The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	31805	91601	3190249	tRNA,transposase	Staphylococcus_phage(28.57%)	52	NA	NA
WP_036772169.1|31805_32681_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378444.1|33039_34395_+	chloride channel protein	NA	NA	NA	NA	NA
WP_017378443.1|34486_34993_-	GrpB family protein	NA	NA	NA	NA	NA
WP_017378442.1|34989_35358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378441.1|36760_38545_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_017378440.1|39025_40153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378439.1|40225_40981_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_027242743.1|41017_43711_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.7	9.9e-69
WP_036771562.1|43742_44294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063736.1|44401_45415_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017378435.1|45535_45760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378434.1|46115_46877_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_144420740.1|47019_47814_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875841.1|47958_48711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378433.1|49022_50549_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_065653750.1|50687_51761_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027242742.1|51800_53108_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
WP_017378429.1|53082_54252_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_027242741.1|54306_55032_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_027242740.1|55497_57603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378426.1|57817_58282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420739.1|58301_58811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420738.1|59195_60137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856772.1|60418_61870_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773655.1|62336_62741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|63301_64276_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|65010_65388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|65977_66952_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036773242.1|66991_67546_-	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_017378416.1|67733_68633_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_080963576.1|68637_69264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242705.1|69208_71530_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_016210342.1|71676_72156_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_017378414.1|72152_73304_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_017378413.1|73438_73942_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_026063734.1|74035_75010_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_036773239.1|74999_76313_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_017378410.1|76353_77733_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_080963575.1|77739_79191_+	potassium transporter	NA	NA	NA	NA	NA
WP_016210352.1|79216_79585_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_017378407.1|79603_80671_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_027242707.1|80703_81600_-	DMT family transporter	NA	NA	NA	NA	NA
WP_047927132.1|81596_82433_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_017378404.1|82568_83021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378403.1|83159_83906_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378402.1|83886_84450_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378401.1|84458_84974_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378400.1|85115_87194_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378399.1|87193_88144_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378398.1|89011_89410_+	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_075275373.1|89635_89965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875844.1|90581_91601_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	123725	241661	3190249	protease,tRNA,transposase	Staphylococcus_phage(12.5%)	105	NA	NA
WP_053093682.1|123725_124469_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929698.1|124909_125203_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_017377396.1|125203_125458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242714.1|125474_127967_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_017377399.1|127959_128643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377400.1|128642_129686_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_017377401.1|129685_130915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377402.1|130916_131246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377403.1|131242_132442_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_144420824.1|132554_132944_+	signal peptidase, peptidase S26 family protein	NA	NA	NA	NA	NA
WP_026063632.1|132943_133888_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_017377406.1|134007_135405_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	3.9e-77
WP_017377407.1|135730_136252_+	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	46.2	1.7e-30
WP_017377408.1|136375_136684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875847.1|136698_141921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242717.1|142311_144318_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377568.1|144448_146779_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_144420823.1|146954_147785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773453.1|147901_148297_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_027242719.1|148293_148827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242720.1|148823_149225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875848.1|149619_149940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377563.1|149949_150906_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.5	1.0e-12
WP_017377562.1|151415_151940_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_017377561.1|152040_153039_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_027242721.1|153127_154024_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080963593.1|154097_155384_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377557.1|155843_157160_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377556.1|157273_157444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|157463_158438_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377551.1|158564_158825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377550.1|159092_159383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377545.1|161921_162962_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_048875849.1|163064_164036_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377543.1|164158_165007_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_017377542.1|165158_165446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|165756_166128_+	isochorismatase	NA	NA	NA	NA	NA
WP_017377540.1|167179_167413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|167550_167688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377539.1|167701_167914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377537.1|168437_169262_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377536.1|169400_170534_+	cation transporter	NA	NA	NA	NA	NA
WP_016210041.1|170593_172003_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_027242724.1|172150_173731_-	APC family permease	NA	NA	NA	NA	NA
WP_017377534.1|174488_175484_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242725.1|175489_177556_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_048875850.1|177613_178564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210045.1|178758_179085_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_026063646.1|179307_180567_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_036772663.1|180826_181702_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377528.1|181740_182703_+	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_017375799.1|188397_188742_-	DMT family protein	NA	NA	NA	NA	NA
WP_047927156.1|188838_189762_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375796.1|190261_190750_+	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_017375795.1|190852_191653_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375794.1|191663_193415_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_081000012.1|194304_194547_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420737.1|194550_194949_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|195180_196056_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375951.1|196774_197233_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420736.1|197414_197600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|198315_200130_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_017375948.1|200540_201209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375947.1|201218_202535_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375945.1|202694_203657_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210730.1|203737_203893_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375944.1|203906_204143_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_036773720.1|204335_205553_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375942.1|205530_205989_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_017375941.1|206016_207396_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_075275379.1|207432_207651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|207970_209266_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|209470_209662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|209860_210736_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|210923_212189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875854.1|212222_213098_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378152.1|213219_213678_-	NfeD family protein	NA	NA	NA	NA	NA
WP_017378151.1|213701_214622_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378150.1|214749_215532_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378149.1|215622_217122_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_027242686.1|217435_219319_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_027242685.1|219578_220241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242684.1|220307_221417_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_017378146.1|221428_222073_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_017378145.1|222091_223078_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378144.1|223162_224239_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378143.1|224440_225265_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378142.1|225567_226533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378141.1|226851_227904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|227962_228937_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027242682.1|229272_229701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|229937_230420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378138.1|230475_231726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378137.1|231828_232047_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378136.1|232518_233373_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378135.1|233427_233898_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_026063709.1|234194_234431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063708.1|234577_234958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|235016_235892_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063707.1|236658_237570_+	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_017378132.1|237686_238535_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_065653735.1|238601_239612_+	lipase	NA	NA	NA	NA	NA
WP_017378129.1|239635_239959_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_017375571.1|239969_240371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875856.1|240641_241661_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	316578	358937	3190249	transposase	Chrysochromulina_ericina_virus(20.0%)	54	NA	NA
WP_036772169.1|316578_317454_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378046.1|317534_318167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378045.1|318120_319566_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_051929544.1|319600_320020_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017378043.1|320793_321162_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_017378042.1|321171_321711_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_017378041.1|321871_322303_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_017378040.1|322306_323005_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_017378039.1|323252_323759_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_017378038.1|323801_324170_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_017378037.1|324440_328517_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.6	1.2e-22
WP_017378036.1|328580_332789_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_016209765.1|332950_333325_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_016209732.1|333429_333903_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_017378035.1|333918_336030_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209759.1|336057_337248_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_016209760.1|337254_337566_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_017378034.1|337688_338327_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_016209735.1|338342_338960_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_016209744.1|338956_339253_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_017378033.1|339267_340092_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_017378032.1|340108_340384_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_016209755.1|340389_340722_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_017378031.1|340734_341469_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_017378030.1|341482_341896_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_016209750.1|341895_342096_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_017378029.1|342095_342353_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_017378028.1|342474_342843_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_016209734.1|342860_343172_+	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_016209761.1|343187_343730_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_026063699.1|343742_344048_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_016209763.1|344076_344469_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_017378025.1|344481_345015_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_016209757.1|345024_345378_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_016209764.1|345388_345889_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_017378024.1|345894_346077_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_017378023.1|346079_346514_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_016209749.1|346514_347837_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_016209752.1|347893_348007_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_017378021.1|348150_348507_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_016209730.1|348532_348922_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_017378020.1|348931_349552_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_016209739.1|349573_350551_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_017378019.1|350599_350998_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_017378018.1|351110_352358_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_027242670.1|352344_353001_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_036772490.1|353085_353364_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375625.1|353606_353834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875859.1|353966_354761_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053856770.1|355069_356284_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|356681_356861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|356829_357483_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376985.1|357858_358107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771653.1|358196_358937_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
>prophage 4
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	376955	426638	3190249	transposase,tRNA	Staphylococcus_phage(25.0%)	54	NA	NA
WP_017376964.1|376955_379436_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_017376963.1|379522_380002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772771.1|379974_381015_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080963574.1|380951_381668_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|381680_382016_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|382052_382523_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_017376959.1|382565_384401_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_036818645.1|384445_385534_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376957.1|385555_386617_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_017376956.1|386694_387210_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376955.1|387250_388528_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376954.1|388542_389394_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376953.1|389422_390070_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026063584.1|390066_391026_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_048875861.1|391547_392417_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875862.1|392561_392816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856769.1|392960_393527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|393632_394073_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_027242664.1|394584_395787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|396070_397045_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_155046562.1|397226_397370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046563.1|397514_397652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910653.1|397668_397884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|398088_398700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376943.1|398696_398954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376942.1|399204_399597_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016210000.1|399726_400275_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_026063583.1|400274_401102_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_017376940.1|401151_402837_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_017376939.1|402914_403376_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_026063582.1|403412_403976_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209991.1|404202_404532_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_017376937.1|404512_404737_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_017376936.1|404881_405472_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376935.1|405496_406768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|406785_408039_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376933.1|408035_408680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376932.1|408752_409802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376931.1|409903_411541_+	response regulator	NA	NA	NA	NA	NA
WP_017376930.1|411575_411905_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376929.1|412061_412349_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376927.1|412775_412913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046565.1|412875_413169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376925.1|413418_414639_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376924.1|414697_417496_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376923.1|417801_418968_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_036772950.1|419066_419603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376921.1|419664_419997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|420254_421157_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|421226_421724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|421869_423273_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377694.1|423473_424202_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963630.1|424371_425229_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_048875864.1|425612_426638_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	497564	544532	3190249	transposase	Streptococcus_phage(33.33%)	44	NA	NA
WP_048875872.1|497564_498848_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|499020_499158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875873.1|499154_500558_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927246.1|500671_501109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242638.1|501229_501658_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017375827.1|501905_502343_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|502774_504163_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_017375825.1|504609_506103_+	amino acid permease	NA	NA	NA	NA	NA
WP_036773936.1|506297_507053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420725.1|507552_507783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|508887_509898_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375821.1|509894_510116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242636.1|510834_511776_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026063480.1|512303_512702_+	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_075275366.1|512641_513496_+	MFS transporter	NA	NA	NA	NA	NA
WP_017375815.1|513587_513869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242634.1|513954_514632_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_026063478.1|514677_515958_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_017375812.1|516133_517183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375811.1|517261_518062_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375810.1|518075_518870_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375809.1|518972_519992_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375808.1|520038_520650_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375807.1|520653_521340_+	acireductone synthase	NA	NA	NA	NA	NA
WP_017375806.1|521336_521879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375805.1|522171_523359_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375804.1|523603_524329_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_144420816.1|524514_525303_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_047927106.1|525299_525695_-	YchJ family protein	NA	NA	NA	NA	NA
WP_017375801.1|526087_527128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|527124_528528_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|530943_531201_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420723.1|531240_532626_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242633.1|532955_534053_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_017377120.1|534086_535337_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_017377119.1|535337_535970_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017377118.1|536259_536712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063598.1|536757_537600_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_155073352.1|537634_538078_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_017377115.1|538321_540289_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377113.1|540516_540921_+	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_047927448.1|540898_541927_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_027242632.1|541913_542702_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053856766.1|543128_544532_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	584038	717432	3190249	plate,tRNA,transposase	Staphylococcus_phage(13.64%)	111	NA	NA
WP_036772726.1|584038_584587_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
WP_017377077.1|585339_586719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|587078_588542_+	nuclease	NA	NA	NA	NA	NA
WP_017377075.1|588725_589538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377074.1|590002_591997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377073.1|592391_593771_+	MFS transporter	NA	NA	NA	NA	NA
WP_036774567.1|593808_594246_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774569.1|594288_595005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|596551_597082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|597148_598969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|599533_600040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242613.1|600124_601528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|601642_601897_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_017377065.1|602049_602322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420722.1|602897_603080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|603196_603772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377063.1|603768_603939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242612.1|604839_605082_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_027242611.1|605384_606476_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377060.1|606456_607410_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_017377059.1|607633_609118_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_027242610.1|609157_609661_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_051929897.1|609920_611096_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_051929903.1|611243_611648_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_036772169.1|611804_612680_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242609.1|612714_613068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|616397_616823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|617053_618190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242608.1|618176_619499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377048.1|619491_620610_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377047.1|620730_621264_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377046.1|621402_623040_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377045.1|623044_623266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377044.1|623374_624388_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377043.1|624659_626888_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_026063593.1|626868_627573_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|627807_628137_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377039.1|629537_629756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|629814_630690_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377037.1|630682_631549_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_017377036.1|631616_632936_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036772137.1|633405_633966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856764.1|634284_635211_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376601.1|636106_637015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|640711_641551_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376604.1|641737_641953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|642001_642577_-	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376606.1|642573_642912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376607.1|643080_644070_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_051929685.1|645059_645962_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048875883.1|646221_646758_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420814.1|646902_647820_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376610.1|648254_649265_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_017376611.1|650072_650609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376613.1|651821_652169_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275357.1|652313_653273_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376616.1|653374_654157_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243116.1|654289_655249_+	response regulator	NA	NA	NA	NA	NA
WP_017376619.1|655273_655678_-	RidA family protein	NA	NA	NA	NA	NA
WP_026063546.1|655706_656381_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_027243117.1|656480_658196_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016209558.1|658192_658555_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_026063550.1|658569_659724_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_017376622.1|659727_660735_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_017376623.1|660737_661754_+	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376624.1|661969_663055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376625.1|663161_663554_-	RidA family protein	NA	NA	NA	NA	NA
WP_027243118.1|663686_664970_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_027243119.1|664985_666287_+	aspartate kinase	NA	NA	NA	NA	NA
WP_036772145.1|666304_668107_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420721.1|668111_669104_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376630.1|669184_670261_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017376631.1|670358_671333_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_144420813.1|671400_672372_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376633.1|672555_672825_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_017376634.1|673426_674713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|674777_675458_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376024.1|681113_681362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816881.1|681439_681658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275355.1|681681_682656_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_027242570.1|682869_684009_-	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_017376020.1|684217_685588_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_017376019.1|685966_686959_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376018.1|686962_687478_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376017.1|687474_688314_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_027242569.1|688346_689897_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376015.1|690004_690376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376011.1|691596_691758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|692338_693742_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375660.1|693776_694214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|694237_695212_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036774104.1|695270_695699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376321.1|695886_696693_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_017376322.1|696767_697160_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376323.1|697204_698026_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376324.1|698038_699022_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376325.1|699023_700292_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_048876074.1|700298_702803_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376328.1|702933_703959_+	phosphotransferase	NA	NA	NA	NA	NA
WP_017376329.1|703955_704666_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_080963653.1|704590_705421_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376331.1|705570_705954_+	response regulator	NA	NA	NA	NA	NA
WP_027242863.1|705988_706888_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_027242862.1|706933_707605_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_017376334.1|707687_708263_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_017376335.1|708361_709162_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376336.1|709303_710161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|711023_712160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242860.1|712226_715397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242859.1|715409_716120_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242858.1|716124_717432_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 7
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	726074	772391	3190249	transposase,plate	Staphylococcus_phage(21.43%)	51	NA	NA
WP_017376356.1|726074_726473_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_027242851.1|726469_728158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242850.1|728139_729096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|729138_729654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|729758_730691_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_017376360.1|730910_731297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376361.1|731314_731959_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_017376362.1|732109_732949_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.6	3.9e-16
WP_017376363.1|733024_733627_+	signal peptidase I	NA	NA	NA	NA	NA
WP_017376364.1|733627_734482_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_017376365.1|734839_735151_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017376366.1|735175_736564_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|736719_737451_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_027242849.1|737447_737975_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|738006_738564_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_027242848.1|738569_739550_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	3.5e-32
WP_016209539.1|739689_740490_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_017376369.1|740493_741261_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_017376370.1|741257_741722_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_017376371.1|741744_742398_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376372.1|742401_742749_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017376373.1|742782_743034_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|743111_744380_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027242847.1|744382_745141_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_017376376.1|745202_746093_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|746143_746827_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_017376377.1|746836_747184_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155062809.1|747453_749577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376379.1|749568_750441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376380.1|750608_752438_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_017376381.1|752605_753247_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_144420811.1|753571_754018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|754035_754209_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_017376383.1|754267_755317_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_017376384.1|755323_756274_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_017376385.1|756328_757273_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_017376386.1|757300_758038_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|758126_758369_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|758443_759667_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_017376387.1|759698_760547_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_017376388.1|760543_761596_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_017376389.1|761732_762353_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	43.7	2.7e-38
WP_087910645.1|762578_763731_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_036771330.1|764751_765726_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046570.1|765722_765893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971647.1|766861_767458_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876071.1|767426_768587_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_017377691.1|769097_769439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377690.1|769542_770577_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|770573_771284_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_036771330.1|771416_772391_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 8
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	780551	834862	3190249	protease,tRNA,transposase	Prochlorococcus_phage(33.33%)	49	NA	NA
WP_017377942.1|780551_781058_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_155046572.1|781139_781562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243057.1|781647_782508_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420810.1|782605_783151_+	chorismate lyase	NA	NA	NA	NA	NA
WP_017377937.1|783233_784085_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_048876070.1|784126_787033_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|787093_787291_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_017377935.1|787297_788308_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_017377934.1|788304_789363_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_087910662.1|789377_790157_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027243055.1|790159_790972_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_017377933.1|790983_791931_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_144420809.1|791941_793234_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377931.1|793412_794516_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_017377930.1|794512_794905_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_027243054.1|794917_796294_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377929.1|796287_797757_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_053856762.1|797950_798385_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_087910651.1|798680_798857_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_027243053.1|799891_800917_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	30.5	4.5e-30
WP_017377925.1|801418_801811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774583.1|803203_803854_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046574.1|804552_805347_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876067.1|805526_806171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|806345_807320_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377920.1|807720_807978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420808.1|809655_810333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243155.1|810566_811391_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377914.1|811484_812198_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_017377913.1|812287_813379_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377912.1|813450_814032_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377911.1|814037_814664_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_026063691.1|814760_815708_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_065653730.1|816054_816717_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017377908.1|816887_817547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377907.1|817715_818975_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377906.1|818971_820057_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377905.1|820049_820931_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_027243154.1|820919_822170_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_144420719.1|823555_823876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|824134_824401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|824891_825110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420718.1|826095_826317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|826313_827396_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063690.1|827406_827778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773050.1|827774_827954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|830657_830933_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065653755.1|831768_833226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|833653_834862_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	878542	941090	3190249	tRNA,transposase	Staphylococcus_phage(28.57%)	53	NA	NA
WP_048875904.1|878542_879418_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376744.1|879674_880112_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_017376743.1|880172_880805_-	endonuclease III	NA	NA	NA	NA	NA
WP_017376742.1|880820_881468_-	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_027242971.1|881470_883534_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_027242972.1|883860_885153_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242973.1|885541_887752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242974.1|887768_888425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242975.1|890810_891686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420805.1|891944_892556_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_027242976.1|892983_895572_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
WP_017375712.1|895674_896436_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242977.1|896432_896969_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375710.1|897017_897974_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242978.1|898051_901237_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_017375707.1|901240_902296_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	1.5e-49
WP_027242979.1|902525_903128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375705.1|903171_903834_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017375704.1|903868_904216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046576.1|904684_905629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|906178_907582_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242980.1|908700_909045_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027242981.1|909136_909592_+	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_144420715.1|909840_909975_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377756.1|909967_910609_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|910605_911322_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377754.1|911325_912645_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_155046577.1|913326_913488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773644.1|914449_917086_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	1.5e-98
WP_036773645.1|917127_918213_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377749.1|918212_918896_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_017377748.1|918956_920618_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377747.1|920770_921025_+	LapA family protein	NA	NA	NA	NA	NA
WP_017377746.1|921103_921421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377745.1|921573_921972_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242983.1|922053_922692_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_036771330.1|922848_923823_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420804.1|924195_924471_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|925020_925305_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772261.1|927121_927715_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243172.1|928830_929712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376527.1|929823_931503_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_017376526.1|931629_932880_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376525.1|932955_933417_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376524.1|933413_934562_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376523.1|934567_935242_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376522.1|935238_935895_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376521.1|936020_936494_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376520.1|936495_936918_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_047927196.1|936904_937924_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_155046578.1|938083_938263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243174.1|938481_938763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|940214_941090_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	944992	1011955	3190249	protease,tRNA,transposase	Bacillus_phage(20.0%)	56	NA	NA
WP_048876012.1|944992_946396_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|946754_947522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|947635_949039_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046579.1|949035_949197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|949512_950487_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376505.1|950727_952011_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376506.1|952077_953001_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376509.1|955196_957341_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_016210310.1|957362_957569_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376510.1|957629_958250_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_017376511.1|958290_959184_-	YicC family protein	NA	NA	NA	NA	NA
WP_016210308.1|959269_959995_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210305.1|960056_960461_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_027243115.1|960623_962732_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_017376514.1|962855_963905_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376515.1|963901_965368_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376516.1|965510_966848_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_047927029.1|966915_968406_-	nuclease	NA	NA	NA	NA	NA
WP_017376518.1|968634_969006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|969156_969984_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_027243112.1|970286_970943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927028.1|970890_971814_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036774751.1|971827_972751_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017376987.1|972998_973682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|975381_975609_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376989.1|975933_976482_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_017376990.1|976562_976838_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_027242882.1|976837_977887_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376991.1|977999_979937_-	AsmA family protein	NA	NA	NA	NA	NA
WP_080963631.1|980084_981797_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376994.1|981865_982585_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_017376995.1|982581_983184_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376996.1|983298_984186_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|984376_984724_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376997.1|984774_985614_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_017376998.1|985709_986456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063589.1|986652_987279_+	porin family protein	NA	NA	NA	NA	NA
WP_017377000.1|987594_988164_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017377001.1|988307_989006_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377003.1|989712_990336_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052106204.1|990445_991339_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377006.1|991445_993056_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_027242880.1|993052_994348_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_027242879.1|994369_996292_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_017377007.1|996402_996705_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_017377008.1|996799_1001686_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_047927528.1|1001733_1003056_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_036771855.1|1003180_1004275_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_027242877.1|1004326_1005265_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_026063591.1|1005345_1005930_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242876.1|1006314_1007205_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_017377014.1|1007407_1007899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242875.1|1008038_1008530_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1008698_1009412_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065653747.1|1009474_1010815_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_048875904.1|1011079_1011955_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	1017568	1080105	3190249	transposase	Staphylococcus_phage(33.33%)	57	NA	NA
WP_017377787.1|1017568_1017796_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377021.1|1017822_1018863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377022.1|1018929_1019499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|1019729_1020134_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1020146_1020287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929560.1|1020381_1021581_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_016211971.1|1021601_1022213_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_027242871.1|1022414_1023176_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080963583.1|1023471_1024398_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_144420803.1|1024558_1025515_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999998.1|1025659_1025929_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1026195_1027170_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375625.1|1027323_1027551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420711.1|1027667_1028093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|1028249_1029179_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_027242870.1|1029625_1030156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046580.1|1030540_1030783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|1031260_1031572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963609.1|1031911_1033078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|1035265_1036237_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046581.1|1036839_1037013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376283.1|1037408_1038326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376284.1|1038326_1039178_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1039618_1040665_+	glutathione synthase	NA	NA	NA	NA	NA
WP_144420802.1|1040654_1042646_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_036773579.1|1042755_1043130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420801.1|1043383_1043566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|1043827_1044529_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420709.1|1044529_1044949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376293.1|1046635_1049386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376294.1|1049621_1050914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|1051400_1052306_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376296.1|1053083_1053800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1054085_1054847_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_048876053.1|1054879_1056283_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1056279_1056444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|1056503_1056791_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017375910.1|1057535_1058264_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_048876052.1|1058232_1058979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420708.1|1059059_1059449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1059445_1060420_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772454.1|1060576_1060894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772457.1|1063369_1063678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|1063753_1064026_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_017377863.1|1066559_1066997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|1067598_1068786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963626.1|1069056_1070691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|1070741_1071470_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377858.1|1072897_1073860_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377857.1|1074093_1075089_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377856.1|1075116_1076052_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|1076095_1076557_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080963625.1|1076535_1077153_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1077182_1078157_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377852.1|1078211_1078679_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377851.1|1078691_1079336_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|1079376_1080105_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
>prophage 12
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	1088805	1138373	3190249	transposase	Acinetobacter_phage(22.22%)	39	NA	NA
WP_082300708.1|1088805_1089366_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378014.1|1090690_1091086_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378015.1|1091094_1091451_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_048876047.1|1091443_1092319_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420706.1|1092404_1092983_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876046.1|1092940_1093234_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_047927811.1|1094194_1095706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1095953_1097357_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999997.1|1097562_1097997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275341.1|1098079_1098784_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999996.1|1099042_1099531_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_051929548.1|1099559_1100234_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|1100474_1101350_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075275340.1|1101880_1102489_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375723.1|1102759_1103218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375724.1|1103496_1103886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|1104071_1104887_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375727.1|1105109_1106015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211119.1|1106178_1106940_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375728.1|1106943_1107810_+	OmpA family protein	NA	NA	NA	NA	NA
WP_017375729.1|1107895_1108507_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_017375730.1|1108885_1110133_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_144420800.1|1110284_1110986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|1111283_1111457_-	phosphatase	NA	NA	NA	NA	NA
WP_048876044.1|1111946_1112447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1113525_1113753_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036774233.1|1113805_1114039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|1114067_1114748_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027242790.1|1114770_1116945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378188.1|1117190_1118261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1118257_1119661_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378190.1|1119803_1120295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242789.1|1120366_1121188_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_017378192.1|1121854_1123354_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_017378193.1|1123657_1126351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242788.1|1126347_1129749_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_048875961.1|1131336_1132740_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378201.1|1133818_1134490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1137398_1138373_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 13
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	1163096	1219490	3190249	tRNA,transposase	Staphylococcus_phage(37.5%)	51	NA	NA
WP_053093677.1|1163096_1163816_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_155046584.1|1164043_1164220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375975.1|1164468_1164792_+	YqcC family protein	NA	NA	NA	NA	NA
WP_036771316.1|1164880_1166899_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375977.1|1166921_1167875_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375978.1|1168040_1169228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876036.1|1169941_1170580_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_036771312.1|1170877_1171873_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_027242772.1|1172013_1173060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|1173052_1174078_+	FUSC family protein	NA	NA	NA	NA	NA
WP_017375766.1|1174144_1176175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1177481_1177709_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375561.1|1179052_1179196_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062365727.1|1179192_1179885_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242771.1|1180151_1180469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242770.1|1180611_1181022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242769.1|1181178_1181505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963649.1|1181651_1182689_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242767.1|1182730_1182976_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_129556541.1|1183100_1183415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242765.1|1183422_1184997_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_027242764.1|1185151_1185721_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242763.1|1186030_1187833_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_087910649.1|1187829_1188771_+	signal peptidase I	NA	NA	NA	NA	NA
WP_027242761.1|1189182_1189857_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_144420798.1|1189862_1190762_+	GTPase Era	NA	NA	NA	NA	NA
WP_027242759.1|1190775_1191519_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_027242758.1|1191521_1192253_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242757.1|1192249_1192633_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242756.1|1192770_1194018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242755.1|1194428_1195574_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242754.1|1195566_1195920_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242753.1|1196200_1196743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927692.1|1197387_1197576_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1197595_1198570_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420702.1|1198613_1199489_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036815628.1|1199842_1200670_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080963648.1|1200769_1200931_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375762.1|1201581_1202922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1203973_1204201_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027243003.1|1204342_1205704_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_027243002.1|1205799_1206459_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144420701.1|1207299_1207656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375757.1|1208252_1209812_-	APC family permease	NA	NA	NA	NA	NA
WP_155073355.1|1210172_1212143_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	4.2e-77
WP_017375893.1|1212340_1213411_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017375892.1|1213468_1213675_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375891.1|1213681_1215157_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375890.1|1215292_1215856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1216025_1217429_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242999.1|1218395_1219490_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 14
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	1235732	1283457	3190249	transposase	Staphylococcus_phage(50.0%)	42	NA	NA
WP_036772169.1|1235732_1236608_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876030.1|1236677_1237781_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774087.1|1237848_1238172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242984.1|1238328_1239111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063491.1|1239246_1240224_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_047927375.1|1240297_1242289_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_017375900.1|1242344_1242626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1242879_1244079_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_051929862.1|1246510_1247023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1247209_1248085_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375562.1|1248121_1248286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1249494_1249908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774270.1|1249918_1250254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420796.1|1250398_1251517_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876026.1|1251746_1252013_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1253295_1253523_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773258.1|1253533_1254040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243127.1|1254117_1254735_-	VOC family protein	NA	NA	NA	NA	NA
WP_017376680.1|1254866_1256099_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_017376681.1|1256088_1256751_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_026063554.1|1257025_1258282_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_087910647.1|1258419_1259079_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376683.1|1259153_1259855_+	cyclase family protein	NA	NA	NA	NA	NA
WP_036771330.1|1260602_1261577_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376688.1|1262785_1263139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1263352_1263547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1263614_1264127_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376691.1|1264264_1265119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1265167_1265812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1265845_1266490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243125.1|1267012_1267306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376695.1|1267404_1268187_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_017376696.1|1268269_1269220_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_027243124.1|1271262_1274103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376700.1|1274125_1274707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376701.1|1274826_1275555_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_036771330.1|1275700_1276675_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243123.1|1276790_1277696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376705.1|1278294_1279041_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376706.1|1279293_1279686_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376707.1|1279723_1280371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1282086_1283457_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	1307276	1348486	3190249	transposase	Enterobacteria_phage(16.67%)	37	NA	NA
WP_048876023.1|1307276_1308380_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_087910645.1|1308470_1309623_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876022.1|1310036_1310888_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420700.1|1311025_1311175_-	phosphatase	NA	NA	NA	NA	NA
WP_017377952.1|1311799_1314166_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_017377953.1|1314213_1315410_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_027242965.1|1315978_1318411_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036773041.1|1318732_1320232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242964.1|1320340_1320913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|1321227_1322697_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017377960.1|1322769_1323519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876021.1|1323522_1324296_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_027242961.1|1324394_1325345_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017377963.1|1325484_1326927_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242960.1|1327142_1328327_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377966.1|1328450_1329137_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_026063694.1|1329272_1329857_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_144420699.1|1329946_1330276_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017377969.1|1330611_1330851_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_017377970.1|1330899_1331091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275334.1|1331865_1332159_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420698.1|1332307_1332469_-	phosphatase	NA	NA	NA	NA	NA
WP_017378162.1|1332983_1333523_-	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1333861_1334506_-	porin family protein	NA	NA	NA	NA	NA
WP_017378160.1|1334839_1335490_-	porin family protein	NA	NA	NA	NA	NA
WP_017378159.1|1336013_1337066_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378158.1|1337083_1340164_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242571.1|1340329_1340578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|1340643_1341519_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772025.1|1342441_1342948_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027243218.1|1342965_1343163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1343181_1343325_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155046586.1|1343392_1343566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1343770_1345084_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000010.1|1345093_1345357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1345415_1346390_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377787.1|1348258_1348486_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 16
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	1379703	1433437	3190249	tRNA,transposase	Bacillus_thuringiensis_phage(25.0%)	46	NA	NA
WP_036772026.1|1379703_1380579_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242912.1|1380683_1383986_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_017376668.1|1383982_1385806_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_017376669.1|1385845_1386244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242911.1|1386352_1387369_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_027242910.1|1387803_1389258_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376672.1|1389339_1392396_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_144420694.1|1392689_1392926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081329473.1|1393786_1394206_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376676.1|1394578_1395043_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075275332.1|1395115_1396117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771585.1|1399009_1399342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420693.1|1399703_1399847_-	phosphatase	NA	NA	NA	NA	NA
WP_048876152.1|1399834_1400779_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080963606.1|1400782_1401169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275328.1|1400990_1401329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376273.1|1401703_1402303_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017376274.1|1402302_1402650_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_026063520.1|1402800_1403784_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376276.1|1404693_1405008_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_144420691.1|1405156_1405315_-	phosphatase	NA	NA	NA	NA	NA
WP_144420690.1|1405286_1406216_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_026063521.1|1407130_1407547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1408675_1409392_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376099.1|1410140_1410299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1410347_1410923_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_075275424.1|1411067_1411346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376100.1|1411410_1412286_-	ParA family protein	NA	NA	NA	NA	NA
WP_048876018.1|1412451_1416318_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376103.1|1416473_1417283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376104.1|1417332_1418154_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376105.1|1418353_1419586_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376106.1|1419756_1420482_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376107.1|1420524_1422063_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376108.1|1422069_1423455_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_048876011.1|1423768_1424818_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1425377_1425755_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420688.1|1425946_1426822_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1427803_1428031_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876149.1|1428083_1428602_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_146619432.1|1428857_1429049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420793.1|1429457_1430231_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243181.1|1430344_1431316_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376772.1|1431297_1432269_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420687.1|1432704_1432890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1432900_1433437_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	1452372	1501791	3190249	transposase	Staphylococcus_phage(23.08%)	46	NA	NA
WP_051929845.1|1452372_1453197_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1453600_1454575_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927610.1|1454760_1455354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1455534_1455999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910660.1|1456393_1456675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1456671_1458075_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377324.1|1458726_1459107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1459346_1460003_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_036773200.1|1460147_1460444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1460503_1460791_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_027243051.1|1461074_1461284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772296.1|1461980_1462358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1462557_1463607_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377209.1|1463583_1465401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1465671_1466250_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_065653751.1|1466277_1466742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377206.1|1466778_1468236_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_027243048.1|1468297_1469785_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377202.1|1470554_1471157_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_017377201.1|1471718_1472189_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_036772316.1|1473836_1474580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275422.1|1474731_1475163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243044.1|1477800_1479147_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_036772310.1|1479234_1481040_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_017378301.1|1481505_1482303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378302.1|1482687_1483149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1483371_1484346_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963614.1|1484388_1484511_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376833.1|1484582_1486538_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1486927_1487113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376832.1|1487434_1488424_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_027243043.1|1488836_1490462_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376830.1|1490570_1490885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1491180_1492566_+	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376829.1|1492730_1492958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1493098_1493557_-	amino acid permease	NA	NA	NA	NA	NA
WP_144420685.1|1493757_1493943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1494011_1494839_-	DsbA family protein	NA	NA	NA	NA	NA
WP_144420792.1|1495293_1495818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376824.1|1496090_1496249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243041.1|1496418_1497372_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_036771330.1|1497566_1498541_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876009.1|1498668_1499694_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1500346_1500634_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929542.1|1500693_1501026_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081377820.1|1501230_1501791_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
>prophage 18
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	1510512	1620044	3190249	transposase,integrase,protease,tRNA	Staphylococcus_phage(21.74%)	106	1499363:1499422	1571366:1571976
1499363:1499422	attL	CCACCACGTGTCACTGATAAGTGGACGTGCGTATTCCAATTTAAACTCTGGCCGAAAGTA	NA	NA	NA	NA
WP_017376809.1|1510512_1512282_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_017376808.1|1512420_1513464_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376807.1|1513477_1514221_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_027243093.1|1514333_1514651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|1514712_1514892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243094.1|1514954_1515662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420791.1|1516445_1517657_+	protein kinase	NA	NA	NA	NA	NA
WP_017376801.1|1517712_1518537_-	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_017376798.1|1519724_1520360_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017376797.1|1520641_1521001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|1521274_1523560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420683.1|1523548_1524205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243096.1|1524381_1525014_+	MarC family protein	NA	NA	NA	NA	NA
WP_027243097.1|1525049_1525235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243098.1|1525300_1526446_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_027243099.1|1526681_1527995_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
WP_155046588.1|1529110_1529320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420682.1|1529854_1530016_-	phosphatase	NA	NA	NA	NA	NA
WP_036774189.1|1530188_1531196_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1531195_1531453_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376785.1|1533000_1533906_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376784.1|1534146_1534332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242578.1|1534368_1534905_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_027242577.1|1534922_1536224_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_048876008.1|1536220_1537195_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_155046589.1|1537274_1537424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046590.1|1537603_1537768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1537769_1538645_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420680.1|1538960_1539881_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_017375696.1|1539896_1540280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1540606_1541563_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_144420678.1|1541830_1542109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243017.1|1542607_1543951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046591.1|1544124_1544268_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1544347_1545322_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927346.1|1545469_1547341_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_075275322.1|1547373_1547472_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017378518.1|1547707_1548337_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017378517.1|1548320_1548743_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378516.1|1548749_1550489_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378515.1|1550489_1551554_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1551557_1551911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1552023_1552992_+	ferrochelatase	NA	NA	NA	NA	NA
WP_017378513.1|1553001_1553313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1553328_1553898_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378512.1|1554161_1555490_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_036771639.1|1555530_1556505_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420677.1|1557091_1557493_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_146619459.1|1558012_1560469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773893.1|1560671_1561523_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275420.1|1561568_1563275_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_069971648.1|1564746_1565721_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_047927336.1|1566083_1566329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653736.1|1566692_1567721_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017375591.1|1567851_1568055_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420676.1|1568339_1569296_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
WP_047927838.1|1569588_1569834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1569830_1570130_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_036774927.1|1570352_1570823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1571433_1571661_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036772851.1|1572883_1573201_+	hypothetical protein	NA	NA	NA	NA	NA
1571366:1571976	attR	TACTTTCGGCCAGAGTTTAAATTGGAATACGCACGTCCACTTATCAGTGACACGTGGTGGTGTTCTGGTCAAGTCATATTGGACACTTTTAATTGAGACTTTTCAAAATTAATAGGCGATAGGTTAGCATTGGCTGTATGCAACCGATCATGATTGTAATATCGAATATAGGCCTCAACATCCTCCTTCATAGTATCACGGGTTAAGTGAATCACATTCAACAGCCATTCGTGCTTTAGGCTGCCAAAAAAACGCTCGACAACCGCATTGTCAACGCAAGCACCGACACTGCTCATAGAAGCGGTGATTTTATGCTTCTTCAACAGTTTTCGATATTTTTTACTGGTATACTGCGAACCACGATCACTGTGAAATAACAAGTGTTCTGTCGGCTGCCGCAAGTGAATCGCCATATCCATTGCACGACAAACTAGATTTTCGCTCATTCTCTTATTCATCGCCCAGCCAATCACTTTTCGAGAGTATAAATCAATAACGACCGCAAGATACAACCAGCCTTCAGCAGTTCTAAGGTAGGTAATGTCACCTGCCCATGAGTGATTTGCAATGACTGGATTAAACTGCTGATTCAATACGTTATCTGCAACAGC	NA	NA	NA	NA
WP_027243023.1|1573194_1573437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243024.1|1573787_1574888_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_017377328.1|1575056_1576358_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_047927520.1|1576434_1576938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|1577113_1578517_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772872.1|1578704_1579562_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243025.1|1579686_1580322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1580370_1580622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243027.1|1580877_1581777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1581913_1582987_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017375995.1|1583087_1583501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375994.1|1583521_1584235_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_027243028.1|1584422_1585835_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243029.1|1586044_1587013_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_075275321.1|1587746_1588115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420675.1|1588118_1588436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1588511_1589486_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375989.1|1590005_1590506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243163.1|1590576_1591905_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036773519.1|1592040_1593429_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243165.1|1593576_1594887_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|1595227_1596511_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_017375982.1|1596584_1597205_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_051929832.1|1597403_1597664_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155046592.1|1597866_1598013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876006.1|1597988_1598582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816364.1|1600445_1600664_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772303.1|1601916_1602687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420790.1|1602773_1602989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376496.1|1603085_1604207_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_036771330.1|1604473_1605448_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771628.1|1605710_1606832_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_017376491.1|1607124_1607412_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1607384_1607888_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_053093673.1|1607968_1608628_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876005.1|1608969_1609887_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_075275317.1|1610016_1610190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1610855_1612214_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_017376486.1|1612288_1612852_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376485.1|1613046_1614276_-	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_017376484.1|1614321_1614948_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_027242833.1|1615097_1616285_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_048876004.1|1616293_1616986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910642.1|1617107_1618260_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876002.1|1619060_1620044_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
>prophage 19
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	1678379	1768694	3190249	protease,tRNA,transposase	Burkholderia_phage(14.29%)	82	NA	NA
WP_036774017.1|1678379_1679255_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377182.1|1679644_1679983_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_026063604.1|1679979_1680576_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_027242821.1|1680578_1682573_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_017377185.1|1682636_1683575_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_036771332.1|1683923_1684898_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_080999986.1|1685101_1685299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000007.1|1685460_1685865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816928.1|1687448_1687889_+	universal stress protein	NA	NA	NA	NA	NA
WP_048875996.1|1688215_1689091_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420669.1|1689103_1689346_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275315.1|1689752_1690007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1691218_1692184_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420668.1|1692276_1692588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1692788_1693565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816899.1|1694394_1694586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377573.1|1695314_1696364_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_017377574.1|1696534_1697308_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377575.1|1697368_1698958_-	APC family permease	NA	NA	NA	NA	NA
WP_017377576.1|1699148_1700240_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377577.1|1700262_1700580_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377578.1|1700666_1701944_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377579.1|1701965_1702802_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377580.1|1702808_1704443_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_026063647.1|1704874_1705234_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377583.1|1705515_1706874_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_017377584.1|1706899_1707142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|1707635_1707815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|1708070_1709327_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377585.1|1709440_1709698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420667.1|1709842_1710853_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_144420786.1|1711229_1712084_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|1712113_1712947_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_036773204.1|1713523_1714297_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_047927606.1|1714378_1714699_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_144420665.1|1714917_1715823_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_048875992.1|1715908_1716307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|1716451_1716949_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047927093.1|1718609_1719713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929549.1|1719811_1720189_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1720268_1721243_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_080999985.1|1722787_1723507_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1723590_1723878_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420664.1|1724162_1725035_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_048875990.1|1724991_1725768_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036816484.1|1725972_1726308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963600.1|1726706_1727063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377440.1|1727224_1727500_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_017377441.1|1727609_1727957_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377442.1|1727974_1728754_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377443.1|1728753_1729263_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|1729298_1729547_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377444.1|1729858_1730194_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_017377445.1|1730493_1731744_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242820.1|1731825_1733853_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377447.1|1734398_1734617_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242819.1|1734788_1735151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|1735299_1736703_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242818.1|1736984_1738160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377453.1|1738177_1740175_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242817.1|1740155_1741136_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075275308.1|1741191_1742034_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_036772544.1|1742033_1742450_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275307.1|1742430_1742850_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017377459.1|1742872_1743502_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017377460.1|1744070_1746260_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377461.1|1746271_1747477_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_080963599.1|1747461_1749309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106215.1|1749293_1750532_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242814.1|1750518_1752387_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_027242813.1|1752420_1753674_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017377465.1|1753679_1754537_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_017377694.1|1754555_1755284_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_081078114.1|1756422_1757214_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017376231.1|1757579_1757867_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017376477.1|1759989_1760379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376476.1|1760555_1761314_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_036772166.1|1761310_1763710_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_027242812.1|1763723_1765001_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_017376475.1|1765090_1766389_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_017376474.1|1766586_1767480_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_027242811.1|1767479_1768694_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 20
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	1779393	1829878	3190249	tRNA,transposase	Vibrio_phage(14.29%)	46	NA	NA
WP_069971651.1|1779393_1780269_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376461.1|1780641_1780905_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_017376460.1|1781211_1783806_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376459.1|1783802_1784285_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_017376458.1|1784262_1785303_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376457.1|1785477_1785963_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376456.1|1786070_1788641_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376455.1|1788674_1789136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773947.1|1789472_1790348_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376452.1|1790625_1792386_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_017376451.1|1792479_1793145_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376450.1|1793157_1794663_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376449.1|1794684_1795215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376448.1|1795288_1796551_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376447.1|1796737_1797610_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_026063532.1|1797711_1798500_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376445.1|1798592_1799918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376444.1|1800271_1801447_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376443.1|1801615_1802269_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376442.1|1802424_1804365_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_036773538.1|1804361_1804985_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036773116.1|1805149_1806124_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_075275305.1|1806395_1807016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1807012_1808416_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910640.1|1808483_1808900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875986.1|1809307_1809805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1809801_1810776_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046598.1|1810855_1811425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1811569_1812106_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375549.1|1812110_1812407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1812415_1813021_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017378212.1|1813206_1813605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1813795_1813999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046599.1|1814143_1814299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378213.1|1814423_1814876_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017378214.1|1814992_1816465_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_016211840.1|1816903_1817368_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_144420785.1|1818056_1819307_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_017378219.1|1819416_1819887_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_047927040.1|1819909_1820503_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_027242798.1|1820640_1821690_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_017378221.1|1821713_1822637_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1822653_1823115_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378223.1|1823222_1824041_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155046600.1|1824650_1824794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378228.1|1828957_1829878_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 21
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	1892141	1907457	3190249	transposase	Staphylococcus_phage(50.0%)	15	NA	NA
WP_017378288.1|1892141_1892363_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1892421_1893396_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046582.1|1893594_1893759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|1893755_1894391_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420659.1|1894667_1895447_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420658.1|1895479_1896241_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_075275303.1|1896217_1897207_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378290.1|1897342_1898218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|1898236_1898896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927801.1|1899137_1899584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1899580_1900984_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378294.1|1901097_1901943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1902087_1903737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378296.1|1903827_1904613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875980.1|1906053_1907457_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	1936130	1985002	3190249	tRNA,transposase	uncultured_Mediterranean_phage(33.33%)	43	NA	NA
WP_144420657.1|1936130_1937192_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420656.1|1937903_1938065_+	phosphatase	NA	NA	NA	NA	NA
WP_017376418.1|1938981_1939521_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_017376419.1|1939903_1940320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|1940415_1941231_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376421.1|1941363_1942857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|1943042_1943468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376423.1|1943464_1945525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376424.1|1945808_1946624_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376425.1|1946724_1947543_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_027242802.1|1947539_1947908_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_075275409.1|1948089_1948917_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|1948980_1949709_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1950111_1950840_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017376428.1|1951229_1951955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875975.1|1951989_1955862_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376430.1|1956062_1957196_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_026063530.1|1957209_1957398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376433.1|1957621_1958980_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_036773947.1|1960586_1961462_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875973.1|1961973_1962609_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999981.1|1962621_1963095_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_155046603.1|1963022_1963175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929627.1|1963368_1963719_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1963778_1964066_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420654.1|1964118_1964898_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376415.1|1965322_1966240_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376414.1|1966291_1967047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242801.1|1967114_1968389_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376412.1|1968509_1969187_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017376411.1|1969387_1970812_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_016209938.1|1970786_1971425_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376410.1|1971787_1972066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376409.1|1972299_1973244_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376408.1|1973265_1975134_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376407.1|1975154_1975508_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_026063528.1|1975546_1976662_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376405.1|1976846_1977887_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_027242800.1|1977889_1978924_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_017376402.1|1978920_1979982_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_017376401.1|1980093_1981566_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
WP_017376400.1|1981718_1982162_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017376399.1|1982230_1985002_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
>prophage 23
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	1989433	2038300	3190249	transposase	Staphylococcus_phage(25.0%)	45	NA	NA
WP_036773116.1|1989433_1990408_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376395.1|1990931_1993658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|1994545_1995520_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_051929562.1|1995770_1996475_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377436.1|1997714_1998233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242883.1|1999200_2000685_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_017377433.1|2000809_2002345_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017377432.1|2002367_2002697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963636.1|2002593_2002809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910639.1|2004792_2005992_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017377428.1|2006201_2007062_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_017377427.1|2007177_2007756_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_017377426.1|2007912_2008554_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	3.3e-07
WP_017377425.1|2008592_2008814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377424.1|2008806_2009790_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	6.2e-53
WP_080963565.1|2010183_2010681_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026063633.1|2010825_2011101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377423.1|2011252_2012935_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.1e-24
WP_017377422.1|2012942_2013965_-	YHYH protein	NA	NA	NA	NA	NA
WP_017377421.1|2014133_2015135_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_017377420.1|2015248_2015587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377419.1|2016062_2017322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2017530_2017758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420653.1|2017786_2018005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772807.1|2018142_2018508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772810.1|2018575_2018818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242887.1|2018832_2019168_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_017377418.1|2019172_2019610_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_036772812.1|2019635_2021021_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_036772815.1|2021131_2021563_-	flaG family protein	NA	NA	NA	NA	NA
WP_144420782.1|2021668_2023180_-	B-type flagellin	NA	NA	NA	NA	NA
WP_017377414.1|2023470_2025063_-	flagellin	NA	NA	NA	NA	NA
WP_027242888.1|2025263_2027459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772819.1|2027552_2028986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927084.1|2029028_2029544_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036772822.1|2029543_2030491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242892.1|2030474_2031140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242893.1|2031136_2031865_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047927085.1|2031854_2032601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963566.1|2032584_2033649_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_017377789.1|2033853_2035041_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377788.1|2035097_2036216_-	hypothetical protein	NA	A0A1V0SIK8	Klosneuvirus	29.3	1.0e-11
WP_047927086.1|2036663_2036921_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
WP_144420652.1|2037200_2037878_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_017375591.1|2038096_2038300_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	2058000	2107535	3190249	protease,tRNA,transposase	Burkholderia_virus(20.0%)	41	NA	NA
WP_017377787.1|2058000_2058228_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377765.1|2058317_2059073_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377764.1|2059486_2060083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377763.1|2060162_2062967_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377762.1|2062947_2063901_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377761.1|2063893_2065264_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_080999971.1|2065434_2066838_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275295.1|2067609_2067936_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420651.1|2068140_2068794_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_017376600.1|2069113_2069293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|2069548_2070805_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999979.1|2071043_2071190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081049196.1|2071272_2071629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|2072124_2072484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375623.1|2072493_2072877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|2073765_2073906_+	phosphatase	NA	NA	NA	NA	NA
WP_048875965.1|2074050_2074971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377998.1|2077128_2077659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243145.1|2077669_2078725_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_036773465.1|2078740_2080780_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_017378003.1|2080766_2081597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378004.1|2081663_2085203_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378005.1|2085316_2086036_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378006.1|2086274_2086904_+	response regulator	NA	NA	NA	NA	NA
WP_048875961.1|2087023_2088427_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378007.1|2088572_2090516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|2091033_2091894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|2092329_2094075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420648.1|2094477_2095950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|2096132_2096732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|2096869_2097067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|2097267_2097408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875964.1|2097475_2098255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|2098819_2099221_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773793.1|2099365_2099743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|2100202_2101510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619530.1|2102258_2102516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2102567_2103971_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377869.1|2104211_2105921_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377870.1|2106090_2106453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875960.1|2106560_2107535_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 25
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	2122104	2181657	3190249	transposase,protease,tRNA	unidentified_phage(14.29%)	60	NA	NA
WP_017377892.1|2122104_2123526_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_026063687.1|2123615_2125214_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377894.1|2125370_2125997_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_027242839.1|2126077_2128750_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377896.1|2129232_2130189_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_017377897.1|2130241_2130661_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_048875958.1|2130687_2131551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377899.1|2131540_2132332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|2132636_2133608_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375746.1|2133956_2134265_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_048875957.1|2134261_2134918_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375749.1|2135051_2135537_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_017375750.1|2135614_2136136_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375751.1|2136181_2137075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|2137071_2137893_-	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_155046605.1|2138087_2138237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|2138464_2139295_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046606.1|2140700_2140871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242841.1|2141023_2142427_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_048875956.1|2142536_2143778_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080963644.1|2143764_2144496_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_017376088.1|2144507_2145785_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_017376087.1|2145884_2146259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376086.1|2146343_2147231_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376085.1|2147288_2148017_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_036771725.1|2148013_2149123_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376083.1|2149274_2149703_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_144420777.1|2149797_2150154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376081.1|2150146_2151358_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376080.1|2151354_2152143_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376079.1|2152305_2153100_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376078.1|2153549_2154290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376077.1|2154293_2156792_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376076.1|2157054_2158011_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_036771709.1|2157994_2158756_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_048875955.1|2158963_2159938_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_048875954.1|2160046_2160802_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2160926_2161172_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_017376072.1|2161231_2163505_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_036772670.1|2163559_2163862_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_016211261.1|2164102_2164396_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_065653731.1|2164566_2164746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420644.1|2164821_2165433_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376068.1|2165679_2166996_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2167006_2167375_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376067.1|2167405_2168068_-	adenylate kinase	NA	NA	NA	NA	NA
WP_144420776.1|2168490_2169069_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376065.1|2169048_2169456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999977.1|2169579_2169876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2169922_2170798_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876123.1|2170867_2173048_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_017376060.1|2173151_2174501_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_036772012.1|2174574_2175264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|2175396_2176584_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376055.1|2177102_2177747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|2177743_2179057_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|2179261_2179435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|2179704_2180178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420642.1|2180322_2180517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|2180781_2181657_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	2200719	2248942	3190249	tRNA,transposase	Staphylococcus_phage(16.67%)	41	NA	NA
WP_036771639.1|2200719_2201694_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875951.1|2201737_2202574_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376035.1|2202719_2203139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|2203415_2204096_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875949.1|2204061_2204412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376032.1|2204444_2205656_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376031.1|2205996_2206626_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376030.1|2206674_2207691_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_016211035.1|2207937_2208153_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376029.1|2208205_2208655_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_027243175.1|2208734_2210480_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376026.1|2210571_2212443_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_053093667.1|2212887_2213604_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378197.1|2215041_2215911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2215867_2216095_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378198.1|2217063_2217978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875948.1|2218023_2219046_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_048875947.1|2219114_2220164_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046689.1|2220786_2220963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243219.1|2221247_2221556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2221722_2223126_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046608.1|2223218_2223383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771959.1|2223704_2223929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|2223939_2225151_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036774710.1|2225545_2226445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375571.1|2226618_2227020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|2227266_2228310_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376859.1|2228429_2228666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376860.1|2229454_2231008_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_082300723.1|2233188_2233416_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971648.1|2234286_2235261_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_017375736.1|2235987_2237070_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_017375735.1|2237112_2237763_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375734.1|2237985_2238357_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_027243178.1|2238467_2239829_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_155046609.1|2241549_2241756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2242066_2243149_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2243145_2243457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2244502_2245477_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999976.1|2246483_2247263_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|2247724_2248942_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	2261791	2322759	3190249	integrase,transposase	Staphylococcus_phage(30.0%)	47	2269644:2269703	2320065:2320825
WP_144420638.1|2261791_2262874_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2262870_2263182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243152.1|2264679_2265615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774146.1|2266207_2267353_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_048875940.1|2269595_2270759_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
2269644:2269703	attL	GTCTTAGAGGTCATTGAAGGAGATCAGACGCTCAACCAAATATGCTCGAAATATGAGCTA	NA	NA	NA	NA
WP_144420637.1|2270787_2271012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|2272359_2273535_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420636.1|2273880_2276391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|2276449_2277262_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377669.1|2277702_2278407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2278456_2279431_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420634.1|2279535_2280867_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420774.1|2281065_2281134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375857.1|2281265_2282708_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420773.1|2283099_2284512_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375855.1|2285201_2285648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|2286242_2287091_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017376916.1|2287344_2288403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927497.1|2288394_2290101_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_036774028.1|2290172_2291906_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_017376912.1|2292202_2292769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376911.1|2292893_2293547_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_027243158.1|2293573_2295034_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376909.1|2295130_2296108_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_048875878.1|2296577_2297981_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063577.1|2298506_2298800_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_026063576.1|2299026_2299791_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_017376905.1|2299998_2300226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|2300289_2300472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376903.1|2301034_2301214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046690.1|2301256_2301589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|2302443_2303148_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376899.1|2303345_2303486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772665.1|2303890_2304415_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144420633.1|2304561_2305818_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|2305885_2306365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2306805_2308209_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420632.1|2308623_2310939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377475.1|2311511_2313404_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_036771639.1|2313575_2314550_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377472.1|2314853_2315660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377471.1|2315728_2316340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377467.1|2317821_2318118_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_075275282.1|2318114_2318957_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|2319347_2320133_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_080999974.1|2320137_2321541_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2320065:2320825	attR	TAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCCTTCAATGACCTCTAAGACTAATGGCACTACCTTAAGGAGCGGATGAACATTTTTTATTGCTATTTTTCTTCATTCTTTTAGTTATTTCTGCCTTTTCCAATTCCCTGCTTTTATTCAGTCGCCTGAATGCTTTGGGACGTTTTTTAACAGCCCGAGGTTCAATCCGTCCAGGCCTATTCCCAACCTTGTTTTTTATGATTGCATGCAACAATATTGCATGGGCTTTATTACAGTCTGCCGAGAAACTGAGTAATGACACAAAGCTATTAAATAACTGTATTACATCCTTGAAACTAACCTGTATAGGAAGGCGTTCAGTATTACGACAAGCTTCTGCAATAAGCGTTCTAATTAAGTTGTATGCTAAAAAGTGTACTGCAATTTCTTTATGTACCATGTCAGGTGTCTTACTTCTTAAATGATCCATTGACATAATGGTTTTTAAGCTGTTGAAATTGATTTCAATGTGCCACCTTTGTTTGTAATGATTAGCCAATGCAACTTTATTGTATTTTTTATGATCTTGAAAAGTTGTTACATAAACCTCCCCTTTGATTTTGAACTCTCTTACCGTCATTTGATCAGGATAACTATCGTATGTTTCTTGTGTCATCCAGTCAGGTTTGTGAGGCTTTTTCCAAATGACAAGGTGATTTTTTGAACCCAACTTCCTTCCTTTACGAAAGTCATACTTCCTCTGTGAATGTGCTTTAAAAATA	NA	NA	NA	NA
WP_048875933.1|2321814_2322759_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	2343601	2371254	3190249	protease,transposase	Staphylococcus_phage(25.0%)	28	NA	NA
WP_017377305.1|2343601_2344903_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_016209647.1|2344984_2345590_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377304.1|2345702_2347007_-	trigger factor	NA	NA	NA	NA	NA
WP_017377303.1|2347607_2348483_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_075275279.1|2348598_2349270_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377301.1|2349449_2350805_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_017377300.1|2350925_2351663_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_144420629.1|2351741_2352458_-	aldolase	NA	NA	NA	NA	NA
WP_036771756.1|2353106_2354381_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2354411_2354987_+	VOC family protein	NA	NA	NA	NA	NA
WP_017377295.1|2355031_2355997_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_027243030.1|2356460_2357369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046610.1|2357681_2358008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377293.1|2358152_2358581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|2358566_2359511_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046611.1|2359715_2359868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910637.1|2359896_2360631_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_017377288.1|2360725_2360986_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999973.1|2361204_2362170_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_146619452.1|2362146_2362443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|2362633_2363083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|2363342_2363771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|2363866_2364367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|2364303_2364465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420627.1|2365345_2365567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093666.1|2367065_2367743_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_081377824.1|2369057_2369396_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2370279_2371254_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 29
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	2410499	2482439	3190249	tRNA,transposase	Staphylococcus_phage(37.5%)	53	NA	NA
WP_080999971.1|2410499_2411903_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377224.1|2412016_2412592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|2413837_2414065_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377221.1|2414354_2414894_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_027243151.1|2415203_2416691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300719.1|2416742_2417168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2417386_2418790_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377217.1|2418786_2419164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243150.1|2419123_2419669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|2420064_2421291_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377214.1|2421891_2423544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046613.1|2423480_2423675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963645.1|2424007_2425198_-	MFS transporter	NA	NA	NA	NA	NA
WP_027243147.1|2425446_2428119_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_027243146.1|2428407_2429244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420769.1|2429904_2430795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2431263_2432238_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876012.1|2432722_2434126_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|2434271_2435675_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420624.1|2435759_2437574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999970.1|2439485_2440889_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376197.1|2440922_2442452_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_017376198.1|2442487_2443948_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_027242908.1|2443922_2444882_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_017376200.1|2444959_2448466_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.6	1.9e-192
WP_017376201.1|2448489_2449059_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	43.4	3.4e-27
WP_027242907.1|2449272_2450427_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_017376204.1|2450445_2451219_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|2451218_2451665_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017376206.1|2451682_2452732_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_017376207.1|2452842_2453376_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_036771893.1|2453456_2455874_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_027242906.1|2456158_2457226_+	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_017376209.1|2459428_2460493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376210.1|2460482_2461511_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_017376211.1|2461507_2462047_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_017376212.1|2462583_2464494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420622.1|2464938_2466516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771906.1|2466612_2467488_-	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_080963646.1|2467576_2468476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063514.1|2468390_2469137_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.0	6.6e-23
WP_017376216.1|2469144_2469702_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_017376217.1|2469705_2470443_-	UMP kinase	NA	NA	NA	NA	NA
WP_017376218.1|2470446_2471325_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_017376219.1|2471489_2472257_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_017376220.1|2472663_2473473_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376221.1|2473550_2476208_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_017376222.1|2476211_2477249_+	asparaginase	NA	NA	NA	NA	NA
WP_017376223.1|2477250_2478072_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376224.1|2478202_2479087_+	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_036773116.1|2479399_2480374_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|2480426_2481422_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2481464_2482439_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 30
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	2493171	2548800	3190249	transposase,tRNA	Burkholderia_virus(28.57%)	53	NA	NA
WP_017376309.1|2493171_2493459_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_017376308.1|2493579_2495040_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_027242902.1|2495119_2496556_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_036771325.1|2496680_2497655_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420621.1|2499845_2500607_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2501764_2501992_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377706.1|2502945_2503158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|2503175_2503493_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242901.1|2503519_2504209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377709.1|2504549_2504753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420768.1|2504884_2505820_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047927332.1|2505832_2506615_-	lipoprotein	NA	NA	NA	NA	NA
WP_017377712.1|2506744_2507056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242900.1|2507399_2507726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377714.1|2507750_2508206_-	arginine repressor	NA	NA	NA	NA	NA
WP_017377715.1|2508195_2509248_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377716.1|2509250_2510714_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377787.1|2510848_2511076_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377718.1|2512492_2512957_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036773913.1|2513213_2514029_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377721.1|2514157_2516470_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_017377722.1|2516586_2517114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377723.1|2517805_2519083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377724.1|2519093_2519345_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377725.1|2519378_2519900_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377726.1|2520069_2521056_-	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377727.1|2521146_2521962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773915.1|2522390_2522786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2522758_2522986_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_047927746.1|2523954_2524542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|2525144_2525816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875918.1|2525960_2526542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420767.1|2526584_2527262_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243185.1|2527540_2528497_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_017377736.1|2528556_2529222_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017377737.1|2529255_2529801_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_155046615.1|2530080_2530242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774946.1|2530938_2531553_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_144420620.1|2531479_2532682_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875923.1|2532667_2533663_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875916.1|2533666_2534071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2535038_2535266_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971647.1|2536234_2536831_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875914.1|2536799_2537960_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_017375625.1|2538664_2538892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875913.1|2538888_2539659_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_017377194.1|2539655_2540969_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_027243130.1|2541893_2542763_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	9.3e-69
WP_017377197.1|2542759_2544109_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	3.0e-74
WP_017377198.1|2544221_2545862_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_027243131.1|2546247_2546514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377200.1|2546643_2546832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2547396_2548800_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	2552795	2598810	3190249	transposase,tRNA	Bacillus_phage(20.0%)	50	NA	NA
WP_017377840.1|2552795_2553515_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_027243134.1|2553676_2553883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243135.1|2553882_2554119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|2554131_2554485_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243136.1|2555022_2555856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377835.1|2555948_2556146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063682.1|2556243_2557629_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377833.1|2557755_2558346_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_017377223.1|2559377_2559665_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2559724_2559889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|2559885_2561256_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|2561622_2563035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|2563104_2563875_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_027243138.1|2564367_2564655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|2566131_2566425_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_144420618.1|2566382_2567204_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_026063680.1|2567348_2567573_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155046618.1|2567827_2568355_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_080999968.1|2568531_2568792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420617.1|2568710_2568866_+	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|2568964_2569939_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999967.1|2571267_2571417_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377700.1|2571533_2571827_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017376598.1|2572635_2573211_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|2573288_2574164_-	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376596.1|2574228_2574849_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027243040.1|2574833_2575916_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376593.1|2576149_2576554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376591.1|2578044_2579346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376590.1|2579492_2580161_+	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_144420764.1|2581093_2581657_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376588.1|2581713_2582910_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_017376587.1|2583034_2584399_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376586.1|2584395_2585487_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376585.1|2585741_2586392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|2586584_2586779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|2586886_2587039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376583.1|2587305_2588433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063543.1|2588522_2589356_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376581.1|2589359_2590010_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_017376580.1|2589999_2590839_-	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_016210074.1|2590844_2591471_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376579.1|2591631_2592174_+	septation protein A	NA	NA	NA	NA	NA
WP_017376578.1|2592257_2592560_+	YciI family protein	NA	NA	NA	NA	NA
WP_144420763.1|2592577_2592820_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376576.1|2592918_2593191_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_017376575.1|2593229_2593868_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376574.1|2593900_2594992_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376573.1|2595163_2596906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2597835_2598810_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 32
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	2608104	2671906	3190249	tRNA,transposase	Staphylococcus_phage(38.46%)	57	NA	NA
WP_080999966.1|2608104_2609454_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242585.1|2609751_2610309_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376558.1|2610402_2610909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376557.1|2611413_2612109_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_144420615.1|2612239_2613028_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_048876031.1|2613061_2614465_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875857.1|2614888_2615863_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017377787.1|2616119_2616347_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377821.1|2617434_2617965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377820.1|2617961_2619494_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2619490_2620441_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2620861_2621494_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2621736_2621934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2622283_2622712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|2622789_2623785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856754.1|2623929_2624181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|2624285_2624930_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2625165_2625663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2626174_2627149_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017377700.1|2627519_2627813_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017375632.1|2628625_2628961_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377815.1|2629281_2630820_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_144420614.1|2630972_2632071_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_036773165.1|2632309_2633509_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_027243005.1|2633539_2634166_+	ribonuclease T	NA	NA	NA	NA	NA
WP_017377811.1|2634194_2635079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275272.1|2635212_2635443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|2635580_2636822_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_144420613.1|2637101_2637473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|2639604_2639766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|2640141_2641269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|2641385_2642048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|2642133_2642394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|2642812_2643574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377799.1|2645635_2646295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377798.1|2646395_2647046_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_075275388.1|2647193_2647883_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377795.1|2647905_2649069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|2649273_2649525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619442.1|2650048_2650711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2650844_2651819_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376009.1|2653173_2653464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376008.1|2653786_2654824_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376007.1|2654854_2656309_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376006.1|2656318_2657503_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376005.1|2657576_2658584_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376004.1|2658652_2660656_-	transketolase	NA	NA	NA	NA	NA
WP_017376003.1|2661107_2662268_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_017376001.1|2662504_2663620_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376000.1|2663782_2664307_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_017375999.1|2664306_2664837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2666496_2667372_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420759.1|2667492_2667993_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376501.1|2667989_2668256_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_048875903.1|2668421_2669396_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_075275269.1|2669575_2670196_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|2670502_2671906_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	2681408	2726565	3190249	tRNA,transposase	Staphylococcus_phage(21.43%)	41	NA	NA
WP_048875901.1|2681408_2682383_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017377273.1|2682917_2683157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420610.1|2683150_2684530_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	3.3e-36
WP_017377275.1|2685564_2686287_+	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377276.1|2686278_2686647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243089.1|2686909_2688211_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377277.1|2688306_2688750_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_017377278.1|2688753_2689263_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377279.1|2689255_2692069_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_048875900.1|2692565_2693498_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377282.1|2693602_2694529_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_017377283.1|2694707_2696246_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2696419_2696680_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377686.1|2697954_2698563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2698609_2699338_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_155046620.1|2699584_2699722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619438.1|2700872_2701424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|2701658_2702570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377698.1|2702829_2703126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910634.1|2703470_2704624_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377702.1|2705220_2705769_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_144420757.1|2705872_2706436_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377704.1|2706653_2707412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|2708687_2708915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|2709137_2709317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971672.1|2709572_2710829_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875897.1|2710896_2711541_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_017378393.1|2712345_2712552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378392.1|2712822_2712975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816949.1|2713552_2713951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378390.1|2714144_2715722_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_017378389.1|2715855_2716797_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378388.1|2716798_2717572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963621.1|2719180_2719387_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_016211707.1|2719653_2719941_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_017378384.1|2719946_2722328_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378383.1|2722340_2723336_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_016210495.1|2723467_2723827_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378382.1|2723869_2724064_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075273353.1|2724098_2724629_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378381.1|2724633_2726565_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
>prophage 34
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	2764343	2817372	3190249	transposase	Staphylococcus_phage(50.0%)	45	NA	NA
WP_048875857.1|2764343_2765318_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378343.1|2765474_2767049_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_017378342.1|2767273_2767552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378341.1|2767621_2768497_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_016210208.1|2768506_2769667_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_017378340.1|2769781_2770930_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_017378339.1|2770940_2773742_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_017378338.1|2773848_2774547_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_017378337.1|2774559_2776323_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_016210223.1|2776326_2776674_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_017378336.1|2776667_2777042_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_017378335.1|2777989_2779273_+	citrate synthase	NA	NA	NA	NA	NA
WP_017378334.1|2779682_2780978_+	MFS transporter	NA	NA	NA	NA	NA
WP_017378333.1|2781333_2781879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046622.1|2782472_2782988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420607.1|2782999_2784379_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_017378329.1|2784614_2785049_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_017378328.1|2785045_2786398_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_027242734.1|2786397_2787513_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_017378326.1|2787513_2788530_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_017378325.1|2788519_2790190_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_017378324.1|2790209_2790545_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_036772382.1|2790572_2792012_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_047927447.1|2792008_2793055_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017378320.1|2793197_2794694_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017378319.1|2794989_2795991_+	glucokinase	NA	NA	NA	NA	NA
WP_080963617.1|2796096_2796708_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_144420755.1|2796828_2797206_-	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_027242736.1|2797256_2798663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378315.1|2798656_2799724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378314.1|2799830_2801432_-	APC family permease	NA	NA	NA	NA	NA
WP_027242737.1|2801680_2802598_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242738.1|2802666_2804361_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.3e-20
WP_017378310.1|2804595_2805525_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048876031.1|2805555_2806959_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378308.1|2807189_2807894_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_017378307.1|2807960_2808617_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_036774478.1|2808627_2809509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242739.1|2809679_2812349_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036771639.1|2812709_2813684_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_036771744.1|2813763_2814735_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2814788_2815763_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772729.1|2815882_2816104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420754.1|2816167_2816476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|2816400_2817372_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	2831938	2886199	3190249	transposase	Staphylococcus_phage(37.5%)	51	NA	NA
WP_026063658.1|2831938_2832667_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_027243070.1|2832976_2833231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2833944_2836599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378171.1|2836637_2836928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2837044_2838343_+	MFS transporter	NA	NA	NA	NA	NA
WP_036772686.1|2838913_2839402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420604.1|2839382_2839685_+	VUT family protein	NA	NA	NA	NA	NA
WP_075275265.1|2839931_2840420_+	VUT family protein	NA	NA	NA	NA	NA
WP_027243073.1|2840453_2841092_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243074.1|2841213_2841753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2841842_2843069_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_155046619.1|2843681_2843939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420603.1|2844025_2844925_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420602.1|2845069_2845336_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2845327_2845477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2845704_2846580_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2846709_2846937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815640.1|2847003_2847198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2847256_2848231_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963634.1|2848268_2848457_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_017376778.1|2848457_2850230_-	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_144420601.1|2850219_2851212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376776.1|2851819_2852512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376774.1|2852998_2853568_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_036771639.1|2853564_2854539_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_080999963.1|2854578_2855082_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155069744.1|2855172_2856576_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2857274_2857460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|2857565_2858969_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046624.1|2859015_2859546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375939.1|2859579_2861007_-	amino acid permease	NA	NA	NA	NA	NA
WP_036772717.1|2862292_2864662_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.4	3.7e-160
WP_017375937.1|2864737_2865556_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_027243188.1|2865907_2866453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971669.1|2866935_2868174_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2868150_2869125_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017375625.1|2869217_2869445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376551.1|2869449_2869941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243039.1|2870613_2871501_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_027243038.1|2871590_2873081_-	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_017376549.1|2873104_2873986_-	ROK family protein	NA	NA	NA	NA	NA
WP_017376548.1|2873982_2874705_-	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376547.1|2875404_2876196_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016210862.1|2876382_2876628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420598.1|2876779_2877010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376543.1|2877039_2877819_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_047927468.1|2877844_2878150_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_144420752.1|2878146_2879040_-	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_027243035.1|2879395_2880694_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376538.1|2883296_2884478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|2884771_2886199_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 36
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	2893785	2943942	3190249	tRNA,transposase	Bodo_saltans_virus(14.29%)	43	NA	NA
WP_062312049.1|2893785_2895153_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243033.1|2895645_2896125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875888.1|2896304_2898368_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_144420751.1|2898376_2899102_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_017375919.1|2899729_2900443_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017375920.1|2900447_2900978_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375921.1|2901212_2901446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971668.1|2901558_2901807_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_144420596.1|2902614_2904807_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_017375924.1|2904824_2905133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2905786_2907496_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017378284.1|2907689_2907845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2909247_2910123_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243077.1|2910448_2911210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2911434_2912166_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_017376852.1|2912162_2912699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376851.1|2912752_2913517_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376850.1|2913519_2915097_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376849.1|2915103_2915580_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2915555_2915987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376847.1|2916019_2916775_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|2916949_2917237_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_027243078.1|2917619_2917844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155073361.1|2918183_2918387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243079.1|2919669_2920647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2920640_2921327_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017376843.1|2921265_2922381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2922660_2923266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420595.1|2923503_2923983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2925805_2926459_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_027243083.1|2926571_2927123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2927222_2928197_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243084.1|2928482_2929007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376838.1|2929704_2930529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875886.1|2930784_2931141_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053856766.1|2931137_2932541_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243085.1|2932660_2933221_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_017376236.1|2933378_2933945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243087.1|2936933_2937629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376234.1|2937669_2937882_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376229.1|2939454_2940564_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376228.1|2940619_2942101_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_048876031.1|2942538_2943942_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 37
NZ_CP039081	Piscirickettsia salmonis strain Psal-110 chromosome, complete genome	3190249	3071625	3136874	3190249	protease,transposase	Hokovirus(14.29%)	56	NA	NA
WP_017376170.1|3071625_3072726_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
WP_017376171.1|3073083_3074058_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771588.1|3074194_3075073_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_016209597.1|3075080_3075311_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771607.1|3075364_3076369_-	OmpA family protein	NA	NA	NA	NA	NA
WP_036771589.1|3076587_3077415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420747.1|3077496_3078885_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_017376176.1|3079172_3080573_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_017376177.1|3080667_3081594_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_027242699.1|3081590_3082727_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_027242700.1|3082723_3083731_-	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242701.1|3083727_3084891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376183.1|3084900_3085752_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242702.1|3085783_3086956_-	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_065653741.1|3086952_3088341_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_017376186.1|3088369_3088777_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_017376187.1|3088796_3089804_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376188.1|3089800_3090673_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_036771610.1|3090669_3091530_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_065653742.1|3091531_3093802_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_017376192.1|3093803_3094949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376193.1|3094995_3095481_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_027242703.1|3095520_3096144_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376237.1|3101823_3102576_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155046626.1|3103178_3103346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243062.1|3103907_3104531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243063.1|3104635_3105424_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243064.1|3105423_3106155_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376241.1|3106188_3107916_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_017376242.1|3107929_3108991_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376243.1|3109305_3110520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376244.1|3110652_3111177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063518.1|3111794_3112643_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376247.1|3112629_3113328_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_017376248.1|3113382_3114144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376249.1|3114136_3114559_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376250.1|3114688_3115240_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376251.1|3115295_3116258_-	TonB family protein	NA	NA	NA	NA	NA
WP_144420746.1|3116258_3116474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376253.1|3116660_3117470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|3117449_3118292_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376255.1|3118288_3119533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376256.1|3119671_3120760_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376257.1|3120777_3121278_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376258.1|3121465_3122065_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376259.1|3122070_3123234_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376260.1|3123266_3124220_+	glutathione synthase	NA	NA	NA	NA	NA
WP_017376261.1|3124583_3125648_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027243065.1|3125644_3128707_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_144420745.1|3128859_3129312_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243066.1|3129343_3129700_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772645.1|3130118_3130892_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376269.1|3133515_3133806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|3134030_3134906_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|3134902_3135460_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|3135470_3136874_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039082	Piscirickettsia salmonis strain Psal-110 plasmid unnamed1, complete sequence	177162	0	42185	177162	transposase,integrase	Streptococcus_phage(53.85%)	39	15447:15506	36451:36740
WP_017377655.1|1412_1658_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|1654_2041_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772434.1|2128_2857_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_080963659.1|2835_3456_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377658.1|3801_4488_+	Fic family protein	NA	NA	NA	NA	NA
WP_082304501.1|5437_5800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|5802_7542_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046629.1|7943_8096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929558.1|8123_8807_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_036771347.1|8888_9866_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_081000019.1|9941_10112_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|10152_10881_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_036771293.1|11426_11693_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420835.1|11988_13902_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017377694.1|14308_15037_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_080999960.1|15104_15257_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
15447:15506	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_155046630.1|15673_15838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375754.1|15858_17145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155073372.1|17327_18056_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	6.0e-37
WP_036771347.1|18183_19161_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_144420843.1|20242_22126_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|22866_23844_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017375911.1|24610_24862_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A077SL39	Escherichia_phage	53.3	6.5e-07
WP_017375910.1|24864_25593_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017375909.1|25881_26571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036775032.1|26618_27434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046632.1|29443_29593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126795.1|30065_30326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772441.1|30329_30602_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_017375910.1|30677_31406_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_048876229.1|31975_32947_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048876208.1|33811_34639_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_036771289.1|35492_35963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046633.1|36856_37000_-	hypothetical protein	NA	NA	NA	NA	NA
36451:36740	attR	AAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGATGGAAGTAGTACAGTGAAGTTAGCCATTCGTGTTAAACAAAAATTGCTCAGCTATAAATCGATTTCGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCGATAATTCAAACTCGCTCTTCTTCTGGTATTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAACTTCATTAAAATCCG	NA	NA	NA	NA
WP_027242940.1|38206_38806_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_017375850.1|39159_39936_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_036771279.1|40296_41025_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_155046634.1|41094_41295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876229.1|41213_42185_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039082	Piscirickettsia salmonis strain Psal-110 plasmid unnamed1, complete sequence	177162	48424	53195	177162		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_017375964.1|48424_48850_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
WP_036817204.1|49120_50116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036817201.1|50419_50827_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_017375960.1|50934_51978_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.0	2.2e-77
WP_017375959.1|52279_52513_+	hypothetical protein	NA	A0A0M3LQB1	Mannheimia_phage	45.2	5.1e-06
WP_146619517.1|52650_52803_-	phosphatase	NA	NA	NA	NA	NA
WP_081078123.1|52832_53195_+	HigA family addiction module antidote protein	NA	A0A2I7RIN6	Vibrio_phage	46.6	3.5e-06
>prophage 3
NZ_CP039082	Piscirickettsia salmonis strain Psal-110 plasmid unnamed1, complete sequence	177162	57331	119132	177162	transposase,integrase,portal,terminase	Streptococcus_phage(41.18%)	61	78607:78666	118249:119169
WP_027242929.1|57331_57715_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|57801_58284_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|58286_59618_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_047927581.1|59822_60257_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_087910668.1|60343_60730_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|60767_61502_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|61548_62262_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_144420848.1|63640_63826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243190.1|63829_67174_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017377509.1|67354_68083_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_075275482.1|68176_69151_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_027242596.1|69464_69827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|69866_70376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420849.1|70607_71588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|72053_73031_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|73511_74489_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046636.1|74503_74665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243211.1|74882_75137_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_027243212.1|75126_75414_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_036771347.1|75908_76886_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_048876196.1|76915_78064_-	hypothetical protein	NA	NA	NA	NA	NA
78607:78666	attL	TTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTA	NA	NA	NA	NA
WP_027243215.1|79877_80900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774350.1|81382_82111_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_048876194.1|83350_83884_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_080963665.1|84064_84406_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_080963664.1|84586_84853_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_027243206.1|84925_86791_-	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_047927778.1|86958_87243_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|87586_88315_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046637.1|88396_88888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|89620_89848_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876191.1|91399_91828_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_081000015.1|91763_92150_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|92179_92908_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|92919_93069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|93315_94044_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036774388.1|95421_96384_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027242592.1|96407_96737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|96803_97844_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_144420833.1|97857_98049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774378.1|98253_98823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774316.1|98865_99165_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155046638.1|99161_99626_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774373.1|99899_100628_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_048876188.1|100801_101575_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_027243202.1|102288_103224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|103498_104227_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046639.1|104392_104596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929623.1|104695_108037_+	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_036772541.1|108194_108923_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_144420834.1|109216_109612_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036815648.1|109664_110393_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772541.1|110876_111605_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_027243197.1|111775_112345_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_087910667.1|112349_113033_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_036772541.1|113184_113913_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_080963627.1|113931_114150_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774644.1|115129_116191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|116699_117446_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_027243200.1|117446_117851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|118157_119132_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
118249:119169	attR	TTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGCGCACAAGAAAAACGAGCTAACGCTAAGCAAGGACAAGCTTTTCAACAAATTTCAGAAGAGGAAAAAATGTTGATTCATCAGCGGTTAAGCACTCATACATCCCCCGATGTTATCAGTCAAGAACTTATACGTGAGCATAATATTCAGGTGAGTGAGAGCACGATTTACCGTTATATTTATGATGATAGAGAGCGGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCAGGAAAACCTTATAAGAAGAAGGTGAGTCGTGGTGATCAAACAAAAATACCTAATCGCGTTGGTATTGAACAACGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGTGACCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACTTCTGACAACGGAACAGAGTTTGCCGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAACACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACGGATTTTAATGAAGTTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATCGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCGT	NA	NA	NA	NA
>prophage 4
NZ_CP039082	Piscirickettsia salmonis strain Psal-110 plasmid unnamed1, complete sequence	177162	125082	126704	177162	transposase	Acinetobacter_phage(50.0%)	3	NA	NA
WP_017375632.1|125082_125418_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017375836.1|125612_125816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243203.1|125909_126704_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
>prophage 5
NZ_CP039082	Piscirickettsia salmonis strain Psal-110 plasmid unnamed1, complete sequence	177162	133200	135618	177162	transposase,portal	unidentified_phage(50.0%)	2	NA	NA
WP_048875857.1|133200_134175_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.2e-26
WP_048876221.1|135162_135618_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
>prophage 6
NZ_CP039082	Piscirickettsia salmonis strain Psal-110 plasmid unnamed1, complete sequence	177162	140336	147304	177162	transposase	Streptococcus_phage(100.0%)	7	NA	NA
WP_017377509.1|140336_141065_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_144420837.1|141206_142139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377511.1|142168_142897_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|142899_143172_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|144022_144751_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|144806_145427_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|146575_147304_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 7
NZ_CP039082	Piscirickettsia salmonis strain Psal-110 plasmid unnamed1, complete sequence	177162	153339	154074	177162	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_027243210.1|153339_154074_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.9e-36
>prophage 8
NZ_CP039082	Piscirickettsia salmonis strain Psal-110 plasmid unnamed1, complete sequence	177162	157284	162277	177162	transposase	Streptococcus_phage(66.67%)	5	NA	NA
WP_075275471.1|157284_158259_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.3e-26
WP_155046640.1|158894_159062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876214.1|159030_159759_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.1e-38
WP_017377521.1|160267_160621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|161548_162277_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 9
NZ_CP039082	Piscirickettsia salmonis strain Psal-110 plasmid unnamed1, complete sequence	177162	168641	174544	177162	transposase	Staphylococcus_phage(28.57%)	9	NA	NA
WP_075275473.1|168641_168818_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_027243191.1|168934_169642_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_048876212.1|169595_170474_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_144420840.1|170504_170936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|171318_172023_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_036772541.1|172034_172763_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|172792_173182_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|173204_173933_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|173935_174544_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
>prophage 1
NZ_CP039084	Piscirickettsia salmonis strain Psal-110 plasmid unnamed3, complete sequence	48742	2917	16713	48742	head,transposase,capsid,tail	Moraxella_phage(18.18%)	18	NA	NA
WP_036771347.1|2917_3895_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017375652.1|3922_4351_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242568.1|4409_7100_-	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375789.1|7096_7654_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_144420832.1|7643_8429_-	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375787.1|8358_9030_-|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_017375786.1|9026_9368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771950.1|9360_11439_-|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375784.1|11442_11709_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_017375783.1|11765_12089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375782.1|12090_12513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375781.1|12512_12863_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375780.1|12859_13255_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375779.1|13433_13859_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375778.1|13855_14167_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_027242598.1|14551_15136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275454.1|15149_15689_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_036771639.1|15738_16713_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
>prophage 1
NZ_CP039085	Piscirickettsia salmonis strain Psal-110 plasmid unnamed4, complete sequence	33555	3402	19424	33555	terminase,capsid,integrase,tail,transposase,head	unidentified_phage(35.71%)	21	NA	NA
WP_036771330.1|3402_4377_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212329.1|4912_5503_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_027242955.1|5733_5994_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211078.1|5986_6340_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_069971681.1|6516_7491_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_027242954.1|8023_8389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242953.1|8533_8788_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_080963620.1|8771_9128_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_036771330.1|9225_10200_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242951.1|10825_11692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242950.1|11904_12288_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242949.1|12374_12857_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242948.1|12859_13045_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_036771330.1|13064_14039_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_075275490.1|14135_14528_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242946.1|14563_15145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|15525_16500_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_144420855.1|16573_16789_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027242945.1|17592_18108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242944.1|18453_19011_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242943.1|19007_19424_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
