The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	45576	89169	3153564	transposase	Moraxella_phage(20.0%)	43	NA	NA
WP_075273371.1|45576_46152_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46097_46463_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036776493.1|46661_47423_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_036779326.1|47724_49251_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49622_50462_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50501_51809_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51783_52953_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|53007_53733_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54011_54401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54588_55494_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55541_55685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047031.1|55732_56329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|56563_57717_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_016210704.1|58611_60558_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|61212_64275_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|64271_65336_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|65691_66645_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|66676_67840_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|67845_68445_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|68632_69133_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|69150_70239_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|70377_71622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|71618_72461_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_036777711.1|72440_73250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|73417_73645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|73645_74596_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|74651_75203_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|75329_75752_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|75744_76491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|76533_77232_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|77242_78067_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|78396_78765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|78759_79821_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|79870_80101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|80230_81445_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|81745_82807_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_036777695.1|82820_84548_+	oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_016211245.1|84581_85313_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|85312_86101_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211251.1|86205_86829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|87148_87361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047032.1|87516_88578_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047033.1|88572_89169_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	127259	181534	3153564	transposase	Staphylococcus_phage(42.86%)	58	NA	NA
WP_054300271.1|127259_128234_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209611.1|128482_128674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047035.1|128753_128933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209580.1|129024_129549_+	ankyrin repeat family protein	NA	NA	NA	NA	NA
WP_016209612.1|129932_130301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209595.1|130338_130611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300576.1|130701_131997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211692.1|132632_133535_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.4	1.6e-18
WP_051307362.1|133591_134443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211694.1|135022_137032_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	3.0e-110
WP_054300271.1|137069_138044_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|138545_139958_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|140450_141458_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|141477_142998_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_016211018.1|143948_145265_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|145368_145752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|145886_148952_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|149020_150124_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|150147_150702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|150816_151386_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211020.1|151505_152261_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_155047036.1|152427_153327_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047037.1|153471_153777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082829.1|154171_154567_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|154588_154954_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|155010_155175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|155164_155464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300544.1|155554_156001_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|156496_157063_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|157074_157860_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|158491_159415_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|159466_160462_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|160493_160988_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_036778333.1|161079_161337_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|161426_161849_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|162167_162884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|162927_163179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778330.1|163183_164620_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|164647_166090_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|166177_166516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|166600_167131_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|167191_169384_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|169426_169912_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|170181_170613_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036778324.1|170630_171461_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|171475_171619_-	lipoprotein	NA	NA	NA	NA	NA
WP_052104672.1|171649_172534_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|172505_172727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|172900_173179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|174149_175055_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_036780891.1|175111_176290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|176286_176862_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155053570.1|176960_177173_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300541.1|177500_178280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126848.1|178813_179614_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_052104671.1|179832_180591_+	ion transporter	NA	NA	NA	NA	NA
WP_016211859.1|180667_180955_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_075273327.1|180958_181534_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	200550	271547	3153564	tRNA,transposase,tail,protease	Acinetobacter_phage(25.0%)	59	NA	NA
WP_016209871.1|200550_202533_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|202742_204086_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|204352_207022_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|207045_208965_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|209134_210556_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|210701_211676_+	phospholipase A	NA	NA	NA	NA	NA
WP_054300537.1|211707_212115_+	glyoxalase	NA	NA	NA	NA	NA
WP_016209859.1|212393_212615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|212778_214440_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|214512_214803_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_036776911.1|215028_215484_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|215548_216013_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|216105_217452_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|217451_218357_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|218418_219405_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|219397_219640_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|219761_221306_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_036776914.1|221352_222639_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|222681_224076_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|224099_224279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|224275_224455_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_054300181.1|224458_224740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|224796_225162_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210079.1|228167_228665_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|228835_229531_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|229633_231196_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|231511_233305_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|233390_233663_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|233668_234295_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|234281_235712_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|236044_237100_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|237068_237746_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|237735_238572_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|238731_239025_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_122940784.1|239131_239938_-	trfA family protein	NA	NA	NA	NA	NA
WP_016210083.1|240242_241097_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_036776920.1|241251_242301_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_036776924.1|242351_243008_-	DedA family protein	NA	NA	NA	NA	NA
WP_016210097.1|243025_244306_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_016210096.1|244579_245941_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_032126863.1|246340_246892_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_016211802.1|252323_253595_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_036778206.1|253651_254635_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_016211800.1|254631_255417_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_032126362.1|256113_256479_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|256424_257000_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300535.1|257003_257723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|257867_258068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|258115_258577_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|259000_260482_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|260544_261654_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|261751_263713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|264242_264647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047045.1|264699_265395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|265371_266346_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_098082809.1|266516_266867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155065693.1|267286_267436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|267809_268892_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_129556499.1|270394_271547_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
>prophage 4
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	300544	360404	3153564	transposase	Bodo_saltans_virus(20.0%)	57	NA	NA
WP_054300526.1|300544_300841_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962174.1|300989_301154_-	phosphatase	NA	NA	NA	NA	NA
WP_016211026.1|301252_301657_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075273367.1|301949_302726_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_155047049.1|302734_304816_+	protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	4.0e-17
WP_016211031.1|304980_305460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211032.1|305769_306567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211033.1|306678_307971_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_032126377.1|308136_309138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211034.1|309254_309434_+	rubredoxin	NA	NA	NA	NA	NA
WP_016211023.1|309444_309879_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_016211029.1|310092_310455_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.6e-25
WP_016212102.1|310628_312269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|313779_314932_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556441.1|318360_319587_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126490.1|319935_320901_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_016210868.1|320897_321197_+	pilZ domain protein	NA	NA	NA	NA	NA
WP_036778898.1|321228_322008_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_016210861.1|322033_322264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|322415_322661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210870.1|322812_323604_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016212128.1|324517_325264_+	solute symporter family protein	NA	NA	NA	NA	NA
WP_032126495.1|325354_326239_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_054300397.1|326644_326890_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046705.1|327130_327298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|327243_327819_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047050.1|327871_328609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777815.1|328612_328897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210128.1|328990_329254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|329620_330439_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|330511_332884_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_036777812.1|333596_335024_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|335058_336081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|336097_336475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|337437_337803_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|337748_338324_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210122.1|338563_339256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|339882_340857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|340846_342619_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|342619_342967_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_036777821.1|343216_344443_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|344532_345831_-	MFS transporter	NA	NA	NA	NA	NA
WP_081007061.1|345864_346614_-	queuosine precursor transporter	NA	A0A1W7AG82	Streptococcus_virus	30.4	3.9e-15
WP_016210137.1|346594_347146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007060.1|347372_348671_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|348787_349078_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_155047051.1|349389_350259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047052.1|350403_351132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777801.1|351994_352213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212044.1|352986_353241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|353963_354950_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|355087_355282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007059.1|355964_357026_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_016211797.1|357187_358591_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|358641_359217_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|359162_359477_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047053.1|359517_360404_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	444636	545108	3153564	tRNA,transposase,integrase	Escherichia_phage(43.75%)	109	511423:511482	525634:525807
WP_054300513.1|444636_445500_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|445716_447276_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|447297_448332_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|448380_448950_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|449085_450057_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|450068_451646_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|451711_452698_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_054300512.1|453029_454139_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|454244_455429_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|455506_457495_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|457703_457859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047055.1|458129_458417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|458454_458820_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|458765_459341_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047056.1|459330_459693_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144019082.1|460043_460274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126128.1|460609_462016_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|462033_463020_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|463022_464177_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|464173_464869_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|465003_466494_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_036777447.1|466514_467564_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|467630_469025_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_036777444.1|469903_471835_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.6	1.0e-120
WP_075273353.1|471839_472370_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|472404_472599_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|472641_473001_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|473420_474416_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_036777440.1|474428_476810_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|476815_477103_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|477374_477851_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|477995_478193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|478317_479292_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|480192_480291_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780545.1|480775_481486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047057.1|481649_482066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300575.1|482302_482995_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|483036_483810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|483811_484753_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|484885_486463_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|486672_488430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|488978_489737_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|489944_490517_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|490620_491169_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|491470_491716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|491744_492041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779353.1|492308_493220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300506.1|493710_494118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|494189_494918_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_032126799.1|494998_495811_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_155047058.1|496872_497235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|497237_498977_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046941.1|499378_499642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300500.1|500313_501042_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_016212070.1|501451_502051_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_016212069.1|502025_502193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212066.1|502404_503181_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_054300501.1|503541_504270_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|504281_504674_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|504670_504916_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017375910.1|505076_505805_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211714.1|505879_509224_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|510472_511048_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|510993_511359_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
511423:511482	attL	ATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATAATCTCACCGGAATAATGCT	NA	NA	NA	NA
WP_155047059.1|511637_512552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212159.1|512819_513017_+	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_054300201.1|513376_514105_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_155047060.1|514134_514809_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	45.9	5.2e-27
WP_016212024.1|514953_515202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780881.1|515198_515798_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212022.1|515797_516016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212023.1|516790_517783_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_075273432.1|517779_518514_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_155047061.1|518774_519041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047062.1|519185_519344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047063.1|519366_519618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300477.1|520067_520796_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_051307368.1|521502_522783_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_016211918.1|522782_523751_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211646.1|524122_524362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211642.1|524354_524708_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_017375910.1|525010_525739_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155047064.1|526208_526517_-	hypothetical protein	NA	NA	NA	NA	NA
525634:525807	attR	ATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATAATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTTTTACCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCC	NA	NA	NA	NA
WP_155047065.1|526678_527356_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.1	7.0e-40
WP_155047066.1|527849_528578_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.5e-43
WP_016212269.1|528746_529430_+	Fic family protein	NA	NA	NA	NA	NA
WP_016212268.1|529433_530018_+	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_017375910.1|530174_530903_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155047064.1|531371_531680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556455.1|531930_532533_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054300203.1|532537_532996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781052.1|534372_534975_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211639.1|535354_535657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211644.1|535771_536038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104773.1|536145_536589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|536650_537536_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047067.1|537636_538530_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047259.1|538674_538890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104771.1|539339_539678_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	54.9	5.4e-25
WP_075274739.1|539670_540018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274717.1|540014_540245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274718.1|540248_540719_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	64.3	1.3e-32
WP_075274740.1|540863_541229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780395.1|541373_541628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377363.1|541611_541968_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_075274719.1|542273_543140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047068.1|543625_543826_+	HNH endonuclease	NA	A0A2H4PHY5	Pseudomonas_phage	64.3	3.5e-16
WP_155047069.1|543913_544267_+	hypothetical protein	NA	Q6DMU4	Streptococcus_phage	34.8	8.2e-08
WP_054300202.1|544379_545108_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
>prophage 6
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	552807	600760	3153564	tRNA,transposase	Synechococcus_phage(33.33%)	51	NA	NA
WP_054300202.1|552807_553536_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211663.1|553629_554295_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211661.1|554359_555316_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_032126810.1|555574_556273_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211662.1|556315_557428_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_075273327.1|558032_558608_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|558553_558919_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212580.1|559006_559357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|560092_561154_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210908.1|562365_563181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126716.1|563271_564255_+	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210913.1|564425_564947_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_036779246.1|564980_565235_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.4e-20
WP_016210909.1|565237_566515_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_051307343.1|567207_567735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210906.1|567854_570167_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_032126715.1|570295_571111_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210915.1|571308_571773_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|571902_572964_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211491.1|573224_573521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211493.1|573803_575267_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211489.1|575269_576322_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_036779281.1|576311_576767_+	arginine repressor	NA	NA	NA	NA	NA
WP_155047071.1|576791_577115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|577462_577774_-	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_054300208.1|577903_578695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779278.1|579852_580806_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016212075.1|580919_581117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126198.1|581362_581563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142396463.1|581673_581790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212074.1|581876_582098_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|582124_582490_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|582546_582711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047072.1|582700_583015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046713.1|583152_583317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126195.1|583611_585048_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016210532.1|585089_586541_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016210537.1|586652_586940_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|587129_588173_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210536.1|588188_589088_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210528.1|589084_589603_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210527.1|589672_590290_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_036776217.1|590299_591787_+	ribonuclease G	NA	NA	NA	NA	NA
WP_016210534.1|591796_595477_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_036776215.1|595550_596363_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210530.1|596359_597040_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_155047260.1|597880_598039_-	phosphatase	NA	NA	NA	NA	NA
WP_155047073.1|598231_598789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|598838_599129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300215.1|599932_600427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007066.1|600421_600760_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	622230	724825	3153564	tRNA,transposase,plate,protease	Prochlorococcus_phage(17.65%)	108	NA	NA
WP_016209523.1|622230_623580_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209510.1|623630_624068_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209501.1|624329_625841_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_036778935.1|625846_627073_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|627066_628095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|628072_628765_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_155049805.1|628766_630239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778941.1|630231_630720_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_051307310.1|630725_632198_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032126187.1|632197_632596_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016209524.1|632592_634281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209506.1|634262_635219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|635261_635777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|635881_636814_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209534.1|637033_637420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209530.1|637436_638081_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209504.1|638261_639101_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_016209502.1|639176_639779_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209512.1|639779_640634_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209537.1|640990_641302_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209519.1|641326_642718_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|642873_643605_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_129556465.1|643601_644174_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|644160_644718_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_016209498.1|644723_645704_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209539.1|645843_646644_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_036780687.1|646647_647415_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209535.1|647411_647876_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_016209507.1|647898_648552_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209517.1|648555_648903_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209505.1|648936_649188_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|649263_650532_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209527.1|650534_651293_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209508.1|651354_652245_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|652295_652979_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_075273445.1|653064_653322_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155047218.1|653594_655763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210408.1|655754_656627_-	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_016210409.1|656794_658624_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210411.1|658786_659428_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_075273448.1|659669_660200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|660217_660391_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_016210402.1|660449_661499_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210405.1|661505_662456_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210406.1|662509_663454_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210415.1|663481_664219_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|664307_664550_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|664624_665848_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210400.1|665879_666728_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210401.1|666724_667777_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_032126181.1|667897_668518_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_036780649.1|668533_669520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|669630_670086_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|670045_670384_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|671148_672054_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155047217.1|672128_673190_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212599.1|673239_673449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|674683_675130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|675133_675709_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|675654_676020_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126651.1|676140_676326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209899.1|676429_677464_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|677460_678171_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209923.1|678645_679164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209901.1|679281_679614_-	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_036777003.1|679643_682598_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_054300221.1|682643_683141_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209922.1|683200_683617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209915.1|683708_684569_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126652.1|684651_685218_+	chorismate lyase	NA	NA	NA	NA	NA
WP_016209918.1|685250_686105_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_155047216.1|686146_689053_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|689113_689311_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209903.1|689317_690328_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209910.1|690324_691383_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_032126655.1|691376_692177_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209913.1|692179_692998_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209907.1|693009_693957_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_032126654.1|693964_695266_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209919.1|695444_696548_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_016209906.1|696544_696937_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209924.1|696948_698325_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209900.1|698318_699788_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_032126362.1|700245_700611_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|700556_701132_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300223.1|701226_702198_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	1.3e-34
WP_129556478.1|702434_703321_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|703620_703866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300225.1|704828_705248_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046954.1|705354_705528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126800.1|705754_706489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|706613_707675_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940948.1|707997_708702_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210599.1|708795_709509_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016210601.1|709591_710683_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210603.1|710754_711336_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210606.1|711341_711968_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210609.1|712064_713000_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_129556471.1|713359_714031_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_036778813.1|714172_714832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210607.1|715000_716260_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210611.1|716256_717342_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210605.1|717334_718216_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210612.1|718204_719455_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_054300237.1|720740_721802_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047215.1|721779_723033_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_032126362.1|723938_724304_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|724249_724825_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	760242	808167	3153564	tRNA,transposase	Staphylococcus_phage(42.86%)	37	NA	NA
WP_016209374.1|760242_761694_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209368.1|761729_763259_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_155047212.1|763834_765478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047211.1|766019_766961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209384.1|767311_768127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209395.1|768418_771109_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_081007011.1|771357_772578_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|772745_774452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209398.1|775050_776277_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|776829_777804_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273456.1|777926_778226_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047210.1|778185_778548_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962625.1|778609_779495_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047266.1|780603_781035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|781750_782116_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|782061_782637_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300237.1|782663_783725_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556478.1|783839_784726_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047209.1|785075_785630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211819.1|785848_786079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|786375_786876_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211818.1|787078_788335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777316.1|788691_789105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273460.1|789414_790299_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300240.1|790555_790759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|791058_792033_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047208.1|792335_793808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|793827_794802_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210742.1|794952_795228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|795393_796014_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_054300241.1|796332_798309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210739.1|798464_799922_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210743.1|799990_801571_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_054300242.1|801611_802148_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210746.1|802193_806090_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210741.1|806096_806420_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_054300237.1|807105_808167_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	824848	931268	3153564	transposase,integrase,protease	Staphylococcus_phage(24.14%)	100	884949:885008	906143:907245
WP_033923708.1|824848_825724_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211687.1|825979_826624_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211685.1|826654_828460_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|828483_829059_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_155047207.1|829603_830677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|830786_831761_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046989.1|831993_833058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|833548_833914_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047206.1|833928_834438_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|834473_835448_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300250.1|835530_836190_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_016209640.1|836608_837628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209649.1|838086_839052_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209646.1|839096_839672_-	VOC family protein	NA	NA	NA	NA	NA
WP_016209651.1|839702_840977_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126159.1|841622_842336_+	aldolase	NA	NA	NA	NA	NA
WP_016209641.1|842415_843153_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016209658.1|843273_844629_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_075273478.1|844805_845477_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209661.1|845592_846468_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_016209645.1|847071_848376_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|848488_849094_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|849175_850477_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_032126161.1|850544_852977_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209655.1|853080_853353_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075273480.1|853435_855334_+	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_016209643.1|855365_856250_+	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_016209657.1|856258_856654_-	CrcB family protein	NA	NA	NA	NA	NA
WP_016209662.1|857081_859229_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209652.1|859200_860550_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209642.1|860546_862667_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209656.1|862663_864367_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209654.1|864485_865628_-	galactokinase	NA	NA	NA	NA	NA
WP_016209659.1|865692_866721_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_036776625.1|866847_868362_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_155065704.1|868451_868733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275067.1|869269_870337_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|871399_872305_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_051307360.1|872421_873351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780074.1|874442_875249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|875591_877484_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_032126157.1|877770_878175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049115.1|878400_878928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|878917_879804_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212436.1|880142_880553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155065706.1|880766_880949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|881436_881802_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|881747_882323_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080664862.1|883496_884195_+	P-loop NTPase	NA	NA	NA	NA	NA
WP_016211528.1|884175_884481_+	hypothetical protein	NA	NA	NA	NA	NA
884949:885008	attL	CGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACT	NA	NA	NA	NA
WP_054300271.1|885040_886015_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300253.1|886233_887184_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	34.7	6.9e-09
WP_016211534.1|887170_887680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211530.1|887685_888582_-	Abi family protein	NA	A3QSC6	Clostridium_virus	32.0	5.3e-35
WP_016211531.1|888935_889616_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155047204.1|889679_890237_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0V4T7	Roseobacter_phage	33.3	8.4e-15
WP_054300271.1|890260_891235_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212424.1|891578_891857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|891849_892122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|892239_893322_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036780532.1|893399_894440_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_081007067.1|894951_900426_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_016212302.1|900646_900946_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_155047203.1|901246_902308_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036781361.1|902327_902717_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_155047202.1|902999_904064_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.2	4.7e-139
WP_016211579.1|904568_905054_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211583.1|905121_906030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|906234_907209_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211584.1|907381_907735_+	hypothetical protein	NA	NA	NA	NA	NA
906143:907245	attR	CGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTCTCTAGTTCGCCTTTTGACTTAGAGGGTAGAGATGGTTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGGTTATCAGAGGGAGACTCGCTCAGATCAATTGCTAGAGCACTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
WP_016211586.1|907801_907996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211578.1|908011_908356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|908425_909001_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|908946_909312_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155049808.1|909396_910005_+	DNA polymerase	NA	NA	NA	NA	NA
WP_052047108.1|910089_910488_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046984.1|911299_912418_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046716.1|912839_912986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|913683_914238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|914674_914857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376905.1|914921_915149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556629.1|915379_916126_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_026063577.1|916352_916646_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556482.1|916717_917323_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_016210545.1|917471_918449_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_155047199.1|918545_919988_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210553.1|920014_920668_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_036779374.1|920792_921359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307331.1|921713_923492_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_052104721.1|923563_925270_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.7	7.3e-25
WP_054300262.1|925261_925552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|926014_926380_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|926325_926901_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212461.1|926904_927279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|927654_928629_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_054300263.1|928700_929141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047198.1|929128_929296_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300265.1|929440_929701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|929660_929999_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962625.1|930382_931268_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	951810	996933	3153564	tRNA,transposase	Escherichia_phage(16.67%)	44	NA	NA
WP_054300173.1|951810_952872_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211781.1|953088_954336_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036779112.1|954558_955995_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155065710.1|956080_956500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273492.1|956518_956638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|956746_957808_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007012.1|957802_957973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|957962_958127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|958183_958549_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300269.1|958570_958939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047196.1|959083_959665_-	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_017375910.1|959735_960464_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016210898.1|960720_961071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|961159_961450_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210894.1|961924_962227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300270.1|962567_963545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556487.1|963623_964961_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210903.1|965079_965451_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_016210904.1|965672_966323_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210896.1|966365_967448_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210899.1|967501_969385_+	APC family permease	NA	NA	NA	NA	NA
WP_033923708.1|969994_970870_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155047195.1|970882_971785_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211091.1|971859_974340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273494.1|975404_975965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|976555_977617_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275207.1|977664_978114_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211036.1|978461_980333_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_036779409.1|980424_982170_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211043.1|982249_982699_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211035.1|982751_982967_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211042.1|983213_984230_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211037.1|984278_984908_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211040.1|985258_986470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126170.1|986697_986970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047067.1|987133_988027_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556557.1|988171_988483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104774.1|988530_989163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047009.1|989307_989481_-	phosphatase	NA	NA	NA	NA	NA
WP_016211450.1|990256_991279_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211448.1|991377_992586_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211446.1|992575_994303_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_036776407.1|994486_995623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|995871_996933_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	1009441	1064330	3153564	tRNA,transposase,protease	Orpheovirus(16.67%)	56	NA	NA
WP_129556478.1|1009441_1010328_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211932.1|1010738_1012028_-	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_036777061.1|1012223_1013411_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211476.1|1013728_1013938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211473.1|1013921_1014521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211474.1|1014595_1015945_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_032126518.1|1016027_1018229_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211478.1|1018245_1019061_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126519.1|1019040_1019760_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_075273327.1|1019927_1020503_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1020448_1020814_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211265.1|1020988_1021651_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|1021681_1022050_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_032126514.1|1022060_1023377_-	MFS transporter	NA	NA	NA	NA	NA
WP_051307354.1|1023659_1024235_+	DedA family protein	NA	NA	NA	NA	NA
WP_032126515.1|1024310_1024490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|1024662_1024956_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_075273504.1|1025145_1025499_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211262.1|1025553_1027827_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_016211259.1|1027886_1028132_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_054300275.1|1028256_1029132_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211550.1|1029209_1029971_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_016211548.1|1029954_1030911_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211549.1|1031173_1033678_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211553.1|1033681_1034422_+	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_054300209.1|1034761_1035127_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1035183_1035348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1035337_1035637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049809.1|1035640_1036936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1037110_1038085_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209411.1|1038290_1039085_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_016209421.1|1039247_1040036_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_036776605.1|1040032_1041244_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_032126508.1|1041233_1041593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209444.1|1041687_1042116_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_129556555.1|1042246_1043377_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209436.1|1043373_1044102_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_016209412.1|1044159_1045047_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209433.1|1045131_1045506_+	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209424.1|1045605_1046883_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
WP_080664816.1|1046894_1047626_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_052047073.1|1047612_1048863_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_016209427.1|1048956_1050360_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_016209408.1|1050513_1050684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209406.1|1050998_1051820_+	ParA family protein	NA	Q8JL10	Natrialba_phage	32.2	5.0e-16
WP_016209405.1|1051816_1052710_+	cheW-like domain protein	NA	NA	NA	NA	NA
WP_016209443.1|1052755_1053277_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_036776598.1|1053351_1053837_+	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_155047194.1|1054125_1054884_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_016209404.1|1054873_1055737_-	chemotaxis phosphatase CheX family protein	NA	NA	NA	NA	NA
WP_016209435.1|1055763_1056135_-	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.1e-05
WP_016209445.1|1056235_1057192_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_054300277.1|1057674_1060356_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_016209439.1|1060436_1061063_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_129556553.1|1061226_1062819_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_016209434.1|1062908_1064330_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	1079369	1208585	3153564	tRNA,transposase,protease	Staphylococcus_phage(21.43%)	104	NA	NA
WP_016209432.1|1079369_1081079_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016209448.1|1081336_1082668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209449.1|1083109_1084582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|1085297_1085663_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273508.1|1085903_1086770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273512.1|1087282_1087627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776562.1|1087779_1087971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1088214_1088790_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1088735_1089101_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300283.1|1089341_1089983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1090450_1091425_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047193.1|1092638_1094027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780476.1|1094262_1096200_-	histidine kinase	NA	NA	NA	NA	NA
WP_016210517.1|1097213_1097933_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_032126504.1|1098046_1101586_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_016210525.1|1101652_1102471_+	ZipA protein	NA	NA	NA	NA	NA
WP_016210518.1|1102457_1104497_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.8	3.0e-126
WP_016210522.1|1104512_1105565_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_016210524.1|1105575_1106106_+	exsB family protein	NA	NA	NA	NA	NA
WP_016210010.1|1107743_1107920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780418.1|1108095_1108479_+	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_075273518.1|1108554_1108848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210016.1|1109014_1109974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210020.1|1110704_1110860_+	putative membrane protein	NA	NA	NA	NA	NA
WP_016210025.1|1111124_1112495_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_052104723.1|1112487_1113441_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036779556.1|1113421_1116226_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.0	3.1e-57
WP_016210027.1|1116305_1116902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|1117291_1118047_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155047191.1|1118444_1119176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210021.1|1119436_1120762_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210023.1|1120758_1122816_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210007.1|1122793_1123366_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126616.1|1123421_1123781_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210019.1|1123845_1124880_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_122941592.1|1125137_1125989_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|1126083_1127067_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_016210013.1|1127223_1128891_+	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
WP_155047190.1|1129829_1130147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556556.1|1130165_1130741_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1130686_1131052_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300287.1|1131073_1131403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047175.1|1131811_1133134_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_032126362.1|1133664_1134030_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1133975_1134551_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047189.1|1134610_1134784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047265.1|1135073_1135667_+	reverse transcriptase	NA	A0A0N7AE80	Bacillus_phage	28.9	4.0e-07
WP_105962623.1|1135675_1136829_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_054300290.1|1136962_1137220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007015.1|1137321_1137747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1137958_1138216_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|1138215_1139223_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300292.1|1139477_1140479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007069.1|1140934_1141087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007016.1|1141059_1141233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047188.1|1141222_1141387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300293.1|1141443_1141809_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300294.1|1142080_1143142_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211279.1|1143885_1146354_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_016211277.1|1146367_1147336_+	homoserine kinase	NA	NA	NA	NA	NA
WP_016211278.1|1147322_1148582_+	threonine synthase	NA	NA	NA	NA	NA
WP_129556646.1|1148633_1150019_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_036781047.1|1151336_1152194_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_036778145.1|1152806_1153928_+	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	8.7e-11
WP_016211172.1|1153977_1155174_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_080664856.1|1155362_1156427_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_051307350.1|1156410_1157157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778066.1|1157146_1157875_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211168.1|1157871_1158531_+	wbqC-like family protein	NA	NA	NA	NA	NA
WP_016211169.1|1158514_1159462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|1159461_1159977_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778065.1|1160019_1161453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210393.1|1161546_1163748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210398.1|1164236_1165829_+	B-type flagellin	NA	NA	NA	NA	NA
WP_032126669.1|1166053_1167631_+	B-type flagellin	NA	NA	NA	NA	NA
WP_122940572.1|1167742_1168168_+	flaG family protein	NA	NA	NA	NA	NA
WP_016210394.1|1168278_1169664_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_032126670.1|1169689_1170127_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210390.1|1170131_1170473_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_016210399.1|1170487_1172479_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210388.1|1172504_1173179_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210397.1|1173175_1175350_-	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_016210772.1|1176558_1178112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|1178195_1179005_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_033923762.1|1179132_1179366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210769.1|1179666_1181169_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_016210773.1|1181472_1184166_+	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210771.1|1184162_1187564_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_054300162.1|1187655_1188738_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300297.1|1188800_1189868_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212246.1|1190803_1191460_+	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300162.1|1191563_1192646_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300271.1|1192985_1193960_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212247.1|1194587_1195343_-	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_036779544.1|1195709_1196717_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1196716_1196974_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047187.1|1197337_1198312_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_075273524.1|1198352_1199318_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212058.1|1199473_1201024_+	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_054300299.1|1203225_1204308_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046981.1|1204397_1204574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1205572_1206436_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155047186.1|1206465_1207695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047185.1|1207698_1208585_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	1249257	1425138	3153564	tRNA,transposase,integrase	Staphylococcus_phage(17.65%)	153	1281511:1281570	1357600:1357963
WP_054300304.1|1249257_1249536_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047180.1|1249588_1249792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776195.1|1250434_1251682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923708.1|1252093_1252969_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211947.1|1253083_1254229_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_129556540.1|1254221_1254617_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211946.1|1254835_1255591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212551.1|1256946_1257441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556643.1|1257898_1259263_-	histidine kinase	NA	NA	NA	NA	NA
WP_016211983.1|1259358_1260018_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_155047179.1|1260265_1260610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047178.1|1260678_1261407_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.5e-43
WP_155047177.1|1261453_1261600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300189.1|1261656_1262022_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036779232.1|1262316_1263876_-	APC family permease	NA	NA	NA	NA	NA
WP_016211215.1|1264236_1266207_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211211.1|1266398_1267478_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_052104715.1|1267526_1267733_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211210.1|1267739_1269221_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016211214.1|1269323_1269887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|1271648_1272908_+	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211940.1|1273028_1273361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1273474_1274449_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_155047176.1|1274593_1274746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300312.1|1274963_1275986_+	YHYH protein	NA	NA	NA	NA	NA
WP_036778055.1|1275993_1277676_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.7e-32
WP_016211344.1|1277836_1278655_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211347.1|1278868_1279852_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211340.1|1279844_1280066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211346.1|1280093_1280735_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_033923708.1|1280978_1281854_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
1281511:1281570	attL	TACCTGAAATTGCTCAAGGTCTGACAGGTAAGATTATTGGTGATAAAGGTTACATTTCAC	NA	NA	NA	NA
WP_129556490.1|1284316_1285202_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1285206_1285494_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_036774554.1|1285546_1285825_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126998.1|1285923_1286271_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_032126997.1|1286592_1286832_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075273532.1|1287049_1287637_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300314.1|1287597_1287933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211315.1|1288120_1288765_-	porin family protein	NA	NA	NA	NA	NA
WP_016211316.1|1289099_1289750_-	porin family protein	NA	NA	NA	NA	NA
WP_016211319.1|1290282_1291335_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032126786.1|1291352_1294433_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_054300384.1|1294731_1295547_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047175.1|1295955_1297278_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_155047174.1|1298186_1298831_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.4	1.1e-39
WP_155047173.1|1298886_1299096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209615.1|1300448_1300955_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_016209623.1|1300971_1302471_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016209624.1|1302492_1303104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274867.1|1303100_1304273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777073.1|1304304_1306842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209626.1|1306873_1308766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273639.1|1309133_1309850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777070.1|1309852_1312726_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_016209636.1|1312726_1313131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209614.1|1313145_1314867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209633.1|1314866_1317815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209625.1|1317817_1319215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209630.1|1319228_1319969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209632.1|1319949_1320384_+	lipoprotein	NA	NA	NA	NA	NA
WP_016209618.1|1320428_1321058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209616.1|1321128_1322043_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_033923701.1|1322073_1325376_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_016209627.1|1325372_1327196_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_016209617.1|1327235_1327634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209621.1|1327754_1328759_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209619.1|1329191_1330640_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_036777066.1|1330726_1333783_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_081007073.1|1333765_1333936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046976.1|1334001_1334139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212485.1|1334435_1334969_-	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_032126753.1|1335765_1336230_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_016211466.1|1336299_1337820_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126752.1|1337907_1338510_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211464.1|1338506_1338854_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_016211465.1|1339004_1339988_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_122942160.1|1340615_1341596_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_052047087.1|1341756_1341975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047172.1|1342146_1343172_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300320.1|1344317_1344917_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300321.1|1345134_1345506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212346.1|1346300_1346447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1346680_1347544_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211748.1|1349025_1350630_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211752.1|1350645_1351791_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_075273313.1|1351867_1352206_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1352165_1352621_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212445.1|1352866_1353133_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155047171.1|1353207_1353771_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	39.9	3.2e-30
WP_155047170.1|1353975_1354257_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047169.1|1354291_1354900_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016212534.1|1355312_1355579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1356706_1357072_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1357017_1357593_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211725.1|1358108_1359023_+	hypothetical protein	NA	NA	NA	NA	NA
1357600:1357963	attR	TACCTGAAATTGCTCAAGGTCTGACAGGTAAGATTATTGGTGATAAAGGTTACATTTCACAAGATTTATTTAACAGGCTTTATGAAAAAGGACTGCAATTAATCAATAAAATTCGCAAGAATATGAAAAATAGGCTCATGCCTATCATCGATAAAATTTTACTCAGAAAACGTGGAATTATTGAAAGTGTATTTGATCAACTTAAAAACATCTCACAAATCGAGCACTCTAGGCATCGTAGTGTCAACAACTTTATGGTCAATATTCTTGCTGGATTAGCAGCCTACTGTCTTCAGGAGAAGAAGCCATCGCTTAATATCCAGCGTAATCTATTGACCAGCTGAGTTATATCGAACTCACGTTA	NA	NA	NA	NA
WP_054300322.1|1359061_1360996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211726.1|1361383_1361977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273534.1|1363608_1364490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049133.1|1364704_1364956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300326.1|1365057_1365522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046975.1|1365935_1366385_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_016212459.1|1366504_1366885_+	glycine-zipper containing OmpA-like membrane domain protein	NA	NA	NA	NA	NA
WP_054300328.1|1367022_1367799_-	class I SAM-dependent methyltransferase	NA	R4ZD91	Adoxophyes_honmai_entomopoxvirus	25.5	8.1e-16
WP_155047167.1|1367909_1369427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047166.1|1369476_1370538_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211456.1|1371159_1371738_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_122942091.1|1371765_1372161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211455.1|1372266_1373724_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_016211452.1|1373785_1375273_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211454.1|1376023_1376494_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|1378368_1378641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1378793_1379159_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1379104_1379680_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556641.1|1381762_1383025_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_016210751.1|1383112_1384918_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_016210752.1|1385401_1386199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210749.1|1386368_1386830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1387128_1389084_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1389765_1389951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212185.1|1390284_1391274_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016211834.1|1394647_1394962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307365.1|1395219_1395480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211836.1|1395499_1395988_+	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_155046972.1|1397511_1398102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047040.1|1398690_1399629_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155047165.1|1399654_1401220_-	amino acid permease	NA	NA	NA	NA	NA
WP_036778182.1|1401426_1402254_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_075273540.1|1402620_1403232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556527.1|1403416_1403677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047164.1|1404669_1405092_+	response regulator	NA	NA	NA	NA	NA
WP_036777256.1|1405514_1405715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104738.1|1406089_1406896_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210795.1|1407001_1407973_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210801.1|1407954_1408926_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155047264.1|1409248_1409608_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_054300271.1|1409647_1410622_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007028.1|1411037_1411493_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1411452_1411791_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211352.1|1411964_1412405_-	universal stress protein	NA	NA	NA	NA	NA
WP_032126362.1|1412871_1413237_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1413182_1413758_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211350.1|1414042_1414981_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211349.1|1415044_1417039_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_032127067.1|1417035_1417638_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_036779888.1|1417634_1417973_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_129556640.1|1418048_1419275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300339.1|1419832_1420804_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.2e-25
WP_016211856.1|1421019_1421205_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_016211855.1|1421331_1421799_+	bacterioferritin	NA	NA	NA	NA	NA
WP_016211857.1|1421795_1422674_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_032126602.1|1422924_1424232_+	MFS transporter	NA	NA	NA	NA	NA
WP_081007028.1|1424384_1424840_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1424799_1425138_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	1440753	1547020	3153564	tRNA,transposase	Staphylococcus_phage(14.81%)	101	NA	NA
WP_054300271.1|1440753_1441728_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047162.1|1441747_1442185_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|1442199_1442565_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210855.1|1442718_1443696_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016210849.1|1443813_1445262_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210847.1|1445290_1446295_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210851.1|1446317_1446989_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210850.1|1446973_1448227_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1448475_1449030_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210848.1|1449613_1450798_+	MFS transporter	NA	NA	NA	NA	NA
WP_051307341.1|1450964_1452563_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_155047161.1|1453256_1454228_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300343.1|1454263_1454491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|1454494_1455381_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007031.1|1455468_1455741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209794.1|1456475_1457099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776664.1|1457144_1459088_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1U9WQS3	Geobacillus_phage	23.9	1.1e-05
WP_016209788.1|1459209_1459962_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016209790.1|1460013_1460472_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_129556639.1|1460767_1461178_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209775.1|1461194_1461650_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_016209797.1|1461646_1462138_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_080664822.1|1462134_1462884_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_016209776.1|1462913_1463183_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_036776670.1|1463198_1463984_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_016209786.1|1463997_1465131_+	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_016209770.1|1465165_1467259_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_016209767.1|1467289_1468750_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_129556524.1|1468730_1469618_+	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_016209784.1|1469614_1470337_+	RNA polymerase sigma factor FliA	NA	A0A1B1P7V3	Bacillus_phage	24.1	2.7e-05
WP_017377132.1|1470423_1470807_+	response regulator	NA	NA	NA	NA	NA
WP_036776675.1|1470848_1471592_+	chemotaxis protein CheZ	NA	NA	NA	NA	NA
WP_036776682.1|1471604_1473629_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_051307317.1|1473690_1473984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209791.1|1474120_1474843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209771.1|1475007_1475730_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126436.1|1476436_1476892_+	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_016209793.1|1476907_1478356_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_016209795.1|1478396_1479152_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	1.3e-10
WP_080664823.1|1479132_1480533_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_016209796.1|1480556_1481774_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.0	2.9e-92
WP_016209778.1|1481804_1482179_+	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_016209772.1|1482197_1482749_+	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_054300271.1|1484030_1485005_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1485102_1486164_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1486718_1487693_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212424.1|1488036_1488315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|1488307_1488580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1488697_1489780_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300346.1|1489926_1490802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126678.1|1490812_1491823_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_016211554.1|1492149_1492776_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_016211557.1|1492821_1494051_+	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_032126677.1|1494245_1494809_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211555.1|1494883_1496242_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_016211664.1|1496778_1497507_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211666.1|1497879_1500699_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211669.1|1500853_1501204_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1502028_1503003_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556522.1|1504313_1505546_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211405.1|1505752_1507525_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_016211403.1|1507660_1508704_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_036777261.1|1508717_1509461_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_032126682.1|1509568_1509895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144019306.1|1509956_1510136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|1510499_1511198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047159.1|1511619_1513011_+	protein kinase	NA	NA	NA	NA	NA
WP_016211733.1|1513066_1513891_-	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_054300173.1|1514505_1515567_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046730.1|1515785_1515926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1516193_1516841_-	LysE family translocator	NA	NA	NA	NA	NA
WP_016212267.1|1517121_1517481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|1517647_1518103_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1518062_1518401_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047158.1|1518536_1520810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126823.1|1520798_1521521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104609.1|1521631_1522264_+	MarC family protein	NA	NA	NA	NA	NA
WP_098082850.1|1522299_1522476_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_016211481.1|1522550_1523693_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_032126825.1|1523925_1525239_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.5e-51
WP_054300349.1|1525790_1527515_+	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	25.6	1.7e-05
WP_155046942.1|1528575_1529461_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046942.1|1529625_1530511_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556521.1|1531045_1531234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1531184_1532338_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047157.1|1532402_1532807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047156.1|1532978_1533602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211631.1|1533860_1534667_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_054300351.1|1534922_1535744_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211632.1|1535779_1536634_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_081007023.1|1537329_1537986_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1538069_1538435_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300181.1|1538491_1538773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|1538776_1538956_+	DDE endonuclease	NA	NA	NA	NA	NA
WP_016210103.1|1539308_1540667_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_016210117.1|1540948_1541308_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210111.1|1541728_1543363_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_017377579.1|1543369_1544206_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210099.1|1544227_1545505_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_016210105.1|1545588_1545909_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210106.1|1545928_1547020_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	1565418	1610331	3153564	transposase,integrase,protease	Staphylococcus_phage(45.45%)	49	1565323:1565382	1593094:1593182
1565323:1565382	attL	GGTAACCCTCCCTTAAAATAGTACAAGTGATAAGTGGAATCTTCTGTTAAATTAACTTAG	NA	NA	NA	NA
WP_054300353.1|1565418_1565646_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046967.1|1565696_1566311_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	40.1	1.5e-33
WP_054300271.1|1566449_1567424_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047154.1|1567496_1567877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1567837_1568203_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1568148_1568724_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300355.1|1568713_1568899_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211563.1|1569109_1569271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211564.1|1569303_1570179_-	ParA family protein	NA	NA	NA	NA	NA
WP_052104693.1|1570344_1574211_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_080728343.1|1574292_1574433_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_081007034.1|1574414_1574699_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_155064791.1|1574984_1576382_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_016211991.1|1577290_1578196_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126537.1|1578436_1578622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211994.1|1578658_1579195_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_155047152.1|1579397_1580120_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1580159_1581134_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047151.1|1581130_1581670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047150.1|1581719_1582946_+	DUF4131 domain-containing protein	NA	NA	NA	NA	NA
WP_155047149.1|1582940_1583156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|1583179_1584154_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016212012.1|1584197_1584875_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016212013.1|1584890_1585274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212011.1|1585495_1586617_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_054300357.1|1586850_1587726_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155065715.1|1588008_1589121_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075273327.1|1589124_1589700_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1589645_1590011_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273551.1|1590188_1590491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556638.1|1590490_1591171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377865.1|1592515_1592800_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664876.1|1593158_1595021_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
1593094:1593182	attR	CTAAGTTAATTTAACAGAAGATTCCACTTATCACTTGTACTATTTTAAGGGAGGGTTACCGATGGTTATTTCACTAGATGAATTTTATT	NA	NA	NA	NA
WP_054300359.1|1595245_1595818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047148.1|1596176_1597214_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047147.1|1597743_1598718_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_054300361.1|1598871_1599168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377353.1|1599145_1599811_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1599850_1600825_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211144.1|1601381_1602011_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_036779218.1|1601994_1602417_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211145.1|1602423_1604163_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211153.1|1604163_1605228_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1605231_1605585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1605697_1606654_+	ferrochelatase	NA	NA	NA	NA	NA
WP_016211151.1|1606663_1606975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1606990_1607560_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211148.1|1607823_1609152_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|1609356_1610331_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 16
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	1619219	1666623	3153564	tRNA,transposase,integrase	Staphylococcus_phage(25.0%)	43	1609266:1609325	1652091:1653192
1609266:1609325	attL	GCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTC	NA	NA	NA	NA
WP_129556637.1|1619219_1619999_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016212589.1|1620473_1620911_-	MFS transporter	NA	NA	NA	NA	NA
WP_155047262.1|1621299_1621416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300363.1|1621807_1622155_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047145.1|1622100_1622676_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273553.1|1622665_1623592_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300364.1|1623765_1624644_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155064793.1|1624899_1625070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126267.1|1625063_1625306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211330.1|1625653_1626754_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_098082827.1|1626928_1628230_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.9	4.1e-28
WP_052104656.1|1628306_1628810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126265.1|1629133_1630051_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016211336.1|1630116_1630731_-	chorismate mutase	NA	NA	NA	NA	NA
WP_016211334.1|1630779_1630968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210322.1|1631585_1632482_+	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016210320.1|1632618_1633692_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_054300366.1|1633841_1634255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300568.1|1634275_1634986_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.3	4.1e-38
WP_129556511.1|1635168_1636605_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210321.1|1636801_1637770_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_016210325.1|1640440_1641817_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210326.1|1641970_1643269_-	ankyrin repeats family protein	NA	NA	NA	NA	NA
WP_036778577.1|1643608_1644892_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_016210333.1|1644965_1645595_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_016210330.1|1645798_1646182_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210332.1|1646279_1647023_+	ribonuclease T2 family protein	NA	NA	NA	NA	NA
WP_032126608.1|1647153_1647690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212498.1|1647964_1648648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|1649401_1650376_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_155047144.1|1650411_1651737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1652181_1653156_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211804.1|1653538_1654924_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
1652091:1653192	attR	GCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTCTCTAGTTCGCCTTTTGACTTAGAGGGTAGAGATGGTTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGGTTATCAGAGGGAGACTCGCTCAGATCAATTGCTAGAGCACTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
WP_081007037.1|1654930_1656469_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211806.1|1656511_1657237_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_032126804.1|1657401_1658277_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032126790.1|1658436_1659342_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_032126803.1|1659575_1660808_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_016211764.1|1661008_1661830_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211767.1|1662668_1663478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211289.1|1665094_1665367_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211286.1|1665478_1665826_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_036777656.1|1665843_1666623_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 17
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	1692684	1737030	3153564	tRNA,transposase,protease	Staphylococcus_phage(22.22%)	39	NA	NA
WP_054300173.1|1692684_1693746_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046721.1|1693926_1694094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1694265_1695240_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300373.1|1695236_1696094_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209842.1|1696821_1697211_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209834.1|1697387_1698146_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209829.1|1698142_1700542_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209839.1|1701921_1703220_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209838.1|1703417_1704311_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209836.1|1704310_1705525_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_032126639.1|1705544_1706831_-	GTPase HflX	NA	NA	NA	NA	NA
WP_016209846.1|1706846_1707101_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_036777393.1|1707336_1708704_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209826.1|1709034_1710057_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_155064795.1|1710885_1712343_+	amino acid permease	NA	NA	NA	NA	NA
WP_054300271.1|1712582_1713557_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556633.1|1713665_1714562_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209827.1|1714880_1716440_+	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_016209841.1|1716515_1716710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209831.1|1716929_1717628_+	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209832.1|1717906_1718170_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_036777412.1|1718476_1721071_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209835.1|1721067_1721550_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209844.1|1721527_1722568_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209840.1|1722740_1723226_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_032126641.1|1723333_1725904_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_032126642.1|1725939_1726401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049837.1|1726470_1726662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211648.1|1727880_1728420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211650.1|1729367_1730852_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211651.1|1730976_1732512_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032126362.1|1732745_1733111_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047140.1|1733056_1733641_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047139.1|1733664_1734069_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047138.1|1734044_1734527_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728346.1|1734544_1734877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046723.1|1735784_1735940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210928.1|1736098_1736404_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_075273327.1|1736454_1737030_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	1758450	1813976	3153564	tRNA,transposase	Staphylococcus_phage(15.38%)	55	NA	NA
WP_075273298.1|1758450_1759026_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046962.1|1759029_1759476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|1760127_1760628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|1761043_1761397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211831.1|1761697_1763425_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_081007040.1|1763562_1764219_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016210510.1|1764249_1764978_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_016210506.1|1764970_1766209_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210512.1|1766344_1767382_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210515.1|1767435_1768338_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210514.1|1768446_1769700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|1769757_1773255_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_075273576.1|1773314_1774043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778516.1|1774170_1774719_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016210508.1|1775039_1776737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1776745_1777899_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_036781272.1|1778494_1778713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047136.1|1778805_1779237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|1779404_1779770_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047135.1|1779715_1780291_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211467.1|1780365_1780932_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_032126344.1|1780934_1782023_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032126343.1|1782143_1782956_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_054300379.1|1783086_1785072_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211470.1|1785131_1785785_-	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_155047134.1|1786551_1787574_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047133.1|1787845_1788820_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	2.6e-27
WP_016212421.1|1789570_1789753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377879.1|1790104_1790329_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155047132.1|1790473_1791136_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.6	5.3e-32
WP_032126637.1|1791252_1791546_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556508.1|1791607_1792051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047131.1|1792321_1792978_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047130.1|1793165_1793924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1793986_1795048_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211841.1|1795907_1796360_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211839.1|1796477_1797950_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211840.1|1798108_1798573_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211838.1|1799043_1799217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1799926_1800292_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1800237_1800813_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300250.1|1800802_1801462_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_032126143.1|1801561_1802833_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_016211422.1|1802921_1803392_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_051307357.1|1803414_1804008_-	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211417.1|1804144_1805194_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_016211415.1|1805217_1806141_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1806157_1806619_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211414.1|1806726_1807545_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_129556449.1|1807760_1808267_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1808281_1808647_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047129.1|1808850_1809507_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300382.1|1809777_1810200_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300383.1|1810470_1812951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126139.1|1813046_1813976_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 19
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	1888713	1994490	3153564	tRNA,transposase	uncultured_Mediterranean_phage(21.05%)	94	NA	NA
WP_054300173.1|1888713_1889775_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780082.1|1890318_1891224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212000.1|1891354_1892083_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016212002.1|1892202_1892481_+	DNA-J related family protein	NA	NA	NA	NA	NA
WP_129556478.1|1892484_1893371_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047008.1|1893428_1893743_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016210889.1|1893760_1896607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210887.1|1897116_1898067_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210886.1|1898149_1898929_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_052104770.1|1898997_1899705_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210888.1|1899665_1899917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|1899939_1900236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|1900769_1901543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|1901575_1902172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300398.1|1902229_1903111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300399.1|1903452_1903719_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300400.1|1903863_1904106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|1904162_1904690_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107517381.1|1905355_1905550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1905763_1906117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211827.1|1906448_1907069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047122.1|1907332_1911424_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211770.1|1911623_1912757_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_016211771.1|1912770_1912959_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_054300276.1|1913251_1914226_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_075273594.1|1914265_1915636_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	4.2e-39
WP_054300404.1|1915708_1916602_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209948.1|1916710_1917628_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_036777569.1|1917679_1918435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209939.1|1918502_1919777_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_036777566.1|1919911_1920589_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_016209944.1|1920789_1922217_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209938.1|1922191_1922830_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209925.1|1923039_1923318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209935.1|1923551_1924496_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_036777561.1|1924517_1926386_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209930.1|1926406_1926760_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_036777579.1|1926798_1927914_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.9	4.8e-94
WP_016209932.1|1928096_1929137_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209945.1|1929139_1930174_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209926.1|1930170_1931232_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209931.1|1931343_1932816_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_052104625.1|1932968_1933412_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209940.1|1933487_1936259_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_036777555.1|1936415_1937645_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1937671_1938334_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_054300405.1|1938855_1939356_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047121.1|1939457_1940561_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	9.5e-10
WP_075274669.1|1940765_1941068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300286.1|1941452_1941917_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105962623.1|1942080_1943233_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047120.1|1943242_1943587_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047119.1|1943871_1945194_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_081007042.1|1945602_1946418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300406.1|1948971_1951707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1952007_1953069_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126856.1|1953129_1953471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1953775_1954929_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_032126362.1|1955563_1955929_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1955874_1956450_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212005.1|1956788_1958549_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_016210592.1|1958938_1959595_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016210586.1|1959607_1961113_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210593.1|1961134_1961665_-	colicin V production protein	NA	NA	NA	NA	NA
WP_016210590.1|1961744_1963007_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210587.1|1963181_1964042_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_032126176.1|1964143_1964926_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210588.1|1965016_1966342_-	fimV domain protein	NA	NA	NA	NA	NA
WP_016210595.1|1966709_1967888_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210594.1|1968064_1968718_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_036778626.1|1968853_1970794_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_129556498.1|1970790_1971399_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054300271.1|1971578_1972553_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080728317.1|1972743_1976109_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211391.1|1976175_1976751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779996.1|1976762_1978319_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_036779999.1|1978338_1978770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780001.1|1978756_1979020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049121.1|1979376_1979727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212466.1|1979952_1980678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212252.1|1980992_1981151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047118.1|1981188_1982631_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_075273327.1|1982620_1983196_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1983141_1983507_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274672.1|1983544_1984138_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211114.1|1984503_1987434_-	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_016211115.1|1987566_1989519_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211112.1|1989711_1990359_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211113.1|1990414_1991740_+	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_032126179.1|1991769_1992021_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_080664854.1|1991978_1992560_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_054300408.1|1992896_1993553_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_032126362.1|1993603_1993969_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1993914_1994490_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	2024224	2133605	3153564	tRNA,transposase	Acinetobacter_phage(18.18%)	112	NA	NA
WP_129556499.1|2024224_2025378_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211588.1|2025545_2026247_-	cyclase family protein	NA	NA	NA	NA	NA
WP_032126329.1|2026322_2026952_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_129556496.1|2027137_2028376_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_036778365.1|2028650_2029313_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_016211589.1|2029302_2030535_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_032126328.1|2030663_2030915_+	VOC family protein	NA	NA	NA	NA	NA
WP_144019383.1|2031269_2031488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|2031895_2032189_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_032126540.1|2032419_2033283_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046995.1|2033416_2034302_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126332.1|2034949_2036149_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_016211366.1|2036401_2036689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779263.1|2036744_2038754_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_032126330.1|2039096_2040056_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_016211367.1|2040203_2040986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273303.1|2041141_2041858_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_016210281.1|2041871_2043263_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_016210270.1|2043304_2046292_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210277.1|2046361_2047195_-	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210279.1|2047248_2048415_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210272.1|2048402_2049113_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210283.1|2049152_2049938_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_129556492.1|2049965_2050709_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|2050806_2053002_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_016210271.1|2053078_2053762_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_032126334.1|2053772_2054204_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_036778186.1|2054243_2054642_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_016210273.1|2055014_2055722_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210275.1|2055786_2056089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210276.1|2056144_2056621_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210284.1|2056675_2057197_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210280.1|2057278_2058373_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_075273327.1|2058784_2059360_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2059305_2059671_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047116.1|2059631_2059883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300415.1|2060472_2061174_+	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	33.0	1.6e-07
WP_032126500.1|2061307_2062024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211118.1|2062160_2063408_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126499.1|2063786_2064398_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211122.1|2064494_2065361_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|2065364_2066126_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_036779309.1|2066289_2067195_+	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211125.1|2067417_2068248_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211126.1|2068417_2068807_+	lipoprotein	NA	NA	NA	NA	NA
WP_032126498.1|2068939_2069500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|2069561_2069927_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2069941_2070448_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047115.1|2070444_2070849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212585.1|2071143_2071464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2071575_2072550_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273327.1|2072919_2073495_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2073440_2073806_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274673.1|2073766_2074765_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780900.1|2074935_2075589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047081.1|2075639_2076077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212519.1|2076347_2076728_-	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_054300173.1|2076802_2077864_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212611.1|2077911_2078232_-	histidine kinase	NA	NA	NA	NA	NA
WP_081377357.1|2078715_2079117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155065718.1|2079172_2080003_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_155047114.1|2080525_2080780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211088.1|2080899_2081862_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211087.1|2082069_2083065_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_016211081.1|2083092_2084028_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|2084068_2084530_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080664852.1|2084508_2085552_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_155047113.1|2085564_2087151_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_081007043.1|2087110_2088853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|2089576_2091613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046717.1|2093869_2094019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274676.1|2094177_2094375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777508.1|2094449_2094722_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_155047112.1|2094798_2095338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|2095617_2096503_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047111.1|2096507_2097836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047110.1|2097952_2099014_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126869.1|2098991_2099231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2099751_2100327_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2100272_2100638_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047109.1|2100699_2101113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556488.1|2102293_2103144_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275079.1|2103292_2104354_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126801.1|2104401_2104911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274679.1|2105579_2106641_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212218.1|2108091_2108442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285943.1|2108586_2109423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778728.1|2109476_2110769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104686.1|2111004_2113761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046955.1|2114916_2115096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|2115337_2116039_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|2116299_2116506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941967.1|2116735_2117041_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126840.1|2117219_2119217_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2119200_2120247_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016212098.1|2120967_2121819_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016212100.1|2121819_2122740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212654.1|2123150_2123435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|2123426_2123882_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2123841_2124180_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212093.1|2124392_2125322_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_129556559.1|2125478_2125907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047107.1|2125987_2126440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2126465_2127371_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|2127567_2128176_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155047106.1|2128216_2129103_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556499.1|2129299_2130452_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211971.1|2130658_2131270_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032126649.1|2131290_2132487_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_017377024.1|2132583_2132724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211968.1|2132736_2133141_-	SufE family protein	NA	NA	NA	NA	NA
WP_075273313.1|2133266_2133605_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	2137621	2185284	3153564	tRNA,transposase,protease	Salinibacter_virus(16.67%)	47	NA	NA
WP_081007045.1|2137621_2138251_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300433.1|2138550_2138781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777096.1|2139353_2140694_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209885.1|2140756_2141470_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016209894.1|2141638_2142130_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209887.1|2142273_2142765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209877.1|2142967_2143858_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_080664826.1|2144057_2144657_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_052104598.1|2144737_2145676_-	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	29.6	1.9e-14
WP_036777110.1|2145727_2146822_-	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_052104599.1|2146946_2148263_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	40.1	3.2e-65
WP_016209893.1|2148605_2153495_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_016209881.1|2153587_2153890_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_016209876.1|2154000_2155923_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_016209888.1|2155944_2157240_+	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_016209898.1|2157236_2158847_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_052104600.1|2158953_2159847_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_016209884.1|2159956_2160580_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036777115.1|2160656_2160857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209891.1|2160998_2161697_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016209896.1|2161843_2162413_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_122940402.1|2162727_2163351_-	porin family protein	NA	NA	NA	NA	NA
WP_032126745.1|2163559_2164162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2164233_2165119_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|2165342_2166229_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273603.1|2166308_2166485_+	phosphatase	NA	NA	NA	NA	NA
WP_016212526.1|2166608_2167142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047105.1|2167312_2168194_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.1	3.4e-50
WP_016212445.1|2168436_2168703_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126686.1|2168761_2169346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274681.1|2169896_2170772_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063519.1|2170820_2171237_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210465.1|2171523_2172366_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_016210463.1|2172416_2172764_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210471.1|2172954_2173842_+	ROK family protein	NA	NA	NA	NA	NA
WP_016210467.1|2173956_2174559_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210468.1|2174555_2175275_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_052104601.1|2175343_2177056_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_036777098.1|2177203_2179141_+	AsmA family protein	NA	NA	NA	NA	NA
WP_032126596.1|2179249_2180302_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_016210461.1|2180301_2180577_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016210458.1|2180657_2181206_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_051307322.1|2181479_2181659_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_155047104.1|2181662_2181944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2182000_2182366_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047103.1|2182481_2183603_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_155049817.1|2184397_2185284_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	2209466	2252636	3153564	transposase	Staphylococcus_phage(41.67%)	44	NA	NA
WP_075273327.1|2209466_2210042_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2209987_2210353_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155065722.1|2210485_2211511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2211879_2212962_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_155047098.1|2212977_2214270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047097.1|2214345_2215029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211538.1|2215723_2216647_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_054300443.1|2216885_2217164_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|2217216_2217465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300444.1|2217422_2218484_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212179.1|2218904_2219057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212177.1|2219479_2219653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212174.1|2219729_2219987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781320.1|2222205_2222433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|2222419_2222746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|2222747_2223179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2223707_2224769_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300445.1|2224863_2225415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|2225684_2226704_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|2226690_2227113_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|2227114_2227588_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_052133275.1|2227703_2228327_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210836.1|2228356_2229031_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|2229036_2230185_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|2230181_2230643_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210830.1|2230718_2231969_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_016210824.1|2232095_2233775_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|2233884_2234751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2235653_2236628_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_036781250.1|2236723_2237509_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307345.1|2237652_2238339_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211002.1|2238372_2238771_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|2238934_2239240_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_016210998.1|2239317_2239572_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|2239725_2241387_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|2241446_2242130_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|2242129_2243218_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016211004.1|2243266_2245903_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300173.1|2246315_2247377_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300448.1|2247566_2249936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2249979_2250954_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300449.1|2250973_2251753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|2251882_2252221_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2252180_2252636_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	2256381	2291854	3153564	tRNA,transposase	Halovirus(20.0%)	36	NA	NA
WP_075273327.1|2256381_2256957_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047096.1|2256988_2257261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047095.1|2257317_2257458_+	phosphatase	NA	NA	NA	NA	NA
WP_155047094.1|2257602_2258070_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211503.1|2258220_2258676_-	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_016211508.1|2258730_2259075_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211502.1|2259104_2260148_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_016211504.1|2260775_2261060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2261049_2261936_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210192.1|2262248_2262767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210193.1|2263138_2263300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210194.1|2263356_2263704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036778869.1|2263738_2264401_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_036778872.1|2264444_2265050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210201.1|2265279_2266335_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	3.4e-49
WP_016210187.1|2266338_2269524_+	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_016210205.1|2269604_2270561_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.6	5.3e-49
WP_016210206.1|2270609_2271146_+	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	38.4	8.4e-20
WP_016210199.1|2271142_2271904_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_036778866.1|2272009_2274598_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.9	3.3e-122
WP_032126472.1|2275060_2275711_-	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_016210190.1|2275930_2276806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210195.1|2276996_2277398_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_016210198.1|2277414_2277966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210188.1|2278277_2278964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779341.1|2278964_2281175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210196.1|2281528_2281882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300452.1|2281839_2282901_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274685.1|2282950_2283574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556449.1|2283563_2284070_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300455.1|2284084_2284450_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273329.1|2284410_2285712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2285759_2286821_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556651.1|2287008_2288217_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300173.1|2288458_2289520_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211428.1|2289790_2291854_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.8	3.8e-36
>prophage 24
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	2332124	2394467	3153564	tRNA,transposase	Planktothrix_phage(18.18%)	57	NA	NA
WP_129556571.1|2332124_2332835_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2332863_2333268_+	RidA family protein	NA	NA	NA	NA	NA
WP_036777168.1|2333292_2334252_-	response regulator	NA	NA	NA	NA	NA
WP_155049839.1|2334383_2334905_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126712.1|2335435_2335894_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209553.1|2336638_2337649_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	42.2	2.9e-58
WP_016209566.1|2338133_2339045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209545.1|2339370_2342865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209551.1|2342902_2343742_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.0	1.8e-45
WP_036777155.1|2343928_2344144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209547.1|2344192_2344768_-	ribonuclease HI	NA	V9M0C8	Vibrio_phage	46.6	1.3e-29
WP_016209540.1|2344764_2345103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209568.1|2345271_2346261_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.7	1.7e-18
WP_016209572.1|2346261_2347224_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-16
WP_054300271.1|2348179_2349154_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212612.1|2349291_2349525_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300455.1|2349618_2349984_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2349998_2350505_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212572.1|2350562_2350955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2351084_2351450_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300461.1|2351506_2351815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2351906_2352482_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2352427_2352793_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|2352945_2353218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126774.1|2353826_2354162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307356.1|2354321_2355854_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_016211407.1|2355886_2356726_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211411.1|2356722_2357220_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_036779082.1|2357223_2358216_-	AAA family ATPase	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_155047091.1|2358330_2359677_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_054300173.1|2359900_2360962_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212287.1|2361040_2362186_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_016211372.1|2367993_2368851_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016211371.1|2368837_2369761_-	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_036778204.1|2369957_2371349_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211369.1|2371395_2372439_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211370.1|2372481_2372925_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211374.1|2373057_2374248_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211373.1|2374302_2374449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|2374999_2375917_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_036794860.1|2376184_2376478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|2376554_2376749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300462.1|2377767_2378685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210876.1|2379150_2379993_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016210873.1|2380060_2380711_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210874.1|2380725_2381766_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210882.1|2381888_2382974_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210872.1|2383000_2384110_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210871.1|2384126_2384444_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210879.1|2384440_2384800_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_054300463.1|2384902_2387632_-	kinase	NA	NA	NA	NA	NA
WP_080664847.1|2388132_2389086_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_054300173.1|2389158_2390220_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212048.1|2390983_2391541_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_032126664.1|2391734_2392418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126663.1|2393136_2393379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|2393405_2394467_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	2484360	2567071	3153564	tRNA,transposase	Escherichia_phage(37.93%)	81	NA	NA
WP_054300202.1|2484360_2485089_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019244.1|2485178_2485790_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_036779399.1|2486146_2486401_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|2486499_2488284_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_036779389.1|2488372_2489092_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210951.1|2489274_2489481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779393.1|2489480_2489717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|2489729_2490107_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|2490613_2491432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779396.1|2491525_2491723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210946.1|2491817_2493203_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210945.1|2493329_2493920_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_155047083.1|2496111_2496840_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	4.3e-43
WP_016211816.1|2497908_2498262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|2498303_2499917_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_075274932.1|2500138_2500360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2500668_2501397_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211951.1|2502013_2503111_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|2503144_2504395_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_054300202.1|2504534_2505263_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212193.1|2505385_2505724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|2505791_2506178_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|2506174_2506420_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300475.1|2506828_2507557_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016211625.1|2508040_2508910_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_036779883.1|2508906_2510256_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.2	2.1e-75
WP_016211623.1|2510368_2512009_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_054300202.1|2512823_2513552_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300478.1|2513831_2515568_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_054300477.1|2516071_2516800_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016212214.1|2516958_2517459_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016212213.1|2517433_2517943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2518696_2519425_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300479.1|2519575_2520616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211653.1|2520813_2521839_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_155065724.1|2521946_2523152_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	7.1e-35
WP_016211655.1|2523411_2523825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|2523953_2524523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|2524526_2524859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300480.1|2524851_2525691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047081.1|2525778_2527326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|2527775_2528279_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|2528241_2528949_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|2529017_2529878_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_036777969.1|2529858_2530632_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|2530662_2531916_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|2531915_2532878_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|2532921_2533674_+	ComF family protein	NA	NA	NA	NA	NA
WP_036777977.1|2533727_2535608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210615.1|2535755_2536226_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|2536271_2536511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777984.1|2536529_2536979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|2537199_2538624_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_016210618.1|2538688_2539738_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|2540004_2540784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556587.1|2540835_2541738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047080.1|2541796_2542543_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	4.4e-19
WP_016210616.1|2542791_2545602_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_081007053.1|2545836_2546697_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_155047079.1|2547539_2547782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|2547936_2549089_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047078.1|2549275_2549611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2549703_2550003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2549992_2550157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047077.1|2550388_2551541_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	4.4e-58
WP_155047076.1|2551550_2551826_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212641.1|2552021_2552468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049820.1|2552432_2552888_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273369.1|2552996_2553812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047075.1|2553885_2554806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|2554817_2555546_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_080664881.1|2555635_2555842_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081007054.1|2556004_2557237_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	1.1e-27
WP_054300482.1|2557752_2559042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049821.1|2560200_2560389_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047219.1|2560435_2561164_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032127022.1|2561840_2564027_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_087910645.1|2564088_2565242_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274943.1|2565527_2566052_+	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_129556588.1|2566242_2566410_-	phosphatase	NA	NA	NA	NA	NA
WP_075274944.1|2566354_2567071_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
>prophage 26
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	2582412	2610599	3153564	tRNA,transposase,integrase,protease	Acinetobacter_phage(12.5%)	25	2579801:2579860	2597641:2597929
2579801:2579860	attL	ACGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTT	NA	NA	NA	NA
WP_155047267.1|2582412_2582622_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007057.1|2583949_2584366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|2584423_2585576_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_016212230.1|2585632_2587081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|2588614_2588803_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046946.1|2590204_2590480_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|2590482_2591085_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_016212522.1|2591181_2591436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|2591980_2593060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780431.1|2593378_2595097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2595140_2596046_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155049822.1|2596516_2596672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047221.1|2597063_2597543_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	42.0	1.7e-11
WP_155047222.1|2597651_2598326_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.8	2.2e-09
2597641:2597929	attR	AAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTT	NA	NA	NA	NA
WP_016210068.1|2599245_2599821_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_036778086.1|2599896_2600772_-	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_052104629.1|2601172_2602198_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047224.1|2602341_2602818_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778088.1|2602802_2603885_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.0e-20
WP_036777829.1|2604125_2604530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210073.1|2605242_2605974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210076.1|2606230_2607532_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210066.1|2607673_2608342_+|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_032126425.1|2608785_2609382_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210052.1|2609402_2610599_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
>prophage 27
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	2639815	2692275	3153564	tRNA,transposase	Microbacterium_phage(12.5%)	57	NA	NA
WP_054300282.1|2639815_2640280_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047228.1|2640336_2640819_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556590.1|2641673_2642069_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_032126312.1|2642065_2642860_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_036778479.1|2643038_2643764_-	D-Ala-D-Ala dipeptidase	NA	NA	NA	NA	NA
WP_016211759.1|2644009_2645197_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_016210935.1|2645773_2646316_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|2646312_2646999_-	acireductone synthase	NA	NA	NA	NA	NA
WP_036778484.1|2647002_2647614_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|2647660_2648680_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|2648781_2649576_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|2649613_2650420_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|2650498_2651548_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|2651745_2653005_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|2653051_2653729_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2653814_2654096_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016210940.1|2654187_2655375_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	6.4e-20
WP_016210820.1|2655611_2656553_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|2657056_2657281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|2657572_2658277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210823.1|2658747_2659386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|2659720_2660251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779158.1|2660247_2661780_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2661776_2662727_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2663147_2663780_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2664022_2664220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2664594_2664960_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2665016_2665181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2665170_2665470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2665517_2665946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300194.1|2666023_2666722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2666699_2667761_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126306.1|2667985_2668282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|2668386_2669031_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2669266_2669764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047229.1|2670973_2671435_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2671394_2671733_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036778253.1|2671790_2673329_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_098082804.1|2673440_2674539_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_016210987.1|2674776_2675976_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_016210981.1|2676005_2676644_+	ribonuclease T	NA	NA	NA	NA	NA
WP_016210983.1|2676659_2678843_-	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	1.1e-06
WP_032126304.1|2679080_2679425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300193.1|2680470_2680677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104666.1|2680841_2681300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212032.1|2681887_2683015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|2683138_2683801_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|2683892_2684138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211963.1|2685211_2685871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|2685972_2686623_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211964.1|2686735_2687056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2687114_2688089_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126299.1|2688339_2688561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047230.1|2688849_2689272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047231.1|2689272_2689806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300190.1|2690300_2691263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046995.1|2691389_2692275_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	2753154	2811187	3153564	tRNA,transposase,protease	Staphylococcus_phage(37.5%)	56	NA	NA
WP_054300271.1|2753154_2754129_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047235.1|2754148_2755135_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2755225_2755972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275004.1|2756096_2756960_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|2757203_2757566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273422.1|2757752_2758280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556595.1|2758424_2758841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|2760937_2761849_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|2761900_2762749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|2763193_2763904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556596.1|2763995_2764964_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|2764951_2765599_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_036779767.1|2765627_2766479_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|2766493_2767771_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|2767811_2768327_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_054300183.1|2768405_2769467_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|2769488_2770577_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_036777788.1|2770621_2772457_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2772499_2772970_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2773006_2773342_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080664840.1|2773354_2774071_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|2774007_2775024_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|2775020_2775500_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|2775583_2778064_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2778126_2778492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|2778830_2779169_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2779128_2779584_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2779598_2779889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777784.1|2779954_2781553_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2781683_2782019_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_036777781.1|2782046_2783711_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	5.4e-33
WP_016210581.1|2783707_2784352_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|2784351_2785095_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2785153_2785393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2785543_2786911_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|2786921_2787473_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126278.1|2787553_2788537_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|2788658_2790416_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126277.1|2790638_2791229_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_155049840.1|2791317_2791737_-	DksA protein	NA	NA	NA	NA	NA
WP_075273416.1|2791877_2792492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212327.1|2792552_2793338_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075273313.1|2793591_2793930_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007003.1|2793889_2794351_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2794723_2795698_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212084.1|2795979_2796996_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126534.1|2796995_2797511_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212085.1|2797552_2798026_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_052104637.1|2798081_2798618_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212310.1|2798647_2799103_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_155046996.1|2800876_2803390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046997.1|2804324_2806847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2807421_2808483_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2808509_2809085_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2809030_2809396_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_105962623.1|2810034_2811187_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 29
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	2936055	3000187	3153564	transposase	Staphylococcus_phage(16.67%)	53	NA	NA
WP_054300271.1|2936055_2937030_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211161.1|2937612_2938722_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|2938733_2939378_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|2939396_2940383_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|2940462_2941539_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|2941741_2942566_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|2942882_2943887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|2944095_2945061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047242.1|2945199_2946075_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2946371_2947424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049173.1|2947745_2948120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2948333_2948825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2948880_2950131_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2950233_2950452_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_036777591.1|2950909_2951764_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_016210728.1|2951818_2952289_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2952676_2954056_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2954083_2954542_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2954519_2955737_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2955928_2956165_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2956178_2956334_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2956414_2957377_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2957536_2958853_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2958862_2959531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2959893_2961708_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_054300166.1|2961825_2962614_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211543.1|2963194_2964946_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016211544.1|2964956_2965757_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.6	5.8e-33
WP_016211545.1|2965859_2966348_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.7	2.4e-29
WP_032126435.1|2966521_2966836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375799.1|2967856_2968201_+	DMT family protein	NA	NA	NA	NA	NA
WP_016210038.1|2973894_2974857_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.0	8.8e-20
WP_016210039.1|2975043_2976303_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|2976526_2976853_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_052104566.1|2977047_2977998_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_032126434.1|2978055_2980122_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_016210049.1|2980127_2981123_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_016210042.1|2981708_2983289_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|2983445_2984855_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_016210047.1|2984914_2986048_-	cation transporter	NA	NA	NA	NA	NA
WP_016210033.1|2986187_2987012_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_016210034.1|2987239_2987869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|2988205_2988577_-	isochorismatase	NA	NA	NA	NA	NA
WP_016210046.1|2988880_2989168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126431.1|2989319_2990168_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_016210037.1|2990295_2991336_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_155047244.1|2991408_2993346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300165.1|2993629_2994289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2994443_2995418_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|2995493_2996513_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556602.1|2996911_2997121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273820.1|2997995_2999078_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.8	1.2e-142
WP_054300161.1|2999125_3000187_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP039035	Piscirickettsia salmonis strain Psal-071 chromosome, complete genome	3153564	3008072	3121992	3153564	tRNA,transposase	Staphylococcus_phage(33.33%)	113	NA	NA
WP_155047053.1|3008072_3008958_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212222.1|3009434_3009908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|3009904_3010300_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|3011229_3011805_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|3011750_3012116_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036778680.1|3012380_3014711_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_129556603.1|3014831_3016847_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300160.1|3017030_3020423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|3020487_3020793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|3020983_3021163_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_155047245.1|3021166_3021355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047246.1|3021378_3022353_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	1.8e-28
WP_032126362.1|3022610_3022976_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047247.1|3023039_3023408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|3023411_3024298_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047248.1|3024361_3025048_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047249.1|3025300_3026401_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556605.1|3026795_3027905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|3028947_3029313_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047002.1|3029327_3029933_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036776867.1|3030303_3031701_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.8e-77
WP_051307313.1|3031820_3032768_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|3032764_3033280_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|3033266_3034466_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|3034462_3034786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|3034787_3036017_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|3036016_3037060_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|3037059_3037743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3037739_3040229_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3040245_3040500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3040500_3040857_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|3041636_3042800_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|3042819_3045927_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|3045928_3047434_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3047461_3047743_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3047891_3048233_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3048352_3050233_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_059372650.1|3050317_3051916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3051933_3053049_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|3053176_3054175_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_052104582.1|3054178_3054937_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3054938_3056138_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3056121_3056793_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3056814_3057591_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3057594_3058593_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3058594_3059173_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3059169_3060639_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3060682_3060970_-	trp operon repressor	NA	NA	NA	NA	NA
WP_155047250.1|3061170_3061767_+	EamA family transporter	NA	NA	NA	NA	NA
WP_054300152.1|3061793_3062159_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|3062215_3062371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273401.1|3062515_3062968_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047251.1|3063005_3063230_+	EamA family transporter	NA	NA	NA	NA	NA
WP_155047003.1|3064825_3065711_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3065897_3066119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047252.1|3066234_3066813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047253.1|3066957_3067152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3067210_3068185_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|3068238_3069300_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776841.1|3070027_3070567_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|3070651_3071188_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|3071839_3072142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|3072591_3072900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556607.1|3073508_3073958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|3074240_3074951_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|3075177_3075576_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_036778156.1|3076443_3077394_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3077393_3079472_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3079619_3080135_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3080143_3080707_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3080687_3081434_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3081573_3082026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|3082449_3083286_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3083282_3084179_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3084211_3085279_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3085297_3085666_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3085691_3087140_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3087149_3088529_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3088569_3089901_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|3089872_3090832_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3090924_3091428_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3091562_3092714_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3092710_3093190_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3093336_3095658_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3095602_3096229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3096233_3097133_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3097205_3097784_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3098084_3098342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556718.1|3098350_3099537_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_155046758.1|3100351_3100483_+	phosphatase	NA	NA	NA	NA	NA
WP_155046759.1|3100627_3100783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777721.1|3101110_3101884_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155047254.1|3102820_3102958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3103001_3103976_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3105070_3105409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007065.1|3105425_3106265_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_081007013.1|3106477_3106777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|3106766_3106931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|3106987_3107353_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3108657_3109353_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3109349_3110777_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3110802_3111066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3111138_3112113_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047005.1|3112171_3113022_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|3113059_3113404_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3113400_3114237_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3114237_3114579_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3114580_3115186_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3115182_3117177_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3117196_3118138_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_052104719.1|3118365_3119790_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|3120302_3121277_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3121335_3121992_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039036	Piscirickettsia salmonis strain Psal-071 plasmid unnamed1, complete sequence	168857	2012	166196	168857	integrase,head,tail,protease,capsid,transposase	Streptococcus_phage(19.7%)	178	118536:118595	152128:153372
WP_105962625.1|2012_2898_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.7	4.5e-10
WP_016212151.1|3500_4463_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|4486_4801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|4864_5839_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_033923686.1|5963_7013_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|7121_8162_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|8175_8805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|8895_9195_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_081377909.1|9191_9656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104769.1|10617_11541_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_105962623.1|12685_13838_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075274741.1|13907_14165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273822.1|14266_14767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|15211_16294_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212255.1|16480_16651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126838.1|16647_16851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212257.1|17187_17412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212260.1|17431_17704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|17861_18836_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_129556717.1|19490_20717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|21042_21879_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_016212398.1|22141_22603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047268.1|22769_23150_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|24238_24604_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|24549_25125_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_105962623.1|26108_27262_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273810.1|27282_27990_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	34.2	1.4e-11
WP_081007042.1|30149_30965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728342.1|31279_31783_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_105962174.1|31926_32091_+	phosphatase	NA	NA	NA	NA	NA
WP_155047269.1|32239_32635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273806.1|32896_33460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|33565_34021_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_075273804.1|33980_34319_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377694.1|34403_35132_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_016212413.1|35465_35894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923775.1|35941_36682_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	4.6e-08
WP_075273798.1|37082_37307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307367.1|37415_37940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047270.1|38060_38207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047297.1|38351_38498_-	phosphatase	NA	NA	NA	NA	NA
WP_032126138.1|39706_39970_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_016211871.1|40535_40871_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_129556699.1|40864_41065_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_054300590.1|41372_41597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|42213_43239_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273790.1|43783_44086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372613.1|44075_44702_-	hypothetical protein	NA	A0A222ZGQ4	Arthrobacter_phage	33.7	1.8e-21
WP_016212412.1|45002_45167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|45159_45609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|45856_46030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212499.1|46234_46609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|47607_48760_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_075273786.1|48769_49168_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211913.1|49600_50722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|51047_51320_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_032126795.1|51323_51584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211912.1|51856_52447_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
WP_129556698.1|52536_53238_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_054300249.1|53351_53717_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|53731_54238_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	25.5	1.0e-06
WP_155047271.1|54241_55359_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	3.6e-57
WP_051307374.1|55473_55950_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_016212298.1|56190_56517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|57183_58209_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047272.1|58418_59147_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_054300594.1|59509_60535_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047273.1|60665_60803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046942.1|60941_61828_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.8	2.6e-10
WP_155047274.1|61912_62119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377350.1|62458_63274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211897.1|63667_64072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|64072_64819_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211895.1|65327_66386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126360.1|66508_67243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211773.1|67829_68504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211775.1|68605_68974_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_016211776.1|69141_70479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556697.1|70961_71354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|71738_72644_-|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
WP_016210664.1|72941_73364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210651.1|73363_73714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210658.1|73710_74106_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210667.1|74098_74422_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210663.1|74418_74730_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	4.3e-08
WP_016210655.1|75048_75645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556716.1|75658_75949_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
WP_052047108.1|76082_76481_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047275.1|76536_77034_-	DNA polymerase	NA	NA	NA	NA	NA
WP_155047276.1|77030_77810_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	31.7	1.8e-18
WP_129556718.1|77838_79024_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_081377350.1|79557_80373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047277.1|80437_81046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211936.1|81780_82803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047278.1|83292_83694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|83811_84837_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046767.1|85411_85573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047048.1|85572_86073_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273747.1|86334_86925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|86987_87281_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_155049832.1|87363_88239_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	3.7e-57
WP_052104629.1|88356_89382_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047281.1|89608_89938_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.8	5.5e-06
WP_155047018.1|90005_90809_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.9e-55
WP_075274752.1|90844_91144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|91140_91716_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|91661_92027_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212061.1|92931_94974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|95743_95944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047246.1|96084_97059_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.0	1.9e-25
WP_016212579.1|98555_98753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|99352_100327_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016212456.1|100370_100658_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_036779532.1|100654_101056_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_075273881.1|101065_103252_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.2	9.2e-73
WP_016212404.1|103372_103606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273857.1|104382_105117_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	8.4e-39
WP_129556710.1|105270_105741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556709.1|105821_105911_-	DUF1891 domain-containing protein	NA	NA	NA	NA	NA
WP_052047129.1|106122_107706_-	protein kinase	NA	NA	NA	NA	NA
WP_075274745.1|107988_108717_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	1.2e-37
WP_016212365.1|109429_109672_+	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_036781349.1|109673_110000_+	potassium ABC transporter ATPase	NA	A9D9Y1	Lactobacillus_prophage	36.6	1.1e-11
WP_054300202.1|110115_110844_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212152.1|111313_111697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|112003_112381_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_155047283.1|112545_112878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|112830_112983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377351.1|113066_113846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047298.1|114375_114561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212019.1|114947_115643_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_105962690.1|116111_116387_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|116383_116629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273839.1|116658_116922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212014.1|117289_117703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|117800_118529_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
118536:118595	attL	TGATCAGGCTACCCTATTCCGGACAAATAAATTACAATAATCCGAGCCGGAGGAATCACA	NA	NA	NA	NA
WP_105962623.1|118595_119748_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047284.1|120377_121406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|121685_122839_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273826.1|122798_123926_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	30.3	1.9e-18
WP_155047013.1|124146_124293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377350.1|124622_125438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780064.1|125683_126274_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	38.3	2.0e-22
WP_016211879.1|127228_128248_+	ParA family protein	NA	NA	NA	NA	NA
WP_075274742.1|128260_129142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|129171_129900_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|130103_132680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|132796_133774_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155047285.1|133792_134050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774631.1|135183_135648_+	hypothetical protein	NA	H6WFS7	Cyanophage	38.2	2.9e-21
WP_080963647.1|135986_136157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|137827_138556_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155047299.1|138739_140098_-	DEAD/DEAH box helicase	NA	D2J050	Enterococcus_phage	50.5	2.6e-126
WP_155047286.1|140187_140754_-	helix-turn-helix domain-containing protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	35.0	1.4e-20
WP_017377658.1|140757_141444_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|141691_142420_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155049831.1|142449_142989_-	helix-turn-helix domain-containing protein	NA	W5R8L2	Staphylococcus_phage	34.9	1.0e-04
WP_032126239.1|143570_143843_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049830.1|143917_144499_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.6	4.2e-33
WP_155047291.1|146046_148077_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|148211_149189_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155047292.1|149266_150184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|150973_152127_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273751.1|152476_154207_-	PLD-like domain protein	NA	NA	NA	NA	NA
152128:153372	attR	TGTGATTCCTCCGGCTCGGATTATTGTAATTTATTTGTCCGGAATAGGGTAGCCTGATCACTATTTCTTTGAGATCACGGTAAGATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATGATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTCTACCCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCCAACTAGAGAGTTTATCTGTATGGATATGAACTCTCTACTCGGTGTTGCACTTCATGTGACGGAGGGCGAAGACTATATGCCTCAGAAGTTATTAATTTTGTTTGCACAGATCAGGTATATATTCTGTTCTAGATGAATATTTCCAAAGAGGGCGCCAGAAACTATTTCTAATAATGTTAGATGCTTTCTTGCTATTAATGATATGACCATAGTTTTGTAATCCTGATGGGTAAAAGTTTTGTGATCCTACATAAAACATCCCTTTGTCTACCATCATAAATTTATAATGGCCTGTTATTTTTTCATTATCAGTCCATAAGTCATCATATTCATTGAACCTAATTGTAGAAATATGCAATTTATTGCATAGTTTTAAATTAATAGTATCTTCTTTTAATGCTGGATACATTGCCATCGCTTCACTTTTTATTTTACTCCATACTTCTTCATCGGTGGCTAAAGATAAATAACCTGATTCCATCATAGTTGCATCACTGTAAGGAGATTGGACAATATATACATGGCCTGCTTCCATGAGAAGTTTAGCTAGGGCACTAATAAGGTTAGTGTGTTGTTCCTTTGTAGTATCATAAGGCCAAGTATTAAAGTGTGCTTTAAGGCTCTGTTGTGCTATATAAATCCTTTTTTTTGCTGAAGTTAATAACCGATACAAAGCATAGTCTGAATTATTATTATTTTTAGCTGAATCATCCTTATATAAACCATAACCAGTGCGACCGATTGCAAGAACTTCTGCATTTCCAGAAGTAGTATGAGGTGCAGCATATAAATCATGTCCTAGCAAATCATTACTCACAATAGCATAATTGTTATTTTTTGTTGCGGAATACTCAATAACATTAAAAGGATAGTAAAGATAAAGTTTAATATTATTCCTTACAAACCTCCACAGCAAATTTGTAAATCTAATTGCTTGAGTTGCTGCTGGGCCTTCTAACTCAATCATGAGATCAAAAACTGGGTGTT	NA	NA	NA	NA
WP_155047019.1|154219_154372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047293.1|154861_155587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|155739_156468_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126843.1|156844_157024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126844.1|157242_157539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212118.1|157633_158095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780014.1|158448_159891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780017.1|160051_160426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047014.1|160496_160838_-	hypothetical protein	NA	A0A1B1IQX9	uncultured_Mediterranean_phage	60.3	1.7e-21
WP_054300202.1|161056_161785_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155047294.1|161991_162654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047295.1|162899_163961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047300.1|165179_165452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047296.1|165560_166196_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	42.5	1.4e-34
>prophage 1
NZ_CP039037	Piscirickettsia salmonis strain Psal-071 plasmid unnamed2, complete sequence	58538	2671	47766	58538	protease,portal,head,transposase,integrase,capsid,tail	Streptococcus_phage(13.64%)	57	NA	NA
WP_052104629.1|2671_3697_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047304.1|3967_4099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047313.1|4825_5179_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_016211142.1|6767_7034_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075274761.1|7090_7414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047305.1|7415_7838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274762.1|7837_8188_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_075274763.1|8184_8580_-	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	39.1	6.0e-07
WP_075274764.1|8572_8896_-|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	41.7	5.4e-14
WP_075274765.1|8892_9204_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	31.7	2.5e-08
WP_155064811.1|9541_10105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047306.1|10140_11307_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	38.7	1.2e-66
WP_081007077.1|11362_12034_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	45.8	5.5e-45
WP_054300593.1|11981_13223_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	43.6	2.7e-85
WP_155047307.1|13219_13816_-	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.3	2.0e-38
WP_155047308.1|13859_14834_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	8.3e-26
WP_155047309.1|14853_15783_-	hypothetical protein	NA	A0A1W6JP18	Morganella_phage	52.0	1.5e-85
WP_155047310.1|16011_16494_-	hypothetical protein	NA	Q9B019	Phage_GMSE-1	33.3	1.1e-13
WP_032126915.1|16580_16964_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	4.7e-25
WP_052047121.1|17142_17544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126916.1|17688_18159_-	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	48.8	1.5e-33
WP_155047311.1|18146_18449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923627.1|18445_18733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210963.1|18828_19068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047315.1|19064_19412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047314.1|19404_19767_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.9e-24
WP_036780304.1|19735_20272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211080.1|20312_21299_-	helix-turn-helix domain-containing protein	NA	A0A0S2MVA0	Bacillus_phage	45.4	4.3e-14
WP_036780299.1|21337_21640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211079.1|21794_22100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211067.1|22309_23053_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211077.1|23185_23971_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300594.1|24403_25429_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_036780005.1|25576_26224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211069.1|26207_26639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047030.1|26663_26807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211075.1|27021_28263_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211068.1|28266_29079_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080664851.1|29075_29885_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|30087_31062_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047312.1|31097_31439_-	toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.7	2.0e-11
WP_027242955.1|31431_31692_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211925.1|32191_32977_+	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	28.7	9.7e-17
WP_016211928.1|32969_33410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126138.1|33960_34224_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_054300276.1|35154_36129_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.8	2.4e-25
WP_016212188.1|37218_37959_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_155047301.1|38136_38409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|39029_39605_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	6.0e-08
WP_016212189.1|39670_40063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|41249_42275_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047302.1|42928_44008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212274.1|44538_45003_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_032126154.1|45013_45208_-	addiction module toxin, HicA family	NA	A0A1X9I5T5	Streptococcus_phage	48.4	2.8e-10
WP_032126152.1|45423_46014_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.8	1.4e-20
WP_081007075.1|46077_46419_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155047303.1|46764_47766_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.3e-29
>prophage 1
NZ_CP039038	Piscirickettsia salmonis strain Psal-071 plasmid unnamed3, complete sequence	38376	6445	19646	38376	terminase,head,protease,transposase,tail,portal,capsid	Erysipelothrix_phage(25.0%)	15	NA	NA
WP_054300271.1|6445_7420_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047317.1|7554_8391_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_016211139.1|8470_8866_-	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211132.1|8858_9182_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211137.1|9178_9490_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_155047318.1|9680_11015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211140.1|11135_12329_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_080664855.1|12386_13058_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.8	3.0e-43
WP_155047319.1|13005_13626_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	50.9	5.5e-39
WP_052104629.1|13828_14854_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047320.1|14984_15707_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	40.8	2.6e-40
WP_155047321.1|15703_17386_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	45.7	6.9e-137
WP_016212234.1|17388_17868_-|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_155047322.1|17944_18337_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	4.4e-26
WP_054300271.1|18671_19646_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
>prophage 1
NZ_CP039039	Piscirickettsia salmonis strain Psal-071 plasmid unnamed4, complete sequence	33277	10315	26969	33277	tail,transposase	Indivirus(18.18%)	19	NA	NA
WP_036781073.1|10315_10576_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	A0A1S5NR91	Burkholderia_phage	48.8	2.1e-13
WP_081007079.1|10646_10919_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_129556478.1|11130_12017_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.4	5.8e-10
WP_016212315.1|13555_13990_+	DUF29 domain-containing protein	NA	A0JC30	Ralstonia_phage	39.7	9.1e-25
WP_155047334.1|14398_14839_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	37.6	1.1e-06
WP_054300249.1|14799_15165_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047335.1|15179_15623_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	25.5	5.1e-07
WP_054300271.1|16632_17607_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047336.1|17603_17888_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047337.1|17906_18269_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211141.1|18268_18691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275196.1|18692_19016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|19072_19339_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075275195.1|19342_21421_+	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	33.4	2.5e-56
WP_036776958.1|21413_21755_+|tail	phage minor tail family protein	tail	NA	NA	NA	NA
WP_016210666.1|21751_22423_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|22391_23138_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_054300696.1|23127_23685_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_075275194.1|23681_26969_+	host specificity protein J	NA	A0A0R6PIC0	Moraxella_phage	33.2	5.2e-112
