476906_1477881_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556517.1|1478278_1478566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1478584_1479421_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1479432_1479705_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274849.1|1479830_1480574_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212348.1|1480568_1481798_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_016211994.1|1483216_1483753_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_032126537.1|1483789_1483975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211991.1|1484215_1485121_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126538.1|1486029_1487448_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_081007034.1|1487712_1487997_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_080728343.1|1487978_1488119_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_016211561.1|1488200_1492067_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_016211564.1|1492232_1493108_+	ParA family protein	NA	NA	NA	NA	NA
WP_016211563.1|1493140_1493302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274852.1|1493512_1493956_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046728.1|1494084_1495059_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	6.8e-28
WP_052047138.1|1495321_1495555_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126690.1|1501602_1502085_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_016210112.1|1502778_1504206_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.0	2.5e-55
WP_122943012.1|1504322_1504778_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_016210108.1|1504963_1506229_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	9.1e-49
WP_016210114.1|1506321_1507581_+	calcineurin-like phosphoesterase	NA	NA	NA	NA	NA
WP_016210107.1|1507652_1507925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210101.1|1508214_1509711_-	flagellin domain protein	NA	NA	NA	NA	NA
WP_016210113.1|1510133_1511183_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.5	7.9e-30
WP_016210110.1|1511370_1512126_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	5.4e-65
WP_016210102.1|1512186_1513776_-	APC family permease	NA	NA	NA	NA	NA
WP_016210106.1|1513958_1515050_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_016210105.1|1515069_1515390_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210099.1|1515473_1516751_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_017377579.1|1516772_1517609_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210111.1|1517615_1519250_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_016210117.1|1519670_1520030_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210103.1|1520311_1521670_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_081377868.1|1521745_1522402_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211627.1|1522707_1522872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211632.1|1523097_1523952_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016211634.1|1523987_1524809_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211631.1|1525064_1525871_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_155046729.1|1526129_1527176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|1527393_1527687_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_075273327.1|1527762_1528338_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1528283_1528649_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556520.1|1528609_1529506_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	1.8e-54
WP_129556521.1|1529456_1529645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|1530178_1531065_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	1541330	1663992	3113959	transposase,tRNA	Staphylococcus_phage(22.73%)	115	NA	NA
WP_075273804.1|1541330_1541669_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1541628_1542084_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212267.1|1542250_1542610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1542890_1543538_+	LysE family translocator	NA	NA	NA	NA	NA
WP_155046730.1|1543805_1543946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274856.1|1544164_1545190_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211733.1|1546945_1547770_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_016211731.1|1547825_1548932_-	protein kinase	NA	NA	NA	NA	NA
WP_016211734.1|1548947_1549217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|1549638_1550337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211398.1|1550941_1551229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211399.1|1551375_1552119_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016211403.1|1552132_1553176_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_016211405.1|1553311_1555084_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_129556522.1|1555290_1556523_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211669.1|1559631_1559982_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211666.1|1560136_1562956_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211664.1|1563328_1564057_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211555.1|1564593_1565952_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_032126677.1|1566026_1566590_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211557.1|1566784_1568014_-	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_016211554.1|1568059_1568686_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_032126678.1|1569012_1570023_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_075274857.1|1570033_1570909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274858.1|1572488_1573574_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1573710_1574076_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1574021_1574597_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1575287_1576262_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1576816_1577878_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274822.1|1577975_1578950_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_129556523.1|1579285_1580171_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209772.1|1581190_1581742_-	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_016209778.1|1581760_1582135_-	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_016209796.1|1582165_1583383_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.0	2.9e-92
WP_080664823.1|1583406_1584807_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_016209795.1|1584787_1585543_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	1.3e-10
WP_016209793.1|1585583_1587032_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_032126436.1|1587047_1587503_-	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_016209771.1|1588209_1588932_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016209791.1|1589096_1589819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307317.1|1589955_1590249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209798.1|1590310_1592335_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_016209769.1|1592347_1593091_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_017377132.1|1593132_1593516_-	response regulator	NA	NA	NA	NA	NA
WP_016209784.1|1593602_1594325_-	RNA polymerase sigma factor FliA	NA	A0A1B1P7V3	Bacillus_phage	24.1	2.7e-05
WP_129556524.1|1594321_1595209_-	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_016209767.1|1595189_1596650_-	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_016209770.1|1596680_1598774_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_016209786.1|1598808_1599942_-	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_016209787.1|1599955_1600741_-	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_016209776.1|1600756_1601026_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_080664822.1|1601055_1601805_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_016209797.1|1601801_1602293_-	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_129556639.1|1602760_1603171_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209790.1|1603466_1603925_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209788.1|1603976_1604729_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016209785.1|1604850_1606794_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A1U9WQS3	Geobacillus_phage	23.9	1.1e-05
WP_016209794.1|1606839_1607463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377870.1|1608197_1608716_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	31.0	1.6e-07
WP_081007030.1|1608751_1609723_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051307341.1|1610416_1612015_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_016210848.1|1612181_1613366_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1613661_1614216_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210850.1|1614464_1615718_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210851.1|1615702_1616374_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210847.1|1616396_1617401_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210849.1|1617429_1618878_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210855.1|1618995_1619973_+	DMT family transporter	NA	NA	NA	NA	NA
WP_129556525.1|1620126_1620946_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1621022_1621997_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212475.1|1622194_1622401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211182.1|1623385_1623715_-	DUF4404 family protein	NA	NA	NA	NA	NA
WP_032126448.1|1623746_1624127_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_016211178.1|1624217_1625246_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016211180.1|1625308_1625773_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_032126449.1|1625793_1626717_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016211185.1|1626783_1627392_+	smr domain protein	NA	NA	NA	NA	NA
WP_032126450.1|1627504_1629499_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211177.1|1629866_1631087_+	amino acid permease	NA	NA	NA	NA	NA
WP_016212445.1|1631301_1631568_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_129556526.1|1631564_1632350_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.8	1.3e-45
WP_075274822.1|1632408_1633383_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016211736.1|1633406_1633607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211739.1|1633723_1634230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126783.1|1634340_1635582_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211741.1|1635727_1636504_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211738.1|1636980_1637625_-	membrane protein	NA	NA	NA	NA	NA
WP_032126790.1|1637695_1638601_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1639562_1639901_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1639860_1640316_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126602.1|1640468_1641776_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211857.1|1642026_1642905_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_016211855.1|1642901_1643369_-	bacterioferritin	NA	NA	NA	NA	NA
WP_016211856.1|1643495_1643681_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_054300271.1|1643896_1644871_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556640.1|1645137_1646364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211351.1|1646439_1646778_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_032127067.1|1646774_1647377_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211349.1|1647373_1649368_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211350.1|1649431_1650370_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211352.1|1651048_1651489_+	universal stress protein	NA	NA	NA	NA	NA
WP_075273313.1|1651662_1652001_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1651960_1652416_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210793.1|1652417_1653098_+	OmpW family protein	NA	NA	NA	NA	NA
WP_016210801.1|1653420_1654392_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210795.1|1654373_1655345_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_051307339.1|1655450_1656257_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210791.1|1656631_1656832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210799.1|1657258_1658212_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_129556527.1|1658673_1658934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273540.1|1659118_1659730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210800.1|1660096_1660924_+	DsbA family protein	NA	NA	NA	NA	NA
WP_051307338.1|1661135_1662701_+	APC family permease	NA	NA	NA	NA	NA
WP_052047040.1|1662726_1663665_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1663734_1663992_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	1670160	1725426	3113959	transposase,tRNA	Pseudomonas_phage(25.0%)	46	NA	NA
WP_075273327.1|1670160_1670736_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212185.1|1670829_1671819_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1672152_1672338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1673017_1674973_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016210749.1|1675271_1675733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210752.1|1675902_1676700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556641.1|1679076_1680339_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_032126362.1|1684213_1684579_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1684524_1685100_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211454.1|1685240_1685711_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_016211452.1|1686461_1687949_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211455.1|1688010_1689468_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_122942091.1|1689573_1689969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211456.1|1689996_1690575_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_054300325.1|1691196_1691469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046732.1|1691662_1691833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274862.1|1691947_1692544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211726.1|1692715_1693309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211728.1|1693696_1695631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211725.1|1695669_1696584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|1698154_1698421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007023.1|1698497_1699154_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1699328_1699784_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1699743_1700082_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556531.1|1700044_1700242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211752.1|1700446_1701592_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211748.1|1701607_1703212_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211749.1|1703291_1704485_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_032126540.1|1704693_1705557_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212346.1|1705790_1705937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274864.1|1708777_1709803_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047087.1|1709974_1710193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211462.1|1710353_1711334_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211465.1|1711961_1712945_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_016211464.1|1713095_1713443_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_032126752.1|1713439_1714042_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211466.1|1714129_1715650_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126753.1|1715719_1716184_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_032126362.1|1716276_1716642_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1716587_1717163_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212485.1|1717923_1718457_+	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_129556532.1|1718753_1718936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664820.1|1719244_1719415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209620.1|1719397_1722454_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209619.1|1722540_1723989_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209621.1|1724421_1725426_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 19
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	1755048	1804496	3113959	integrase,transposase	Acinetobacter_phage(16.67%)	51	1753992:1754051	1783764:1784054
1753992:1754051	attL	AAACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGA	NA	NA	NA	NA
WP_081377829.1|1755048_1755783_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_129556535.1|1756227_1757113_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1757303_1757561_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377871.1|1757765_1758458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556536.1|1758460_1759614_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075274872.1|1759573_1760113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274873.1|1760587_1761085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1761106_1761472_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1761417_1761993_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274874.1|1761993_1762362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126786.1|1762660_1765741_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016211319.1|1765758_1766811_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211316.1|1767343_1767994_+	porin family protein	NA	NA	NA	NA	NA
WP_016211315.1|1768328_1768973_+	porin family protein	NA	NA	NA	NA	NA
WP_054300314.1|1769160_1769496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273532.1|1769456_1770044_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126997.1|1770261_1770501_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_032126998.1|1770822_1771170_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_036774554.1|1771268_1771547_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1771599_1771887_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|1771890_1772777_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211346.1|1773926_1774568_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_016211340.1|1774595_1774817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211347.1|1774809_1775793_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211344.1|1776006_1776825_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211342.1|1776985_1778668_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.1e-32
WP_016211343.1|1778675_1779698_-	YHYH protein	NA	NA	NA	NA	NA
WP_016211341.1|1779896_1780067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1780211_1781186_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016211940.1|1781299_1781632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|1781752_1783012_-	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211214.1|1784774_1785338_+	hypothetical protein	NA	NA	NA	NA	NA
1783764:1784054	attR	AAACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_016211210.1|1785440_1786922_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016211213.1|1786928_1787135_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211211.1|1787183_1788263_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211215.1|1788454_1790425_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211212.1|1790785_1792345_+	APC family permease	NA	NA	NA	NA	NA
WP_075274875.1|1792627_1792930_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300307.1|1792976_1793705_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_129556539.1|1793773_1794118_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211983.1|1794365_1795025_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556643.1|1795120_1796485_+	histidine kinase	NA	NA	NA	NA	NA
WP_016212551.1|1796942_1797437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|1797778_1798354_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1798299_1798590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1798603_1799179_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1799124_1799490_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211946.1|1800710_1801466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556540.1|1801684_1802080_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211947.1|1802072_1803218_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_075274878.1|1803620_1804496_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	1847185	1863552	3113959	transposase	Leptospira_phage(40.0%)	15	NA	NA
WP_032126239.1|1847185_1847458_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377873.1|1847469_1848306_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.9	4.6e-41
WP_016212058.1|1848948_1850499_-	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_075274880.1|1850654_1851620_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126239.1|1852615_1852888_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1852899_1853736_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_098082828.1|1854233_1854491_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774189.1|1854490_1855498_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212247.1|1855864_1856620_+	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|1857247_1858222_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300162.1|1858561_1859644_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212246.1|1859747_1860404_-	AT hook motif family protein	NA	NA	NA	NA	NA
WP_075274882.1|1861339_1861936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556544.1|1862050_1862407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1862469_1863552_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
>prophage 21
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	1908347	1923157	3113959	integrase,transposase	Acinetobacter_phage(50.0%)	22	1913403:1913462	1917105:1917343
WP_075274886.1|1908347_1909409_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274888.1|1909680_1910016_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081007004.1|1910020_1910476_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1910435_1910774_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046696.1|1910931_1911096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1911085_1911385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212209.1|1911840_1912842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556545.1|1913096_1913438_-	hypothetical protein	NA	NA	NA	NA	NA
1913403:1913462	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_075274890.1|1913642_1914323_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_098082828.1|1914392_1914650_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377874.1|1914818_1915286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556546.1|1915746_1916932_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	5.9e-58
WP_155046738.1|1916941_1917082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556547.1|1917358_1917919_-	reverse transcriptase	NA	NA	NA	NA	NA
1917105:1917343	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTACGTGCCTTGAATCGGCACACTCCACTACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGCCTTTCGCAACTCCGCTCTGCTAAAAACCCGAA	NA	NA	NA	NA
WP_054300287.1|1918327_1918657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1918678_1919044_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1918989_1919565_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274733.1|1919583_1919901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1919951_1920788_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1920799_1921072_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211421.1|1921930_1922155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|1922251_1923157_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	1985405	2158129	3113959	protease,transposase,tRNA	Staphylococcus_phage(14.81%)	166	NA	NA
WP_016209434.1|1985405_1986827_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_129556553.1|1986916_1988509_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_016209439.1|1988672_1989299_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_129556647.1|1989379_1992010_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_016209445.1|1992543_1993500_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_016209435.1|1993600_1993972_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.1e-05
WP_016209404.1|1993998_1994862_+	chemotaxis phosphatase CheX family protein	NA	NA	NA	NA	NA
WP_016209416.1|1994851_1995637_-	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_016209413.1|1995925_1996411_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_016209443.1|1996485_1997007_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016209405.1|1997052_1997946_-	cheW-like domain protein	NA	NA	NA	NA	NA
WP_016209406.1|1997942_1998764_-	ParA family protein	NA	Q8JL10	Natrialba_phage	32.2	5.0e-16
WP_016209408.1|1999078_1999249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209427.1|1999402_2000806_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_052047073.1|2000899_2002150_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080664816.1|2002136_2002868_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_016209424.1|2002879_2004157_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
WP_016209433.1|2004256_2004631_-	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209436.1|2005659_2006388_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_129556555.1|2006384_2007515_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209444.1|2007645_2008074_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_032126508.1|2008168_2008528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209447.1|2008517_2009729_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016209421.1|2009725_2010514_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_016209411.1|2010676_2011471_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_054300271.1|2011676_2012651_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046761.1|2013077_2013251_+	phosphatase	NA	NA	NA	NA	NA
WP_075274901.1|2013395_2014409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2014412_2014712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2014701_2014866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2014922_2015288_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211553.1|2015627_2016368_-	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_016211549.1|2016371_2018876_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211548.1|2019138_2020095_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211550.1|2020078_2020840_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_075274903.1|2020917_2021793_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2021917_2022163_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_016211262.1|2022222_2024496_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_075273504.1|2024550_2024904_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211261.1|2025093_2025387_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_032126515.1|2025559_2025739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307354.1|2025814_2026390_-	DedA family protein	NA	NA	NA	NA	NA
WP_032126514.1|2026672_2027989_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2027999_2028368_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_016211265.1|2028398_2029061_-	adenylate kinase	NA	NA	NA	NA	NA
WP_032126362.1|2029235_2029601_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556556.1|2029546_2030122_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033923779.1|2030436_2031273_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2031284_2031557_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211478.1|2032222_2033038_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126518.1|2033054_2035256_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211474.1|2035338_2036688_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_016211473.1|2036762_2037362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211476.1|2037345_2037555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211931.1|2037872_2039060_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211932.1|2039255_2040545_+	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_054300152.1|2040955_2041321_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210558.1|2042957_2043713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210562.1|2043786_2045439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210560.1|2047006_2048707_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_016210557.1|2048795_2049548_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_016210564.1|2049550_2050012_-	amidohydrolase	NA	NA	NA	NA	NA
WP_016210559.1|2050008_2050971_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_016210566.1|2051331_2051754_-	universal stress protein	NA	NA	NA	NA	NA
WP_016210568.1|2052059_2052701_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_016210561.1|2052828_2054163_+	dihydroorotase	NA	NA	NA	NA	NA
WP_032126397.1|2054277_2054868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2055216_2056278_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556648.1|2056691_2057663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211446.1|2057846_2059574_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_016211448.1|2059563_2060772_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211450.1|2060870_2061893_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016212394.1|2062914_2063619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556557.1|2063666_2063978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556558.1|2064122_2065016_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126170.1|2065179_2065452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211040.1|2065679_2066891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211037.1|2067241_2067871_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211042.1|2067919_2068936_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211035.1|2069182_2069398_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211043.1|2069450_2069900_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211039.1|2069979_2071725_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211036.1|2071816_2073688_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_054300271.1|2074035_2075010_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211094.1|2075029_2075353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211091.1|2076417_2078898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211092.1|2078941_2080234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307348.1|2080469_2083226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211519.1|2084381_2084801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|2084801_2085503_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|2085763_2085970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941967.1|2086199_2086505_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126840.1|2086683_2088681_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2088664_2089711_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016212098.1|2090418_2091270_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016212100.1|2091270_2092191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212654.1|2092601_2092886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377876.1|2092877_2093333_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2093292_2093631_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212093.1|2093843_2094773_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_129556559.1|2094929_2095358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556560.1|2095438_2095975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2095944_2096850_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|2097040_2097649_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_081007013.1|2097689_2097989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2097978_2098143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274909.1|2098526_2098853_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2098951_2099527_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2099472_2099838_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556561.1|2100008_2101161_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	2.6e-58
WP_016211971.1|2101367_2101979_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032126649.1|2101999_2103196_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_017377024.1|2103292_2103433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211968.1|2103445_2103850_-	SufE family protein	NA	NA	NA	NA	NA
WP_075273313.1|2103975_2104314_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556562.1|2104273_2104576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|2104720_2104906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|2105475_2106057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556649.1|2106084_2106942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211960.1|2107481_2108009_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_075273327.1|2108252_2108828_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2108773_2109139_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209897.1|2109160_2109403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556650.1|2109723_2110698_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209885.1|2111126_2111840_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016209894.1|2112008_2112500_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209887.1|2112643_2113135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209877.1|2113337_2114228_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_080664826.1|2114416_2115016_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016209878.1|2115096_2116035_-	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	29.6	1.9e-14
WP_129556563.1|2116086_2117187_-	FUSC family protein	NA	NA	NA	NA	NA
WP_016209883.1|2117305_2118622_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	9.4e-65
WP_016209893.1|2118676_2123566_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_016209881.1|2123658_2123961_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_016209876.1|2124071_2125994_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_016209888.1|2126015_2127311_+	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_016209898.1|2127307_2128918_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_016209882.1|2129024_2129918_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_016209884.1|2130027_2130651_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036777115.1|2130727_2130928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209891.1|2131069_2131768_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016209896.1|2131914_2132484_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_122940402.1|2132798_2133422_-	porin family protein	NA	NA	NA	NA	NA
WP_032126745.1|2133630_2134233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|2134304_2134670_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046744.1|2134726_2134900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556564.1|2136069_2136399_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273603.1|2137555_2137732_+	phosphatase	NA	NA	NA	NA	NA
WP_129556565.1|2137855_2138251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126686.1|2139720_2140305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274914.1|2140855_2141731_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_059372565.1|2141779_2142151_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556566.1|2142059_2142263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210465.1|2142770_2143613_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_016210463.1|2143663_2144011_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210471.1|2144201_2145089_+	ROK family protein	NA	NA	NA	NA	NA
WP_016210467.1|2145203_2145806_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210468.1|2145802_2146522_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_075275113.1|2146590_2148300_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_016210464.1|2148450_2150388_+	AsmA family protein	NA	NA	NA	NA	NA
WP_032126596.1|2150496_2151549_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_016210461.1|2151548_2151824_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016210458.1|2151904_2152453_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_016210459.1|2155527_2156046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212492.1|2156250_2157105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2157154_2158129_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 23
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	2178799	2260407	3113959	transposase,tRNA	Staphylococcus_phage(35.29%)	83	NA	NA
WP_036771330.1|2178799_2179774_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016212614.1|2179942_2180149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923739.1|2180293_2181802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211535.1|2182013_2183801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211536.1|2183876_2184110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211538.1|2184804_2185728_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_054300443.1|2185966_2186245_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|2186297_2186546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|2186503_2187565_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212177.1|2188560_2188734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212174.1|2188810_2189068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2190142_2190718_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274918.1|2190663_2191029_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212205.1|2191712_2191892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|2192031_2193477_+	MFS transporter	NA	NA	NA	NA	NA
WP_016212319.1|2194035_2194263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|2194249_2194576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|2194577_2195009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|2195537_2196599_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210831.1|2196693_2197239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|2197508_2198528_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|2198514_2198937_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|2198938_2199412_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_052133275.1|2199527_2200151_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210836.1|2200180_2200855_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|2200860_2202009_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|2202005_2202467_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210830.1|2202542_2203793_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_016210824.1|2203919_2205599_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|2205708_2206575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274920.1|2208005_2208740_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	4.8e-10
WP_016211000.1|2208835_2209621_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307345.1|2209764_2210451_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211002.1|2210484_2210883_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|2211046_2211352_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_016210998.1|2211429_2211684_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|2211837_2213499_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|2213558_2214242_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|2214241_2215330_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016211004.1|2215378_2218015_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300237.1|2218427_2219489_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556568.1|2219678_2221160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2221196_2221772_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|2221717_2222008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2222021_2222597_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2222542_2222908_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212450.1|2223063_2223966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2224009_2224984_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211507.1|2225297_2226617_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|2226620_2227337_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211506.1|2227333_2227975_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_075274921.1|2227967_2228066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274922.1|2228043_2228340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211503.1|2228350_2228806_-	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_016211508.1|2228860_2229205_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211502.1|2229234_2230278_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_129556569.1|2230692_2230902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2230891_2231467_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2231412_2231778_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210192.1|2232090_2232609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210193.1|2232980_2233142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210194.1|2233198_2233546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210186.1|2233580_2234243_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_129556570.1|2234286_2234904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210201.1|2235115_2236171_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	3.4e-49
WP_016210187.1|2236174_2239360_+	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_016210205.1|2239440_2240397_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.6	5.3e-49
WP_016210206.1|2240445_2240982_+	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	38.4	8.4e-20
WP_016210199.1|2240978_2241740_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_016210202.1|2241845_2244434_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.8	9.7e-122
WP_032126472.1|2244896_2245547_-	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_016210190.1|2245766_2246642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210195.1|2246832_2247234_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_016210198.1|2247250_2247802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210188.1|2248113_2248800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210185.1|2248800_2251011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210196.1|2251364_2251718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2251675_2252737_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212285.1|2252786_2254265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274925.1|2254312_2255374_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556651.1|2255561_2256770_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300237.1|2257011_2258073_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211428.1|2258343_2260407_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.8	3.8e-36
>prophage 24
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	2300670	2360282	3113959	transposase,tRNA	Planktothrix_phage(16.67%)	57	NA	NA
WP_129556571.1|2300670_2301381_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2301409_2301814_+	RidA family protein	NA	NA	NA	NA	NA
WP_016209567.1|2302929_2303547_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126712.1|2303981_2304440_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209553.1|2305184_2306195_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	42.2	2.9e-58
WP_016209566.1|2306679_2307591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209545.1|2307916_2311411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209551.1|2311448_2312288_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.0	1.8e-45
WP_016209564.1|2312474_2312690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209547.1|2312738_2313314_-	ribonuclease HI	NA	V9M0C8	Vibrio_phage	46.6	1.3e-29
WP_016209540.1|2313310_2313649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209568.1|2313817_2314807_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.7	1.7e-18
WP_016209572.1|2314807_2315770_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-16
WP_016209559.1|2315779_2316682_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300271.1|2316725_2317700_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212612.1|2317837_2318071_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300455.1|2318164_2318530_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2318586_2318751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2318740_2319040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212572.1|2319097_2319490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2319619_2319985_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300461.1|2320041_2320350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2320441_2321017_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2320962_2321328_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|2321480_2321753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212514.1|2322163_2322301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|2322319_2323156_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2323167_2323440_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126774.1|2323595_2323931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307356.1|2324090_2325623_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_016211407.1|2325655_2326495_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211411.1|2326491_2326989_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_016211412.1|2326992_2327985_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_016211408.1|2328099_2329446_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_054300173.1|2329669_2330731_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212287.1|2330809_2331955_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_016211372.1|2338054_2338912_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016211371.1|2338898_2339822_-	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211368.1|2340018_2341410_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211369.1|2341456_2342500_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211370.1|2342542_2342986_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211374.1|2343118_2344309_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211373.1|2344363_2344510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|2345061_2345979_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_036794860.1|2346246_2346540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|2346616_2346811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212197.1|2347829_2348747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210876.1|2349212_2350055_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016210873.1|2350122_2350773_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210874.1|2350787_2351828_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210882.1|2351950_2353036_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210872.1|2353062_2354172_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210871.1|2354188_2354506_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210879.1|2354502_2354862_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210878.1|2354964_2357694_-	kinase	NA	NA	NA	NA	NA
WP_080664847.1|2358194_2359148_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_075274927.1|2359220_2360282_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	2447339	2532511	3113959	transposase,tRNA	Escherichia_phage(41.18%)	86	NA	NA
WP_033923779.1|2447339_2448176_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2448187_2448460_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211743.1|2448526_2448889_-	ABC transporter membrane domain protein	NA	NA	NA	NA	NA
WP_129556577.1|2448875_2449904_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	4.8e-16
WP_016211744.1|2449881_2450286_-	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_016211742.1|2450516_2452496_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_054300202.1|2452775_2453504_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019244.1|2453593_2454205_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_016210955.1|2454561_2454816_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|2454914_2456699_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_016210956.1|2456787_2457507_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210951.1|2457689_2457896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210948.1|2457895_2458132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|2458144_2458522_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|2459028_2459847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210947.1|2459940_2460138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210946.1|2460232_2461618_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210945.1|2461744_2462335_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_075274930.1|2463145_2463565_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274931.1|2463594_2464323_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_032126570.1|2465080_2465380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211816.1|2465392_2465746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|2465787_2467401_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_075274932.1|2467622_2467844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274933.1|2468152_2468881_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211951.1|2469497_2470595_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|2470628_2471879_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_075274934.1|2472366_2473035_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.0	2.8e-41
WP_016212193.1|2473157_2473496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|2473563_2473950_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|2473946_2474192_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300202.1|2474600_2475329_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211625.1|2475812_2476682_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_016211621.1|2476678_2478028_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	4.6e-75
WP_016211623.1|2478140_2479781_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_016211987.1|2481602_2483339_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_144019359.1|2483500_2483698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556671.1|2483842_2484571_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_098082825.1|2484634_2484943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|2484935_2485268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|2485271_2485841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211655.1|2485969_2486383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211652.1|2486642_2487848_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211653.1|2487955_2488981_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_054300202.1|2489072_2489801_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212214.1|2489959_2490460_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036780855.1|2490434_2490932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|2491697_2492426_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211053.1|2492468_2493035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211047.1|2493122_2494757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|2495118_2495622_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|2495584_2496292_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|2496360_2497221_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_016211045.1|2497201_2497975_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|2498005_2499259_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|2499258_2500221_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|2500264_2501017_+	ComF family protein	NA	NA	NA	NA	NA
WP_016210615.1|2503392_2503863_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|2503908_2504148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274938.1|2504166_2504673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|2504836_2506261_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_016210618.1|2506325_2507375_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|2507641_2508421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556587.1|2508464_2509367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210625.1|2509425_2510172_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_016210616.1|2510420_2513231_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_129556661.1|2513531_2514095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|2514083_2514812_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_080664881.1|2514901_2515108_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212263.1|2515270_2515864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212264.1|2515909_2516503_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	5.4e-28
WP_016212238.1|2517018_2518308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274939.1|2518337_2519066_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.8e-42
WP_087910645.1|2519178_2520331_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274940.1|2520359_2521040_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	2.0e-42
WP_016211997.1|2521395_2522505_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	24.5	4.4e-07
WP_016211996.1|2522506_2523454_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_075274941.1|2523837_2524566_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.2e-42
WP_075275114.1|2524595_2524958_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212339.1|2525110_2525857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274942.1|2525875_2526604_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.1	2.7e-45
WP_032127022.1|2527280_2529467_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_087910645.1|2529528_2530682_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274943.1|2530967_2531492_+	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_129556588.1|2531682_2531850_-	phosphatase	NA	NA	NA	NA	NA
WP_075274944.1|2531794_2532511_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
>prophage 26
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	2547329	2594931	3113959	integrase,protease,transposase,tRNA	uncultured_Caudovirales_phage(18.18%)	43	2545054:2545113	2595671:2595965
2545054:2545113	attL	CACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAG	NA	NA	NA	NA
WP_081377879.1|2547329_2547554_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_016212230.1|2547609_2549058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|2550591_2550780_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556589.1|2552181_2552457_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|2552459_2553062_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_016212522.1|2553158_2553413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|2553957_2555037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211874.1|2555355_2557074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2557117_2558023_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046750.1|2559267_2559405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210068.1|2560591_2561167_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_016210050.1|2561242_2562118_-	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_016210054.1|2562182_2562704_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210069.1|2562688_2563771_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.6e-20
WP_016210051.1|2564011_2564416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210073.1|2564840_2565572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210076.1|2565828_2567130_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210066.1|2567271_2567940_+|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_032126425.1|2568383_2568980_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210052.1|2569000_2570197_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
WP_016210064.1|2570321_2571686_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_016210075.1|2571682_2572774_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_016210065.1|2573027_2573687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210057.1|2573827_2574337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126424.1|2574345_2575170_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_016210061.1|2575182_2575827_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.8e-19
WP_016210062.1|2575816_2576656_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.3	1.8e-08
WP_016210074.1|2576661_2577288_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_016210053.1|2577449_2577992_+	septation protein A	NA	NA	NA	NA	NA
WP_016210060.1|2578075_2578378_+	YciI family protein	NA	NA	NA	NA	NA
WP_032126423.1|2578374_2578638_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210070.1|2578731_2579004_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_016210055.1|2579042_2579681_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_032126421.1|2579948_2581040_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032126420.1|2581243_2583004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210679.1|2583679_2586004_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.9	2.0e-17
WP_016210675.1|2586171_2586888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210677.1|2586967_2587582_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_016210672.1|2587574_2588957_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_016210673.1|2588965_2589439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210671.1|2589571_2590831_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_016210676.1|2591286_2593368_+	kinase domain protein	NA	NA	NA	NA	NA
WP_036771330.1|2593956_2594931_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
2595671:2595965	attR	CACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTTGGA	NA	NA	NA	NA
>prophage 27
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	2599944	2653537	3113959	transposase,tRNA	Microbacterium_phage(12.5%)	58	NA	NA
WP_054300282.1|2599944_2600409_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377880.1|2600465_2600945_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556590.1|2601802_2602198_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_032126312.1|2602194_2602989_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211756.1|2603167_2603893_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211759.1|2604138_2605326_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_081377344.1|2605680_2606808_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210935.1|2607138_2607681_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|2607677_2608364_-	acireductone synthase	NA	NA	NA	NA	NA
WP_016210942.1|2608367_2608979_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|2609025_2610045_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|2610146_2610941_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|2610978_2611785_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|2611863_2612913_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|2613110_2614370_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|2614416_2615094_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2615179_2615461_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016210940.1|2615552_2616740_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	6.4e-20
WP_129556549.1|2616847_2617734_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210820.1|2617935_2618877_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|2619380_2619605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|2619896_2620601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210823.1|2621050_2621689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|2622023_2622554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210821.1|2622550_2624083_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2624079_2625030_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2625449_2626082_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2626324_2626522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2626871_2627300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046752.1|2627338_2628076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274949.1|2628053_2629115_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126306.1|2629339_2629636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556591.1|2629740_2630397_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2630620_2631118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377881.1|2632034_2632202_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377882.1|2632208_2632490_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2632449_2632788_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210986.1|2632845_2634384_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	1.3e-86
WP_098082804.1|2634495_2635594_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_016210987.1|2635831_2637031_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_016210981.1|2637060_2637699_+	ribonuclease T	NA	NA	NA	NA	NA
WP_016210983.1|2637714_2639898_-	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	1.1e-06
WP_032126304.1|2640135_2640480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210984.1|2640493_2641444_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_052104666.1|2641608_2642067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2642470_2643357_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212032.1|2643613_2644741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|2644864_2645527_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|2645618_2645864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211962.1|2646161_2646677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211963.1|2647225_2647885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|2647986_2648637_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211964.1|2648749_2649070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2649128_2650103_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126299.1|2650353_2650575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212027.1|2650597_2651821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212028.1|2652315_2652564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2652651_2653537_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	2693040	2776359	3113959	protease,transposase,tRNA	unidentified_phage(23.08%)	82	NA	NA
WP_075273298.1|2693040_2693616_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033923659.1|2693753_2694362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307321.1|2694424_2694973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209980.1|2695059_2696226_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.7e-25
WP_032126286.1|2696531_2699330_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	4.9e-180
WP_016209981.1|2699388_2700609_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	8.5e-36
WP_016209998.1|2700638_2701040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209994.1|2701706_2701994_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_016209985.1|2702150_2702489_+	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_016209995.1|2702523_2704161_-	response regulator	NA	NA	NA	NA	NA
WP_016209992.1|2704262_2705312_+	WD domain, G-beta repeat family protein	NA	NA	NA	NA	NA
WP_016209988.1|2705384_2706029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556662.1|2706025_2707273_-	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_016209986.1|2707278_2708568_-	ubiquinone biosynthesis hydroxylase UbiH/UbiF/VisC/COQ6 family protein	NA	NA	NA	NA	NA
WP_016209989.1|2708592_2709183_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_016209996.1|2709327_2709552_+	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_016209991.1|2709532_2709862_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_033923658.1|2710087_2710651_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209997.1|2710685_2711147_+	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_016209977.1|2711223_2712909_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_032126288.1|2712958_2713759_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_016210000.1|2713785_2714334_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_016209993.1|2714463_2714856_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016209990.1|2714912_2715317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144019123.1|2715349_2716093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2716582_2717644_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2717734_2718481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274953.1|2718605_2719469_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|2719712_2720075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377902.1|2720261_2720789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556595.1|2720933_2721350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|2723121_2724033_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|2724084_2724933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|2725377_2726088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556596.1|2726179_2727148_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|2727135_2727783_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_016210370.1|2727811_2728663_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|2728677_2729955_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|2729995_2730511_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210372.1|2730589_2731651_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|2731672_2732761_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_016210378.1|2732805_2734641_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2734683_2735154_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2735190_2735526_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080664840.1|2735538_2736255_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|2736191_2737208_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|2737204_2737684_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|2737767_2740248_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2740310_2740676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273456.1|2741053_2741353_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2741312_2741768_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2741782_2742073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210570.1|2742138_2743737_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2743867_2744203_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_016210578.1|2744230_2745895_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	7.1e-33
WP_016210581.1|2745891_2746536_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|2746535_2747279_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2747337_2747577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2747727_2749095_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|2749105_2749657_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_155097789.1|2749737_2750841_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|2750842_2752600_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126277.1|2752822_2753413_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|2753500_2753920_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_016210580.1|2754060_2754321_+	methyltransferase	NA	NA	NA	NA	NA
WP_075274955.1|2754396_2755371_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_075274956.1|2755413_2755782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212327.1|2755842_2756628_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075274955.1|2758013_2758988_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212084.1|2759269_2760286_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126534.1|2760285_2760801_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212085.1|2760842_2761316_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_075274955.1|2761473_2762448_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212306.1|2762483_2763014_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212310.1|2763043_2763499_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_129556598.1|2766048_2768562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211935.1|2769496_2772145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274958.1|2772593_2773655_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2773681_2774257_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2774202_2774568_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046755.1|2774639_2774816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556599.1|2775206_2776359_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 29
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	2888921	2932319	3113959	protease,transposase	Acanthamoeba_polyphaga_lentillevirus(14.29%)	41	NA	NA
WP_016209259.1|2888921_2889770_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_016209274.1|2889886_2890798_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_075274963.1|2891516_2892578_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212454.1|2892797_2893478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211192.1|2894266_2895625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211189.1|2895669_2896128_-	NfeD family protein	NA	NA	NA	NA	NA
WP_016211187.1|2896152_2897073_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_016211186.1|2897199_2897982_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.3	8.2e-32
WP_016211190.1|2898071_2899571_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_016211188.1|2899892_2901776_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_075273298.1|2901849_2902425_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2902370_2902736_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211157.1|2903300_2903957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211161.1|2904064_2905174_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|2905185_2905830_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|2905848_2906835_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|2906914_2907991_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|2908193_2909018_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|2909334_2910339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|2910547_2911513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274965.1|2911651_2912527_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2912823_2913876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211698.1|2914143_2914572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2914785_2915277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2915332_2916583_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2916685_2916904_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_052104629.1|2917346_2918372_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080728341.1|2918821_2918992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212561.1|2918963_2919104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210728.1|2920018_2920489_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2920777_2922157_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2922184_2922643_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2922620_2923838_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2924029_2924266_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2924279_2924435_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2924515_2925478_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2925637_2926954_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2926963_2927632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2927994_2929809_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_129556601.1|2929926_2930703_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_052104629.1|2931293_2932319_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP038967	Piscirickettsia salmonis strain Psal-068 chromosome, complete genome	3113959	2964004	3081431	3113959	transposase,tRNA	Staphylococcus_phage(33.33%)	111	NA	NA
WP_054300271.1|2964004_2964979_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|2965054_2966074_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556602.1|2966472_2966682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274966.1|2968673_2969735_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211201.1|2969815_2970124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211206.1|2970238_2971555_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664857.1|2972016_2973303_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211205.1|2973375_2974272_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211203.1|2974358_2975357_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032126430.1|2975465_2975990_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_129556668.1|2976237_2977476_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_016212222.1|2978023_2978497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|2978493_2978889_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2979818_2980394_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2980339_2980705_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211610.1|2980969_2983300_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_129556603.1|2983420_2985436_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075274967.1|2985619_2989012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|2989076_2989382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274968.1|2989551_2990652_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556605.1|2991046_2992156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209721.1|2993094_2994492_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.3e-77
WP_051307313.1|2994611_2995559_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|2995555_2996071_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|2996057_2997257_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|2997253_2997577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|2997578_2998808_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|2998807_2999851_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|2999850_3000534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3000530_3003020_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3003036_3003291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3003291_3003648_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|3004427_3005591_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|3005610_3008718_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|3008719_3010225_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3010252_3010534_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3010682_3011024_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3011143_3013024_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_059372650.1|3013108_3014707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3014724_3015840_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|3015967_3016966_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209700.1|3016969_3017728_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3017729_3018929_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3018912_3019584_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3019605_3020382_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3020385_3021384_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3021385_3021964_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3021960_3023430_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3023473_3023761_-	trp operon repressor	NA	NA	NA	NA	NA
WP_016209699.1|3023961_3024558_+	DMT family transporter	NA	NA	NA	NA	NA
WP_075274970.1|3024767_3025238_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|3025294_3025450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274971.1|3025594_3026047_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3026232_3026454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212371.1|3026569_3027202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274972.1|3027179_3028241_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211865.1|3028680_3029220_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|3029304_3029841_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|3030492_3030795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|3031244_3031553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274973.1|3032143_3032611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|3032893_3033604_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|3033830_3034229_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_016211231.1|3035096_3036047_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3036046_3038125_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3038272_3038788_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3038796_3039360_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3039340_3040087_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3040226_3040679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|3041102_3041939_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3041935_3042832_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3042864_3043932_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3043950_3044319_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3044344_3045793_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3045802_3047182_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3047222_3048554_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|3048525_3049485_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3049577_3050081_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3050215_3051367_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3051363_3051843_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3051989_3054311_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3054255_3054882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3054886_3055786_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3055858_3056437_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3056737_3056995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556611.1|3057003_3058157_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046758.1|3059293_3059425_+	phosphatase	NA	NA	NA	NA	NA
WP_155046759.1|3059569_3059725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212051.1|3060052_3060826_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126148.1|3061367_3061550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3062153_3063128_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3064222_3064561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212337.1|3064577_3065288_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_051307375.1|3065275_3065467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|3065628_3065928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|3065917_3066082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|3066138_3066504_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3067808_3068504_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3068500_3069928_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3069953_3070217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3070577_3071552_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556612.1|3071610_3072461_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|3072498_3072843_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3072839_3073676_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3073676_3074018_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3074019_3074625_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3074621_3076616_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3076635_3077577_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211292.1|3077804_3079229_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|3079741_3080716_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3080774_3081431_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP038968	Piscirickettsia salmonis strain Psal-068 plasmid unnamed1, complete sequence	150783	2323	101129	150783	head,tail,protease,transposase,capsid,integrase	Streptococcus_phage(21.28%)	116	91368:91427	104702:105564
WP_129556705.1|2323_2824_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	28.0	9.9e-07
WP_036771330.1|2882_3857_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_054300162.1|4369_5452_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212151.1|5816_6779_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|6802_7117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923686.1|7173_8223_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|8331_9372_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|9385_10015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|10105_10405_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211886.1|10401_10830_-	nucleotidyltransferase substrate-binding, HI0074 family protein	NA	NA	NA	NA	NA
WP_054300202.1|11618_12347_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126832.1|12591_13500_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_054300202.1|13610_14339_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046765.1|14450_14645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|15531_16260_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|16463_19040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046766.1|19264_19402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274822.1|19445_20420_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_075274931.1|20620_21349_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.4e-38
WP_016212137.1|21792_22854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212139.1|22929_23175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307371.1|23146_23761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|24578_25553_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_129556707.1|25912_26932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|27560_28714_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_032126239.1|28858_29131_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|29142_29979_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075275144.1|30011_30743_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212014.1|30840_31254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212017.1|31548_31947_+	hypothetical protein	NA	W8VUR5	Pseudomonas_phage	38.8	2.3e-06
WP_047927838.1|31976_32222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|32218_32518_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_016212019.1|32674_33370_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_081377351.1|34183_34963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|35046_35199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126739.1|35151_35484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|35648_36026_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_016212152.1|36332_36716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|37185_37914_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_129556708.1|38029_38365_-	mRNA-degrading endonuclease	NA	A9D9Y1	Lactobacillus_prophage	35.6	2.6e-11
WP_016212365.1|38357_38600_-	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_054300271.1|38808_39783_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_075275142.1|40418_41147_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	1.2e-37
WP_075275141.1|41429_43115_+	protein kinase	NA	NA	NA	NA	NA
WP_129556709.1|43326_43416_+	DUF1891 domain-containing protein	NA	NA	NA	NA	NA
WP_129556710.1|43496_43967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275140.1|44120_44855_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.1e-38
WP_075275139.1|45481_45712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212404.1|46326_46560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126756.1|46680_47124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275138.1|47268_47577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047124.1|47781_49443_+	AAA family ATPase	NA	A0A0K2FLP8	Brevibacillus_phage	31.5	9.1e-65
WP_016212457.1|49452_49854_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_016212456.1|49850_50138_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_075275137.1|50181_50595_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126239.1|50650_50923_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|50934_51771_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_016212579.1|52701_52899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|54404_54605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|54615_55191_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|55136_55502_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212061.1|56333_58376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|59280_59646_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|59591_60167_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075274752.1|60163_60463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|60498_61652_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_052047048.1|61832_62333_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046767.1|62332_62494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211937.1|62763_63153_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016211936.1|63642_64665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211938.1|65159_65720_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275133.1|66291_66600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|67132_68286_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273327.1|68534_69110_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075275128.1|69055_69421_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556696.1|69520_70537_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.0	3.0e-18
WP_052133287.1|70638_71037_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_129556716.1|71170_71461_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
WP_016210655.1|71474_72071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210663.1|72389_72701_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	4.3e-08
WP_016210667.1|72697_73021_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210658.1|73013_73409_+	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210651.1|73405_73756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210664.1|73755_74178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210669.1|74179_74503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|74559_74826_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075273774.1|77027_78185_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275128.1|78326_78692_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|78637_79213_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126790.1|79683_80589_+|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
WP_129556697.1|80973_81366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211776.1|81848_83186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211775.1|83353_83722_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_016211773.1|83823_84498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|84950_85316_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|85261_85837_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126360.1|86043_86778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211895.1|86900_87959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|88467_89214_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211897.1|89214_89619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|90012_90828_-	hypothetical protein	NA	NA	NA	NA	NA
91368:91427	attL	GGCACTGTTGCGAAAAATTATAGTGAACTTCAGAAAGGTTATTTTCTTGTGCTCTCTGCT	NA	NA	NA	NA
WP_054300202.1|91432_92161_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212298.1|92602_92929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307374.1|93169_93646_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_075275158.1|93760_94054_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377916.1|94170_94695_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.4	2.5e-29
WP_098082791.1|94899_95202_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.6	8.6e-14
WP_129556698.1|95210_95912_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_016211912.1|96001_96592_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
WP_032126795.1|96864_97125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|97128_97401_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_016211913.1|97726_98848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273786.1|99280_99679_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081377915.1|99687_100245_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	2.9e-47
WP_081377914.1|100389_100719_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|100835_101129_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
104702:105564	attR	GGCACTGTTGCGAAAAATTATAGTGAACTTCAGAAAGGTTATTTTCTTGTGCTCTCTGCTTAGAATTAAGCAGCTAATCCAAATAATTTATCAATGAGCTGATTTTGGGCACAGATATTCTGTTTTTTAATATAACGTAATTGACCTTTTTGAACCATGCGCATCGCTTCCATTATGTCAATGGTAGGCCGTGCTGTAGAAAGTGATTGGTACCATTGGCGGAAACGGGATTTGCGCTTTACCGCTTTGTGATCATTTTCAATGCAGTTGTTTAAATACTTCACTCGCCTGAGTTTACACTGACTAGAAAAGACACCTTCATCTTTGGCTTTTTGGTGAGCGGGTGGAAATGAAGCGTGCTTGTCGACATTCACAACACGCGGTGATTTCACATAAGGTTGGGCGATTGCCTTTTTGAAAAAGCGCATCGCCGCTTTGGCATTTTGCTGTCGGCTGAGCATCCAGTCCAAAGTATGGCCATATTTATCAATGGCTCGATAAAGGTAATACCAACGACCTTTGATTTTCACCAACGTTTCATCTAACCGCCAAGAGGCACACGTTTGACGAAAGTGGGGCCTCAGCCGTTTGGCGATCTGCGAGCCATACTCGTGCACCCAGCGACAAATGGTTGAACGCTCAATCTCAAGACCTCTTTCAGCTGCTATTTCTTTGAGATCACGGTAAGATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATGATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTCTACCCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCCG	NA	NA	NA	NA
>prophage 1
NZ_CP038969	Piscirickettsia salmonis strain Psal-068 plasmid unnamed2, complete sequence	79943	4824	28863	79943	transposase	Streptococcus_phage(16.67%)	33	NA	NA
WP_075273327.1|4824_5400_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|5345_5711_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212400.1|5761_6361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212399.1|6360_6621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|6750_7903_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212392.1|7931_8939_-	hypothetical protein	NA	W6E8G0	Rhizobium_phage	26.4	1.2e-06
WP_075273802.1|9002_9731_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.5e-37
WP_016212131.1|9914_10262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212135.1|10700_11885_+	3-methylitaconate isomerase	NA	NA	NA	NA	NA
WP_075275202.1|12128_12830_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	6.0e-10
WP_075275201.1|12832_13561_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_016212164.1|13689_14718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211443.1|15741_16428_+	Fic family protein	NA	NA	NA	NA	NA
WP_016211439.1|16431_16986_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	40.6	1.0e-20
WP_016211436.1|17030_17969_+	fic/DOC family protein	NA	S4TP71	Salmonella_phage	37.2	5.2e-25
WP_016211434.1|17941_18133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211445.1|18310_18661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211437.1|18677_19304_-	zinc-ribbon domain-containing protein	NA	A0A1S5XYQ1	Kurlavirus	28.2	4.4e-12
WP_032126541.1|19310_19703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211440.1|19713_20628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211444.1|20897_21404_+	antirestriction protein ArdA	NA	A0A222YZE5	Mycobacterium_phage	33.7	2.8e-17
WP_051307358.1|21552_21936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556729.1|22219_22450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212541.1|22436_22661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212539.1|22720_22870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|22866_23841_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212090.1|23884_24064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212087.1|24063_24492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126714.1|24659_25199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212089.1|25435_25666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126713.1|25764_26802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|27271_28297_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275198.1|28323_28863_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	40.2	8.4e-12
>prophage 2
NZ_CP038969	Piscirickettsia salmonis strain Psal-068 plasmid unnamed2, complete sequence	79943	37206	57887	79943	portal,protease,head,terminase,capsid,tail	Pseudomonas_phage(11.76%)	29	NA	NA
WP_129556725.1|37206_37887_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	39.3	3.3e-37
WP_016210977.1|38065_38359_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_129556724.1|38576_38759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046773.1|38903_39083_-	phosphatase	NA	NA	NA	NA	NA
WP_016212235.1|39129_39495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126134.1|39795_40179_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	5.6e-26
WP_016212234.1|40266_40746_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_016212231.1|40749_40959_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	43.1	1.3e-08
WP_080743047.1|40974_41331_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	61.3	5.4e-23
WP_081377926.1|41349_42432_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	1.2e-89
WP_016211136.1|42428_43670_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	46.0	3.1e-86
WP_080664855.1|43617_44289_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.8	3.0e-43
WP_016211140.1|44346_45540_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_016211133.1|45660_46995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211137.1|47185_47497_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_016211132.1|47493_47817_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211139.1|47809_48205_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211129.1|48201_48552_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211141.1|48551_48974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126913.1|48975_49299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|49355_49622_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_032126912.1|49625_51704_+	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	33.0	2.5e-56
WP_016210657.1|51696_52038_+|tail	phage minor tail family protein	tail	NA	NA	NA	NA
WP_016210666.1|52034_52706_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|52674_53421_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_016210665.1|53410_53968_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_016210662.1|53974_54262_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	2.5e-15
WP_016210670.1|54251_54506_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_016210653.1|54599_57887_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	33.5	5.2e-112
>prophage 1
NZ_CP038970	Piscirickettsia salmonis strain Psal-068 plasmid unnamed3, complete sequence	35101	3171	10860	35101	integrase,transposase	Caulobacter_phage(33.33%)	10	NA	NA
WP_016212329.1|3171_3762_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_032126737.1|3975_4704_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126738.1|4830_5103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|5095_5374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212425.1|5577_6168_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	34.4	1.1e-20
WP_032126150.1|6316_6550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|6648_7623_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212315.1|9276_9711_+	DUF29 domain-containing protein	NA	A0JC30	Ralstonia_phage	39.7	9.1e-25
WP_032126346.1|9810_10053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126347.1|10119_10860_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	6.0e-08
>prophage 2
NZ_CP038970	Piscirickettsia salmonis strain Psal-068 plasmid unnamed3, complete sequence	35101	14055	21777	35101	integrase,transposase	unidentified_phage(33.33%)	10	7660:7719	21099:21290
7660:7719	attL	TTATTCCGGTGAGATTATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTA	NA	NA	NA	NA
WP_129556741.1|14055_14727_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.4	3.4e-10
WP_155097790.1|14748_15009_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	38.5	1.7e-10
WP_016212274.1|15101_15566_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_032126154.1|15576_15771_-	addiction module toxin, HicA family	NA	A0A1X9I5T5	Streptococcus_phage	48.4	2.8e-10
WP_032126152.1|15986_16577_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.8	1.4e-20
WP_129556740.1|16640_17009_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155046774.1|17220_17397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300579.1|17615_18617_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	1.3e-26
WP_016211990.1|18946_21019_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_129556739.1|21048_21777_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
21099:21290	attR	TTATTCCGGTGAGATTATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTACCGTGATCTCAAAGAAATAGCAGCTGAAAGAGGTCTTGAGATTGAGCGTTCAACCATTTGTCGTTGGGTGCACGAGTATGGCTCGCAGATCGCCAAACGGCTGAGGCCCCACTTTCGTCAAACGTGTGCCTC	NA	NA	NA	NA
