The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	31805	91594	3195235	transposase,tRNA	Staphylococcus_phage(28.57%)	52	NA	NA
WP_036772169.1|31805_32681_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378444.1|33039_34395_+	chloride channel protein	NA	NA	NA	NA	NA
WP_017378443.1|34486_34993_-	GrpB family protein	NA	NA	NA	NA	NA
WP_017378442.1|34989_35358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378441.1|36760_38545_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_017378440.1|39025_40153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378439.1|40225_40981_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_027242743.1|41017_43711_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.7	9.9e-69
WP_036771562.1|43742_44294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063736.1|44401_45415_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017378435.1|45535_45760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378434.1|46115_46877_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_144420740.1|47019_47814_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875841.1|47958_48711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378433.1|49022_50549_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_065653750.1|50687_51761_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027242742.1|51800_53108_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
WP_017378429.1|53082_54252_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_027242741.1|54306_55032_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_027242740.1|55497_57603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378426.1|57817_58282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420739.1|58301_58811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420738.1|59195_60137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856772.1|60418_61870_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773655.1|62336_62741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|63301_64276_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|65010_65388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|65977_66952_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036773242.1|66991_67546_-	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_017378416.1|67726_68626_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_080963576.1|68630_69257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242705.1|69201_71523_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_016210342.1|71669_72149_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_017378414.1|72145_73297_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_017378413.1|73431_73935_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_026063734.1|74028_75003_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_036773239.1|74992_76306_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_017378410.1|76346_77726_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_080963575.1|77732_79184_+	potassium transporter	NA	NA	NA	NA	NA
WP_016210352.1|79209_79578_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_017378407.1|79596_80664_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_027242707.1|80696_81593_-	DMT family transporter	NA	NA	NA	NA	NA
WP_047927132.1|81589_82426_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_017378404.1|82561_83014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378403.1|83152_83899_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378402.1|83879_84443_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378401.1|84451_84967_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378400.1|85108_87187_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378399.1|87186_88137_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378398.1|89004_89403_+	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_075275373.1|89628_89958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875844.1|90574_91594_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	123076	241144	3195235	protease,transposase,tRNA	Staphylococcus_phage(12.5%)	105	NA	NA
WP_075278722.1|123076_123952_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929698.1|124392_124686_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_017377396.1|124686_124941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242714.1|124957_127450_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_017377399.1|127442_128126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377400.1|128125_129169_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_017377401.1|129168_130398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377402.1|130399_130729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377403.1|130725_131925_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_144420824.1|132037_132427_+	signal peptidase, peptidase S26 family protein	NA	NA	NA	NA	NA
WP_026063632.1|132426_133371_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_017377406.1|133490_134888_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	3.9e-77
WP_017377407.1|135213_135735_+	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	46.2	1.7e-30
WP_017377408.1|135858_136167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875847.1|136181_141404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242717.1|141794_143801_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377568.1|143931_146262_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_144420823.1|146437_147268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773453.1|147384_147780_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_027242719.1|147776_148310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242720.1|148306_148708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875848.1|149102_149423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377563.1|149432_150389_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.5	1.0e-12
WP_017377562.1|150898_151423_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_017377561.1|151523_152522_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_027242721.1|152610_153507_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080963593.1|153580_154867_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377557.1|155326_156643_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377556.1|156756_156927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|156946_157921_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377551.1|158047_158308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377550.1|158575_158866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377545.1|161404_162445_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_048875849.1|162547_163519_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377543.1|163641_164490_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_017377542.1|164641_164929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|165239_165611_+	isochorismatase	NA	NA	NA	NA	NA
WP_155052673.1|166671_166896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|167033_167171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377539.1|167184_167397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377537.1|167920_168745_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377536.1|168883_170017_+	cation transporter	NA	NA	NA	NA	NA
WP_016210041.1|170076_171486_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_027242724.1|171633_173214_-	APC family permease	NA	NA	NA	NA	NA
WP_017377534.1|173971_174967_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242725.1|174972_177039_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_048875850.1|177096_178047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210045.1|178241_178568_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_026063646.1|178790_180050_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_036772663.1|180309_181185_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377528.1|181223_182186_+	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_017375799.1|187880_188225_-	DMT family protein	NA	NA	NA	NA	NA
WP_047927156.1|188321_189245_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375796.1|189744_190233_+	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_017375795.1|190335_191136_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375794.1|191146_192898_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_081000012.1|193787_194030_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420737.1|194033_194432_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|194663_195539_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375951.1|196257_196716_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420736.1|196897_197083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|197798_199613_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_017375948.1|200023_200692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375947.1|200701_202018_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375945.1|202177_203140_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210730.1|203220_203376_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375944.1|203389_203626_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_036773720.1|203818_205036_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375942.1|205013_205472_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_017375941.1|205499_206879_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_075275379.1|206915_207134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|207453_208749_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|208953_209145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|209343_210219_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|210406_211672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875854.1|211705_212581_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378152.1|212702_213161_-	NfeD family protein	NA	NA	NA	NA	NA
WP_017378151.1|213184_214105_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378150.1|214232_215015_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378149.1|215105_216605_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_027242686.1|216918_218802_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_027242685.1|219061_219724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242684.1|219790_220900_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_017378146.1|220911_221556_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_017378145.1|221574_222561_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378144.1|222645_223722_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378143.1|223923_224748_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378142.1|225050_226016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378141.1|226334_227387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|227445_228420_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027242682.1|228755_229184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|229420_229903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378138.1|229958_231209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378137.1|231311_231530_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378136.1|232001_232856_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378135.1|232910_233381_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_026063709.1|233677_233914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063708.1|234060_234441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|234499_235375_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063707.1|236141_237053_+	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_017378132.1|237169_238018_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_065653735.1|238084_239095_+	lipase	NA	NA	NA	NA	NA
WP_017378129.1|239118_239442_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_017375571.1|239452_239854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875856.1|240124_241144_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	314947	357306	3195235	transposase	Chrysochromulina_ericina_virus(20.0%)	54	NA	NA
WP_036772169.1|314947_315823_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378046.1|315903_316536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378045.1|316489_317935_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_051929544.1|317969_318389_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017378043.1|319162_319531_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_017378042.1|319540_320080_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_017378041.1|320240_320672_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_017378040.1|320675_321374_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_017378039.1|321621_322128_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_017378038.1|322170_322539_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_017378037.1|322809_326886_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.6	1.2e-22
WP_017378036.1|326949_331158_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_016209765.1|331319_331694_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_016209732.1|331798_332272_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_017378035.1|332287_334399_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209759.1|334426_335617_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_016209760.1|335623_335935_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_017378034.1|336057_336696_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_016209735.1|336711_337329_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_016209744.1|337325_337622_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_017378033.1|337636_338461_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_017378032.1|338477_338753_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_016209755.1|338758_339091_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_017378031.1|339103_339838_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_017378030.1|339851_340265_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_016209750.1|340264_340465_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_017378029.1|340464_340722_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_017378028.1|340843_341212_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_016209734.1|341229_341541_+	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_016209761.1|341556_342099_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_026063699.1|342111_342417_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_016209763.1|342445_342838_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_017378025.1|342850_343384_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_016209757.1|343393_343747_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_016209764.1|343757_344258_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_017378024.1|344263_344446_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_017378023.1|344448_344883_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_016209749.1|344883_346206_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_016209752.1|346262_346376_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_017378021.1|346519_346876_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_016209730.1|346901_347291_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_017378020.1|347300_347921_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_016209739.1|347942_348920_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_017378019.1|348968_349367_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_017378018.1|349479_350727_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_027242670.1|350713_351370_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_036772490.1|351454_351733_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375625.1|351975_352203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875859.1|352335_353130_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053856770.1|353438_354653_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|355050_355230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|355198_355852_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376985.1|356227_356476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771653.1|356565_357306_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
>prophage 4
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	366729	421642	3195235	protease,transposase,tRNA	uncultured_Caudovirales_phage(20.0%)	59	NA	NA
WP_017376975.1|366729_367281_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_017376974.1|367291_368659_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376973.1|368809_369046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376972.1|369104_369848_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_027242667.1|369847_370489_+	lipoprotein	NA	NA	NA	NA	NA
WP_017376970.1|370488_372153_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.8	6.4e-34
WP_017376969.1|372181_372517_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_027242666.1|372681_374280_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.1e-06
WP_017376966.1|374339_374630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772765.1|374830_375262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376964.1|375324_377805_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_017376963.1|377891_378371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772771.1|378343_379384_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080963574.1|379320_380037_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|380049_380385_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|380421_380892_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_017376959.1|380934_382770_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_036818645.1|382814_383903_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376957.1|383924_384986_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_017376956.1|385063_385579_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376955.1|385619_386897_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376954.1|386911_387763_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376953.1|387791_388439_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026063584.1|388435_389395_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_048875861.1|389916_390786_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875862.1|390930_391185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856769.1|391329_391896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|392001_392442_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_027242664.1|392953_394156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|394439_395414_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_155046563.1|395883_396021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910653.1|396037_396253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|396457_397069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376943.1|397065_397323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376942.1|397573_397966_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016210000.1|398095_398644_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_026063583.1|398643_399471_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_017376940.1|399520_401206_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_017376939.1|401283_401745_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_026063582.1|401781_402345_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209991.1|402571_402901_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_017376937.1|402881_403106_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_017376936.1|403250_403841_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376935.1|403865_405137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|405154_406408_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376933.1|406404_407049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376932.1|407121_408171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376931.1|408272_409910_+	response regulator	NA	NA	NA	NA	NA
WP_017376930.1|409944_410274_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376929.1|410430_410718_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376927.1|411144_411282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376925.1|411787_413008_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376924.1|413066_415865_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376923.1|416170_417337_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_036772950.1|417435_417972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376921.1|418033_418366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|418623_419526_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|419595_420093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|420238_421642_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	451079	499218	3195235	transposase	Staphylococcus_phage(100.0%)	42	NA	NA
WP_036774259.1|451079_452054_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420729.1|452401_453040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|453159_454563_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242658.1|455905_457369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856768.1|457444_458239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242656.1|458530_459349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046566.1|459366_459960_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376894.1|460176_460410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242655.1|460633_461530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420727.1|461834_462605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376891.1|462774_463677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242654.1|463673_464897_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_027242653.1|464914_465841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242652.1|465856_466897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242651.1|467011_467422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376888.1|467474_467978_+	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_017376887.1|467970_468717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376886.1|468719_469850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420726.1|469854_470094_+	type IV secretion protein IcmT	NA	NA	NA	NA	NA
WP_027242650.1|472583_473072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242649.1|473074_474151_+	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_017376878.1|474143_474797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875870.1|474803_475229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242647.1|475265_478265_+	ATPase AAA	NA	NA	NA	NA	NA
WP_027242646.1|478326_479829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772357.1|480280_481900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376871.1|481941_484245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376870.1|484521_485418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242644.1|485420_488747_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_144420818.1|488948_489137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242642.1|489148_489625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772352.1|489667_489895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420817.1|490076_490610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242641.1|490640_490982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772347.1|490984_491401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876253.1|491562_492219_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.3e-10
WP_036771639.1|492215_493190_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_032126138.1|493631_493895_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_036771639.1|494322_495297_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_087910671.1|495684_496149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910670.1|496242_496428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875857.1|498243_499218_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
>prophage 6
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	504022	558705	3195235	transposase	Streptococcus_phage(22.22%)	52	NA	NA
WP_048875872.1|504022_505306_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|505478_505616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875873.1|505612_507016_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927246.1|507129_507567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242638.1|507687_508116_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017375827.1|508363_508801_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|509232_510621_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_017375825.1|511067_512561_+	amino acid permease	NA	NA	NA	NA	NA
WP_036773936.1|512755_513511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420725.1|514010_514241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|515345_516356_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375821.1|516352_516574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242636.1|517292_518234_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026063480.1|518761_519160_+	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_075275366.1|519099_519954_+	MFS transporter	NA	NA	NA	NA	NA
WP_017375815.1|520045_520327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242634.1|520412_521090_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_026063478.1|521135_522416_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_017375812.1|522591_523641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375811.1|523719_524520_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375810.1|524533_525328_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375809.1|525430_526450_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375808.1|526496_527108_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375807.1|527111_527798_+	acireductone synthase	NA	NA	NA	NA	NA
WP_017375806.1|527794_528337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375805.1|528629_529817_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375804.1|530061_530787_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_144420816.1|530972_531761_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_047927106.1|531757_532153_-	YchJ family protein	NA	NA	NA	NA	NA
WP_017375801.1|532545_533586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|533582_534986_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|537401_537659_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420723.1|537698_539084_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242633.1|539413_540511_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_017377120.1|540544_541795_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_017377119.1|541795_542428_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017377118.1|542717_543170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063598.1|543215_544058_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377116.1|544092_544584_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_017377115.1|544779_546747_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377113.1|546974_547379_+	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_047927448.1|547356_548385_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_027242632.1|548371_549160_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053856766.1|549586_550990_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377110.1|551191_552202_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_075275363.1|552214_552682_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377107.1|553011_554382_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_017377106.1|554684_555155_+	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377105.1|555432_555708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|555718_557122_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_069971661.1|557296_557734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|557730_558705_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 7
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	590496	723890	3195235	transposase,plate,tRNA	Staphylococcus_phage(13.64%)	111	NA	NA
WP_036772726.1|590496_591045_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
WP_017377077.1|591797_593177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|593536_595000_+	nuclease	NA	NA	NA	NA	NA
WP_017377075.1|595183_595996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377074.1|596460_598455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377073.1|598849_600229_+	MFS transporter	NA	NA	NA	NA	NA
WP_036774567.1|600266_600704_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774569.1|600746_601463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|603009_603540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|603606_605427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|605991_606498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242613.1|606582_607986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|608100_608355_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_017377065.1|608507_608780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420722.1|609355_609538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|609654_610230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046568.1|610238_610397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242612.1|611297_611540_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_027242611.1|611842_612934_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377060.1|612914_613868_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_017377059.1|614091_615576_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_027242610.1|615615_616119_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_051929897.1|616378_617554_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_051929903.1|617701_618106_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_036772169.1|618262_619138_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242609.1|619172_619526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|622855_623281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|623511_624648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242608.1|624634_625957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377048.1|625949_627068_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377047.1|627188_627722_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377046.1|627860_629498_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377045.1|629502_629724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377044.1|629832_630846_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377043.1|631117_633346_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_026063593.1|633326_634031_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|634265_634595_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377039.1|635995_636214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|636272_637148_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377037.1|637140_638007_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_017377036.1|638074_639394_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036772137.1|639863_640424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856764.1|640742_641669_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376601.1|642564_643473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|647169_648009_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376604.1|648195_648411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|648459_649035_-	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376606.1|649031_649370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376607.1|649538_650528_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_051929685.1|651517_652420_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048875883.1|652679_653216_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420814.1|653360_654278_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376610.1|654712_655723_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_017376611.1|656530_657067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376613.1|658279_658627_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275357.1|658771_659731_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376616.1|659832_660615_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243116.1|660747_661707_+	response regulator	NA	NA	NA	NA	NA
WP_017376619.1|661731_662136_-	RidA family protein	NA	NA	NA	NA	NA
WP_026063546.1|662164_662839_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_027243117.1|662938_664654_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016209558.1|664650_665013_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_026063550.1|665027_666182_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_017376622.1|666185_667193_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_017376623.1|667195_668212_+	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376624.1|668427_669513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376625.1|669619_670012_-	RidA family protein	NA	NA	NA	NA	NA
WP_027243118.1|670144_671428_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_027243119.1|671443_672745_+	aspartate kinase	NA	NA	NA	NA	NA
WP_036772145.1|672762_674565_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420721.1|674569_675562_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376630.1|675642_676719_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017376631.1|676816_677791_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_144420813.1|677858_678830_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376633.1|679013_679283_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_017376634.1|679884_681171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|681235_681916_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155052676.1|687571_687859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375775.1|687897_688092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275355.1|688139_689114_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_027242570.1|689327_690467_-	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_017376020.1|690675_692046_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_017376019.1|692424_693417_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376018.1|693420_693936_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376017.1|693932_694772_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_027242569.1|694804_696355_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376015.1|696462_696834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376011.1|698054_698216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|698796_700200_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375660.1|700234_700672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|700695_701670_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036774104.1|701728_702157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376321.1|702344_703151_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_017376322.1|703225_703618_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376323.1|703662_704484_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376324.1|704496_705480_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376325.1|705481_706750_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_048876074.1|706756_709261_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376328.1|709391_710417_+	phosphotransferase	NA	NA	NA	NA	NA
WP_017376329.1|710413_711124_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_080963653.1|711048_711879_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376331.1|712028_712412_+	response regulator	NA	NA	NA	NA	NA
WP_027242863.1|712446_713346_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_027242862.1|713391_714063_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_017376334.1|714145_714721_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_017376335.1|714819_715620_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376336.1|715761_716619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|717481_718618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242860.1|718684_721855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242859.1|721867_722578_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242858.1|722582_723890_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	732532	778848	3195235	transposase,plate	Staphylococcus_phage(21.43%)	51	NA	NA
WP_017376356.1|732532_732931_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_027242851.1|732927_734616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242850.1|734597_735554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|735596_736112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|736216_737149_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_017376360.1|737368_737755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376361.1|737772_738417_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_017376362.1|738567_739407_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.6	3.9e-16
WP_017376363.1|739482_740085_+	signal peptidase I	NA	NA	NA	NA	NA
WP_017376364.1|740085_740940_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_017376365.1|741297_741609_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017376366.1|741633_743022_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|743177_743909_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_027242849.1|743905_744433_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|744464_745022_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_027242848.1|745027_746008_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	3.5e-32
WP_016209539.1|746147_746948_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_017376369.1|746951_747719_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_017376370.1|747715_748180_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_017376371.1|748202_748856_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376372.1|748859_749207_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017376373.1|749240_749492_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|749568_750837_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027242847.1|750839_751598_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_017376376.1|751659_752550_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|752600_753284_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_017376377.1|753293_753641_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_027242846.1|753913_756034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376379.1|756025_756898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376380.1|757065_758895_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_017376381.1|759062_759704_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_144420811.1|760028_760475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|760492_760666_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_017376383.1|760724_761774_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_017376384.1|761780_762731_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_017376385.1|762785_763730_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_017376386.1|763757_764495_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|764583_764826_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|764900_766124_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_017376387.1|766155_767004_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_017376388.1|767000_768053_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_017376389.1|768189_768810_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	43.7	2.7e-38
WP_087910645.1|769035_770188_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_036771330.1|771208_772183_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046570.1|772179_772350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971647.1|773318_773915_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876071.1|773883_775044_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_017377691.1|775554_775896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377690.1|775999_777034_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|777030_777741_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_036771330.1|777873_778848_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 9
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	787008	841319	3195235	protease,transposase,tRNA	Prochlorococcus_phage(33.33%)	49	NA	NA
WP_017377942.1|787008_787515_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_027243058.1|787596_788013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243057.1|788104_788965_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420810.1|789062_789608_+	chorismate lyase	NA	NA	NA	NA	NA
WP_017377937.1|789690_790542_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_048876070.1|790583_793490_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|793550_793748_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_017377935.1|793754_794765_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_017377934.1|794761_795820_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_087910662.1|795834_796614_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027243055.1|796616_797429_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_017377933.1|797440_798388_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_144420809.1|798398_799691_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377931.1|799869_800973_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_017377930.1|800969_801362_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_027243054.1|801374_802751_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377929.1|802744_804214_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_053856762.1|804407_804842_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_087910651.1|805137_805314_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_027243053.1|806348_807374_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	30.5	4.5e-30
WP_017377925.1|807875_808268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774583.1|809660_810311_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046574.1|811009_811804_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876067.1|811983_812628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|812802_813777_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377920.1|814177_814435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420808.1|816112_816790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243155.1|817023_817848_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377914.1|817941_818655_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_017377913.1|818744_819836_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377912.1|819907_820489_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377911.1|820494_821121_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_026063691.1|821217_822165_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_065653730.1|822511_823174_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017377908.1|823344_824004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377907.1|824172_825432_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377906.1|825428_826514_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377905.1|826506_827388_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_027243154.1|827376_828627_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_144420719.1|830012_830333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|830591_830858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|831348_831567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420718.1|832552_832774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|832770_833853_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063690.1|833863_834235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773050.1|834231_834411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|837114_837390_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065653755.1|838225_839683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|840110_841319_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	884999	947519	3195235	transposase,tRNA	Staphylococcus_phage(28.57%)	53	NA	NA
WP_048875904.1|884999_885875_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376744.1|886131_886569_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_017376743.1|886629_887262_-	endonuclease III	NA	NA	NA	NA	NA
WP_017376742.1|887277_887925_-	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_027242971.1|887927_889991_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_027242972.1|890317_891610_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242973.1|891998_894209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242974.1|894225_894882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242975.1|897267_898143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420805.1|898401_899013_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_027242976.1|899440_902029_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
WP_017375712.1|902131_902893_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242977.1|902889_903426_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375710.1|903474_904431_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242978.1|904508_907694_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_017375707.1|907697_908753_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	1.5e-49
WP_027242979.1|908982_909585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375705.1|909628_910291_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017375704.1|910325_910673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375702.1|911141_912173_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|912635_914039_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242980.1|915157_915502_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027242981.1|915593_916049_+	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_144420715.1|916297_916432_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377756.1|916424_917066_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|917062_917779_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377754.1|917782_919102_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_155051395.1|919783_919927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773644.1|920906_923543_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	1.5e-98
WP_036773645.1|923584_924670_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377749.1|924669_925353_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_017377748.1|925413_927075_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377747.1|927227_927482_+	LapA family protein	NA	NA	NA	NA	NA
WP_017377746.1|927560_927878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377745.1|928030_928429_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242983.1|928510_929149_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_036771330.1|929305_930280_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420804.1|930652_930928_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|931477_931762_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772261.1|933578_934172_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243172.1|935259_936141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376527.1|936252_937932_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_017376526.1|938058_939309_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376525.1|939384_939846_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376524.1|939842_940991_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376523.1|940996_941671_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376522.1|941667_942324_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376521.1|942449_942923_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376520.1|942924_943347_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_047927196.1|943333_944353_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_155046578.1|944512_944692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243174.1|944910_945192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|946643_947519_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	951421	1018384	3195235	protease,transposase,tRNA	Bacillus_phage(20.0%)	56	NA	NA
WP_048876012.1|951421_952825_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|953183_953951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|954064_955468_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046579.1|955464_955626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|955941_956916_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376505.1|957156_958440_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376506.1|958506_959430_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376509.1|961625_963770_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_016210310.1|963791_963998_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376510.1|964058_964679_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_017376511.1|964719_965613_-	YicC family protein	NA	NA	NA	NA	NA
WP_016210308.1|965698_966424_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210305.1|966485_966890_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_027243115.1|967052_969161_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_017376514.1|969284_970334_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376515.1|970330_971797_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376516.1|971939_973277_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_047927029.1|973344_974835_-	nuclease	NA	NA	NA	NA	NA
WP_017376518.1|975063_975435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|975585_976413_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_027243112.1|976715_977372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927028.1|977319_978243_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036774751.1|978256_979180_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017376987.1|979427_980111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|981810_982038_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376989.1|982362_982911_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_017376990.1|982991_983267_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_027242882.1|983266_984316_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376991.1|984428_986366_-	AsmA family protein	NA	NA	NA	NA	NA
WP_080963631.1|986513_988226_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376994.1|988294_989014_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_017376995.1|989010_989613_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376996.1|989727_990615_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|990805_991153_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376997.1|991203_992043_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_017376998.1|992138_992885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063589.1|993081_993708_+	porin family protein	NA	NA	NA	NA	NA
WP_017377000.1|994023_994593_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017377001.1|994736_995435_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377003.1|996141_996765_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052106204.1|996874_997768_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377006.1|997874_999485_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_027242880.1|999481_1000777_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_027242879.1|1000798_1002721_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_017377007.1|1002831_1003134_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_017377008.1|1003228_1008115_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_047927528.1|1008162_1009485_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_036771855.1|1009609_1010704_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_027242877.1|1010755_1011694_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_026063591.1|1011774_1012359_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242876.1|1012743_1013634_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_017377014.1|1013836_1014328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242875.1|1014467_1014959_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1015127_1015841_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065653747.1|1015903_1017244_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_048875904.1|1017508_1018384_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	1023997	1086524	3195235	transposase	Staphylococcus_phage(33.33%)	58	NA	NA
WP_017377787.1|1023997_1024225_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377021.1|1024251_1025292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377022.1|1025358_1025928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|1026158_1026563_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1026575_1026716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929560.1|1026810_1028010_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_016211971.1|1028030_1028642_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_027242871.1|1028843_1029605_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080963583.1|1029900_1030827_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_144420803.1|1030987_1031944_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999998.1|1032088_1032358_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1032624_1033599_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375625.1|1033752_1033980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420711.1|1034096_1034522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|1034678_1035608_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_027242870.1|1036054_1036585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420710.1|1036906_1037212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|1037689_1038001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963609.1|1038340_1039507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|1041694_1042666_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046581.1|1043268_1043442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376283.1|1043837_1044755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376284.1|1044755_1045607_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1046047_1047094_+	glutathione synthase	NA	NA	NA	NA	NA
WP_144420802.1|1047083_1049075_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_036773579.1|1049184_1049559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420801.1|1049812_1049995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|1050256_1050958_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027242868.1|1050958_1051426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376291.1|1051482_1051704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376293.1|1053064_1055815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376294.1|1056050_1057343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|1057829_1058735_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376296.1|1059512_1060229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1060514_1061276_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_048876053.1|1061308_1062712_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1062708_1062873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|1062932_1063220_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017375910.1|1063964_1064693_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_048876052.1|1064661_1065408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420708.1|1065488_1065878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1065874_1066849_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772454.1|1067005_1067323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772457.1|1069798_1070107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|1070182_1070455_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_017377863.1|1072988_1073426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|1074027_1075215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963626.1|1075485_1077120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|1077170_1077899_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377858.1|1079326_1080289_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377857.1|1080512_1081508_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377856.1|1081535_1082471_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|1082514_1082976_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080963625.1|1082954_1083572_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1083601_1084576_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377852.1|1084630_1085098_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377851.1|1085110_1085755_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|1085795_1086524_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
>prophage 13
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	1095224	1144792	3195235	transposase	Acinetobacter_phage(22.22%)	39	NA	NA
WP_082300708.1|1095224_1095785_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378014.1|1097109_1097505_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378015.1|1097513_1097870_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_048876047.1|1097862_1098738_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420706.1|1098823_1099402_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876046.1|1099359_1099653_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_047927811.1|1100613_1102125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1102372_1103776_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999997.1|1103981_1104416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275341.1|1104498_1105203_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999996.1|1105461_1105950_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_051929548.1|1105978_1106653_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|1106893_1107769_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075275340.1|1108299_1108908_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375723.1|1109178_1109637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375724.1|1109915_1110305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|1110490_1111306_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375727.1|1111528_1112434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211119.1|1112597_1113359_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375728.1|1113362_1114229_+	OmpA family protein	NA	NA	NA	NA	NA
WP_017375729.1|1114314_1114926_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_017375730.1|1115304_1116552_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_144420800.1|1116703_1117405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|1117702_1117876_-	phosphatase	NA	NA	NA	NA	NA
WP_048876044.1|1118365_1118866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1119944_1120172_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420705.1|1120257_1120458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|1120486_1121167_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027242790.1|1121189_1123364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378188.1|1123609_1124680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1124676_1126080_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619408.1|1126228_1126714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242789.1|1126785_1127607_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_017378192.1|1128273_1129773_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_017378193.1|1130076_1132770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242788.1|1132766_1136168_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_048875961.1|1137755_1139159_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378201.1|1140237_1140909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1143817_1144792_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 14
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	1169515	1226210	3195235	transposase,tRNA	Staphylococcus_phage(28.57%)	51	NA	NA
WP_053093677.1|1169515_1170235_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_155046584.1|1170462_1170639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375975.1|1170887_1171211_+	YqcC family protein	NA	NA	NA	NA	NA
WP_036771316.1|1171299_1173318_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375977.1|1173340_1174294_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375978.1|1174459_1175647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876036.1|1176360_1176999_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_036771312.1|1177296_1178292_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_155052679.1|1179164_1179764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|1179756_1180782_+	FUSC family protein	NA	NA	NA	NA	NA
WP_017375766.1|1180848_1182879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1184185_1184413_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375561.1|1185756_1185900_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062365727.1|1185896_1186589_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242771.1|1186855_1187173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242770.1|1187315_1187726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242769.1|1187882_1188209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963649.1|1188355_1189393_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242767.1|1189434_1189680_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_155052681.1|1189765_1190119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242765.1|1190126_1191701_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_027242764.1|1191855_1192425_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242763.1|1192734_1194537_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_087910649.1|1194533_1195475_+	signal peptidase I	NA	NA	NA	NA	NA
WP_036771308.1|1195502_1195724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242761.1|1195886_1196561_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_144420798.1|1196566_1197466_+	GTPase Era	NA	NA	NA	NA	NA
WP_027242759.1|1197479_1198223_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_027242758.1|1198225_1198957_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242757.1|1198953_1199337_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242756.1|1199474_1200722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242755.1|1201132_1202278_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242754.1|1202270_1202624_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242753.1|1202904_1203447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927692.1|1204091_1204280_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1204299_1205274_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420702.1|1205317_1206193_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036815628.1|1206546_1207374_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080963648.1|1207473_1207635_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375762.1|1208285_1209626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1210677_1210905_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027243003.1|1211046_1212408_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_027243002.1|1212503_1213163_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144420701.1|1214003_1214360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375757.1|1214956_1216516_-	APC family permease	NA	NA	NA	NA	NA
WP_017375893.1|1219060_1220131_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017375892.1|1220188_1220395_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375891.1|1220401_1221877_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375890.1|1222012_1222576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1222745_1224149_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242999.1|1225115_1226210_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	1242452	1290177	3195235	transposase	Staphylococcus_phage(50.0%)	42	NA	NA
WP_036772169.1|1242452_1243328_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876030.1|1243397_1244501_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774087.1|1244568_1244892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242984.1|1245048_1245831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063491.1|1245966_1246944_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_047927375.1|1247017_1249009_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_017375900.1|1249064_1249346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1249599_1250799_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_051929862.1|1253230_1253743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1253929_1254805_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375562.1|1254841_1255006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1256214_1256628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774270.1|1256638_1256974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420796.1|1257118_1258237_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876026.1|1258466_1258733_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1260015_1260243_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773258.1|1260253_1260760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243127.1|1260837_1261455_-	VOC family protein	NA	NA	NA	NA	NA
WP_017376680.1|1261586_1262819_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_017376681.1|1262808_1263471_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_026063554.1|1263745_1265002_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_087910647.1|1265139_1265799_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376683.1|1265873_1266575_+	cyclase family protein	NA	NA	NA	NA	NA
WP_036771330.1|1267322_1268297_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376688.1|1269505_1269859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1270072_1270267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1270334_1270847_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376691.1|1270984_1271839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1271887_1272532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1272565_1273210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243125.1|1273732_1274026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376695.1|1274124_1274907_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_017376696.1|1274989_1275940_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_027243124.1|1277982_1280823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376700.1|1280845_1281427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376701.1|1281546_1282275_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_036771330.1|1282420_1283395_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243123.1|1283510_1284416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376705.1|1285014_1285761_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376706.1|1286013_1286406_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376707.1|1286443_1287091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1288806_1290177_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	1313996	1355206	3195235	transposase	Enterobacteria_phage(16.67%)	37	NA	NA
WP_048876023.1|1313996_1315100_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_087910645.1|1315190_1316343_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876022.1|1316756_1317608_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420700.1|1317745_1317895_-	phosphatase	NA	NA	NA	NA	NA
WP_017377952.1|1318519_1320886_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_017377953.1|1320933_1322130_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_027242965.1|1322698_1325131_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036773041.1|1325452_1326952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242964.1|1327060_1327633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|1327947_1329417_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017377960.1|1329489_1330239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876021.1|1330242_1331016_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_027242961.1|1331114_1332065_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017377963.1|1332204_1333647_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242960.1|1333862_1335047_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377966.1|1335170_1335857_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_026063694.1|1335992_1336577_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_144420699.1|1336666_1336996_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017377969.1|1337331_1337571_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_017377970.1|1337619_1337811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275334.1|1338585_1338879_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420698.1|1339027_1339189_-	phosphatase	NA	NA	NA	NA	NA
WP_017378162.1|1339703_1340243_-	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1340581_1341226_-	porin family protein	NA	NA	NA	NA	NA
WP_017378160.1|1341559_1342210_-	porin family protein	NA	NA	NA	NA	NA
WP_017378159.1|1342733_1343786_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378158.1|1343803_1346884_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242571.1|1347049_1347298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|1347363_1348239_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772025.1|1349161_1349668_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027243218.1|1349685_1349883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1349901_1350045_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155046586.1|1350112_1350286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1350490_1351804_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000010.1|1351813_1352077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1352135_1353110_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377787.1|1354978_1355206_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 17
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	1386423	1440157	3195235	transposase,tRNA	Bacillus_thuringiensis_phage(25.0%)	45	NA	NA
WP_036772026.1|1386423_1387299_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242912.1|1387403_1390706_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_017376668.1|1390702_1392526_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_017376669.1|1392565_1392964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242911.1|1393072_1394089_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_027242910.1|1394523_1395978_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376672.1|1396059_1399116_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_081329473.1|1400506_1400926_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376676.1|1401298_1401763_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075275332.1|1401835_1402837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771585.1|1405729_1406062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420693.1|1406423_1406567_-	phosphatase	NA	NA	NA	NA	NA
WP_048876152.1|1406554_1407499_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420692.1|1407502_1407892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275328.1|1407710_1408049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376273.1|1408423_1409023_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017376274.1|1409022_1409370_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_026063520.1|1409520_1410504_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376276.1|1411413_1411728_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_144420691.1|1411876_1412035_-	phosphatase	NA	NA	NA	NA	NA
WP_144420690.1|1412006_1412936_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_026063521.1|1413850_1414267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1415395_1416112_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376099.1|1416860_1417019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1417067_1417643_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_075275424.1|1417787_1418066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376100.1|1418130_1419006_-	ParA family protein	NA	NA	NA	NA	NA
WP_048876018.1|1419171_1423038_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376103.1|1423193_1424003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376104.1|1424052_1424874_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376105.1|1425073_1426306_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376106.1|1426476_1427202_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376107.1|1427244_1428783_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376108.1|1428789_1430175_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_048876011.1|1430488_1431538_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1432097_1432475_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420688.1|1432666_1433542_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1434523_1434751_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876149.1|1434803_1435322_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_146619432.1|1435577_1435769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420793.1|1436177_1436951_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243181.1|1437064_1438036_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376772.1|1438017_1438989_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420687.1|1439424_1439610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1439620_1440157_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	1459092	1508511	3195235	transposase	Staphylococcus_phage(23.08%)	45	NA	NA
WP_051929845.1|1459092_1459917_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1460320_1461295_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927610.1|1461480_1462074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1462254_1462719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910660.1|1463113_1463395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1463391_1464795_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377324.1|1465446_1465827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1466066_1466723_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_036773200.1|1466867_1467164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1467223_1467511_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_036772296.1|1468700_1469078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1469277_1470327_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377209.1|1470303_1472121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1472391_1472970_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_065653751.1|1472997_1473462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377206.1|1473498_1474956_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_027243048.1|1475017_1476505_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377202.1|1477274_1477877_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_017377201.1|1478438_1478909_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_036772316.1|1480556_1481300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275422.1|1481451_1481883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243044.1|1484520_1485867_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_036772310.1|1485954_1487760_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_017378301.1|1488225_1489023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378302.1|1489407_1489869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1490091_1491066_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963614.1|1491108_1491231_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376833.1|1491302_1493258_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1493647_1493833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376832.1|1494154_1495144_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_027243043.1|1495556_1497182_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376830.1|1497290_1497605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1497900_1499286_+	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376829.1|1499450_1499678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1499818_1500277_-	amino acid permease	NA	NA	NA	NA	NA
WP_144420685.1|1500477_1500663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1500731_1501559_-	DsbA family protein	NA	NA	NA	NA	NA
WP_144420792.1|1502013_1502538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376824.1|1502810_1502969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243041.1|1503138_1504092_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_036771330.1|1504286_1505261_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876009.1|1505388_1506414_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1507066_1507354_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929542.1|1507413_1507746_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081377820.1|1507950_1508511_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
>prophage 19
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	1517232	1576803	3195235	protease,transposase,integrase,tRNA	Staphylococcus_phage(25.0%)	57	1506083:1506142	1576508:1577118
1506083:1506142	attL	CCACCACGTGTCACTGATAAGTGGACGTGCGTATTCCAATTTAAACTCTGGCCGAAAGTA	NA	NA	NA	NA
WP_017376809.1|1517232_1519002_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_017376808.1|1519140_1520184_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376807.1|1520197_1520941_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_062312151.1|1521038_1521371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|1521432_1521612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243094.1|1521674_1522382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420791.1|1523165_1524377_+	protein kinase	NA	NA	NA	NA	NA
WP_017376801.1|1524432_1525257_-	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_017376798.1|1526444_1527080_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017376797.1|1527361_1527721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|1527994_1530280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420683.1|1530268_1530925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243096.1|1531101_1531734_+	MarC family protein	NA	NA	NA	NA	NA
WP_155049745.1|1531769_1531946_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_027243098.1|1532020_1533166_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_027243099.1|1533401_1534715_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
WP_155046588.1|1535830_1536040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420682.1|1536574_1536736_-	phosphatase	NA	NA	NA	NA	NA
WP_017376785.1|1538142_1539048_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027242578.1|1539510_1540047_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_027242577.1|1540064_1541366_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_048876008.1|1541362_1542337_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_144420681.1|1542380_1542566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046590.1|1542745_1542910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1542911_1543787_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420680.1|1544102_1545023_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_017375696.1|1545038_1545422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1545748_1546705_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_144420678.1|1546972_1547251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243017.1|1547749_1549093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046591.1|1549266_1549410_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1549489_1550464_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927346.1|1550611_1552483_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_075275322.1|1552515_1552614_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017378518.1|1552849_1553479_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017378517.1|1553462_1553885_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378516.1|1553891_1555631_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378515.1|1555631_1556696_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1556699_1557053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1557165_1558134_+	ferrochelatase	NA	NA	NA	NA	NA
WP_017378513.1|1558143_1558455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1558470_1559040_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378512.1|1559303_1560632_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_036771639.1|1560672_1561647_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420677.1|1562233_1562635_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_146619459.1|1563154_1565611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773893.1|1565813_1566665_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275420.1|1566710_1568417_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_069971648.1|1569888_1570863_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_047927336.1|1571225_1571471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653736.1|1571834_1572863_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017375591.1|1572993_1573197_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420676.1|1573481_1574438_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
WP_047927838.1|1574730_1574976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1574972_1575272_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_036774927.1|1575494_1575965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1576575_1576803_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
1576508:1577118	attR	TACTTTCGGCCAGAGTTTAAATTGGAATACGCACGTCCACTTATCAGTGACACGTGGTGGTGTTCTGGTCAAGTCATATTGGACACTTTTAATTGAGACTTTTCAAAATTAATAGGCGATAGGTTAGCATTGGCTGTATGCAACCGATCATGATTGTAATATCGAATATAGGCCTCAACATCCTCCTTCATAGTATCACGGGTTAAGTGAATCACATTCAACAGCCATTCGTGCTTTAGGCTGCCAAAAAAACGCTCGACAACCGCATTGTCAACGCAAGCACCGACACTGCTCATAGAAGCGGTGATTTTATGCTTCTTCAACAGTTTTCGATATTTTTTACTGGTATACTGCGAACCACGATCACTGTGAAATAACAAGTGTTCTGTCGGCTGCCGCAAGTGAATCGCCATATCCATTGCACGACAAACTAGATTTTCGCTCATTCTCTTATTCATCGCCCAGCCAATCACTTTTCGAGAGTATAAATCAATAACGACCGCAAGATACAACCAGCCTTCAGCAGTTCTAAGGTAGGTAATGTCACCTGCCCATGAGTGATTTGCAATGACTGGATTAAACTGCTGATTCAATACGTTATCTGCAACAGC	NA	NA	NA	NA
>prophage 20
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	1582255	1625186	3195235	transposase	Staphylococcus_phage(20.0%)	41	NA	NA
WP_053856766.1|1582255_1583659_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772872.1|1583846_1584704_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243025.1|1584828_1585464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1585512_1585764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243027.1|1586019_1586919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1587055_1588129_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017375995.1|1588229_1588643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375994.1|1588663_1589377_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_027243028.1|1589564_1590977_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243029.1|1591186_1592155_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_075275321.1|1592888_1593257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420675.1|1593260_1593578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1593653_1594628_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375989.1|1595147_1595648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243163.1|1595718_1597047_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036773519.1|1597182_1598571_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243165.1|1598718_1600029_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|1600369_1601653_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_017375982.1|1601726_1602347_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_051929832.1|1602545_1602806_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155046592.1|1603008_1603155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876006.1|1603130_1603724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816364.1|1605587_1605806_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772303.1|1607058_1607829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420790.1|1607915_1608131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376496.1|1608227_1609349_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_036771330.1|1609615_1610590_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771628.1|1610852_1611974_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_017376491.1|1612266_1612554_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1612526_1613030_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_053093673.1|1613110_1613770_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876005.1|1614111_1615029_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_075275317.1|1615158_1615332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1615997_1617356_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_017376486.1|1617430_1617994_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376485.1|1618188_1619418_-	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_017376484.1|1619463_1620090_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_027242833.1|1620239_1621427_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_048876004.1|1621435_1622128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910642.1|1622249_1623402_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876002.1|1624202_1625186_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
>prophage 21
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	1683521	1773836	3195235	protease,transposase,tRNA	Burkholderia_phage(14.29%)	82	NA	NA
WP_036774017.1|1683521_1684397_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377182.1|1684786_1685125_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_026063604.1|1685121_1685718_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_027242821.1|1685720_1687715_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_017377185.1|1687778_1688717_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_036771332.1|1689065_1690040_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_080999986.1|1690243_1690441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000007.1|1690602_1691007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816928.1|1692590_1693031_+	universal stress protein	NA	NA	NA	NA	NA
WP_048875996.1|1693357_1694233_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420669.1|1694245_1694488_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275315.1|1694894_1695149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1696360_1697326_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420668.1|1697418_1697730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1697930_1698707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816899.1|1699536_1699728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377573.1|1700456_1701506_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_017377574.1|1701676_1702450_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377575.1|1702510_1704100_-	APC family permease	NA	NA	NA	NA	NA
WP_017377576.1|1704290_1705382_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377577.1|1705404_1705722_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377578.1|1705808_1707086_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377579.1|1707107_1707944_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377580.1|1707950_1709585_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_026063647.1|1710016_1710376_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377583.1|1710657_1712016_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_017377584.1|1712041_1712284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|1712777_1712957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|1713212_1714469_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377585.1|1714582_1714840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420667.1|1714984_1715995_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_144420786.1|1716371_1717226_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|1717255_1718089_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_036773204.1|1718665_1719439_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_047927606.1|1719520_1719841_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_144420665.1|1720059_1720965_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_048875992.1|1721050_1721449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|1721593_1722091_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242786.1|1723763_1724855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929549.1|1724953_1725331_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1725410_1726385_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_080999985.1|1727929_1728649_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1728732_1729020_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420664.1|1729304_1730177_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_048875990.1|1730133_1730910_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036816484.1|1731114_1731450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963600.1|1731848_1732205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377440.1|1732366_1732642_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_017377441.1|1732751_1733099_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377442.1|1733116_1733896_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377443.1|1733895_1734405_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|1734440_1734689_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377444.1|1735000_1735336_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_017377445.1|1735635_1736886_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242820.1|1736967_1738995_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377447.1|1739540_1739759_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242819.1|1739930_1740293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|1740441_1741845_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242818.1|1742126_1743302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377453.1|1743319_1745317_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242817.1|1745297_1746278_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075275308.1|1746333_1747176_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_036772544.1|1747175_1747592_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275307.1|1747572_1747992_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017377459.1|1748014_1748644_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017377460.1|1749212_1751402_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377461.1|1751413_1752619_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_080963599.1|1752603_1754451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106215.1|1754435_1755674_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242814.1|1755660_1757529_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_027242813.1|1757562_1758816_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017377465.1|1758821_1759679_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_017377694.1|1759697_1760426_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_081078114.1|1761564_1762356_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017376231.1|1762721_1763009_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017376477.1|1765131_1765521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376476.1|1765697_1766456_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_036772166.1|1766452_1768852_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_027242812.1|1768865_1770143_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_017376475.1|1770232_1771531_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_017376474.1|1771728_1772622_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_027242811.1|1772621_1773836_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 22
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	1784535	1835020	3195235	transposase,tRNA	Vibrio_phage(14.29%)	46	NA	NA
WP_069971651.1|1784535_1785411_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376461.1|1785783_1786047_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_017376460.1|1786353_1788948_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376459.1|1788944_1789427_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_017376458.1|1789404_1790445_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376457.1|1790619_1791105_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376456.1|1791212_1793783_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376455.1|1793816_1794278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773947.1|1794614_1795490_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376452.1|1795767_1797528_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_017376451.1|1797621_1798287_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376450.1|1798299_1799805_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376449.1|1799826_1800357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376448.1|1800430_1801693_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376447.1|1801879_1802752_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_026063532.1|1802853_1803642_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376445.1|1803734_1805060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376444.1|1805413_1806589_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376443.1|1806757_1807411_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376442.1|1807566_1809507_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_036773538.1|1809503_1810127_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036773116.1|1810291_1811266_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_075275305.1|1811537_1812158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1812154_1813558_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910640.1|1813625_1814042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875986.1|1814449_1814947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1814943_1815918_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046598.1|1815997_1816567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1816711_1817248_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375549.1|1817252_1817549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1817557_1818163_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017378212.1|1818348_1818747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1818937_1819141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046599.1|1819285_1819441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378213.1|1819565_1820018_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017378214.1|1820134_1821607_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_016211840.1|1822045_1822510_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_144420785.1|1823198_1824449_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_017378219.1|1824558_1825029_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_047927040.1|1825051_1825645_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_027242798.1|1825782_1826832_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_017378221.1|1826855_1827779_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1827795_1828257_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378223.1|1828364_1829183_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155046600.1|1829792_1829936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378228.1|1834099_1835020_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 23
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	1897313	1912629	3195235	transposase	Staphylococcus_phage(50.0%)	16	NA	NA
WP_017378288.1|1897313_1897535_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1897593_1898568_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046582.1|1898766_1898931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|1898927_1899563_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046602.1|1899839_1900619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1900651_1901413_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_075275303.1|1901389_1902379_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378290.1|1902514_1903390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|1903408_1904068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378292.1|1904097_1904304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927801.1|1904309_1904756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1904752_1906156_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378294.1|1906269_1907115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1907259_1908909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378296.1|1908999_1909785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875980.1|1911225_1912629_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	1941302	1983059	3195235	transposase,tRNA	uncultured_Mediterranean_phage(40.0%)	39	NA	NA
WP_144420657.1|1941302_1942364_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420656.1|1943075_1943237_+	phosphatase	NA	NA	NA	NA	NA
WP_017376418.1|1944153_1944693_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_017376419.1|1945075_1945492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|1945587_1946403_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376421.1|1946535_1948029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|1948214_1948640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376423.1|1948636_1950697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376424.1|1950980_1951796_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376425.1|1951896_1952715_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_027242802.1|1952711_1953080_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_075275409.1|1953261_1954089_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|1954152_1954881_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1955283_1956012_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017376428.1|1956401_1957127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875975.1|1957161_1961034_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376430.1|1961234_1962368_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_026063530.1|1962381_1962570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376433.1|1962793_1964152_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_036773947.1|1965758_1966634_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875973.1|1967145_1967781_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999981.1|1967793_1968267_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_155046603.1|1968194_1968347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929627.1|1968540_1968891_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1968950_1969238_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420654.1|1969290_1970070_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376416.1|1970189_1970360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376415.1|1970494_1971412_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376414.1|1971463_1972219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242801.1|1972286_1973561_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376412.1|1973681_1974359_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017376411.1|1974559_1975984_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_016209938.1|1975958_1976597_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376410.1|1976959_1977238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376409.1|1977471_1978416_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376408.1|1978437_1980306_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376407.1|1980326_1980680_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_026063528.1|1980718_1981834_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376405.1|1982018_1983059_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
>prophage 25
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	1987402	2043472	3195235	transposase,tRNA	Klosneuvirus(22.22%)	49	NA	NA
WP_017376399.1|1987402_1990174_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
WP_017376398.1|1990330_1991563_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1991804_1992467_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_017376397.1|1992926_1994408_+	MFS transporter	NA	NA	NA	NA	NA
WP_036773116.1|1994605_1995580_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376395.1|1996103_1998830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|1999717_2000692_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_051929562.1|2000942_2001647_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377436.1|2002886_2003405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242883.1|2004372_2005857_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_017377433.1|2005981_2007517_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017377432.1|2007539_2007869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963636.1|2007765_2007981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910639.1|2009964_2011164_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017377428.1|2011373_2012234_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_017377427.1|2012349_2012928_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_017377426.1|2013084_2013726_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	3.3e-07
WP_017377425.1|2013764_2013986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377424.1|2013978_2014962_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	6.2e-53
WP_080963565.1|2015355_2015853_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026063633.1|2015997_2016273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377423.1|2016424_2018107_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.1e-24
WP_017377422.1|2018114_2019137_-	YHYH protein	NA	NA	NA	NA	NA
WP_017377421.1|2019305_2020307_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_017377420.1|2020420_2020759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377419.1|2021234_2022494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2022702_2022930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420653.1|2022958_2023177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772807.1|2023314_2023680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772810.1|2023747_2023990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242887.1|2024004_2024340_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_017377418.1|2024344_2024782_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_036772812.1|2024807_2026193_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_036772815.1|2026303_2026735_-	flaG family protein	NA	NA	NA	NA	NA
WP_144420782.1|2026840_2028352_-	B-type flagellin	NA	NA	NA	NA	NA
WP_017377414.1|2028642_2030235_-	flagellin	NA	NA	NA	NA	NA
WP_027242888.1|2030435_2032631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772819.1|2032724_2034158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927084.1|2034200_2034716_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036772822.1|2034715_2035663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242892.1|2035646_2036312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242893.1|2036308_2037037_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047927085.1|2037026_2037773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963566.1|2037756_2038821_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_017377789.1|2039025_2040213_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377788.1|2040269_2041388_-	hypothetical protein	NA	A0A1V0SIK8	Klosneuvirus	29.3	1.0e-11
WP_047927086.1|2041835_2042093_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
WP_144420652.1|2042372_2043050_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_017375591.1|2043268_2043472_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	2063172	2112707	3195235	protease,transposase,tRNA	Burkholderia_virus(20.0%)	41	NA	NA
WP_017377787.1|2063172_2063400_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377765.1|2063489_2064245_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377764.1|2064658_2065255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377763.1|2065334_2068139_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377762.1|2068119_2069073_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377761.1|2069065_2070436_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_080999971.1|2070606_2072010_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275295.1|2072781_2073108_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420651.1|2073312_2073966_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_017376600.1|2074285_2074465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|2074720_2075977_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999979.1|2076215_2076362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081049196.1|2076444_2076801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|2077296_2077656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375623.1|2077665_2078049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|2078937_2079078_+	phosphatase	NA	NA	NA	NA	NA
WP_048875965.1|2079222_2080143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377998.1|2082300_2082831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243145.1|2082841_2083897_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_036773465.1|2083912_2085952_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_017378003.1|2085938_2086769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378004.1|2086835_2090375_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378005.1|2090488_2091208_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378006.1|2091446_2092076_+	response regulator	NA	NA	NA	NA	NA
WP_048875961.1|2092195_2093599_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378007.1|2093744_2095688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|2096205_2097066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|2097501_2099247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420648.1|2099649_2101122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|2101304_2101904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|2102041_2102239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|2102439_2102580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875964.1|2102647_2103427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|2103991_2104393_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773793.1|2104537_2104915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|2105374_2106682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619530.1|2107430_2107688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2107739_2109143_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377869.1|2109383_2111093_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377870.1|2111262_2111625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875960.1|2111732_2112707_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 27
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	2127276	2254114	3195235	protease,transposase,tRNA	Staphylococcus_phage(14.81%)	116	NA	NA
WP_017377892.1|2127276_2128698_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_026063687.1|2128787_2130386_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377894.1|2130542_2131169_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_027242839.1|2131249_2133922_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377896.1|2134404_2135361_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_017377897.1|2135413_2135833_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_048875958.1|2135859_2136723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377899.1|2136712_2137504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|2137808_2138780_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375746.1|2139128_2139437_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_048875957.1|2139433_2140090_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375749.1|2140223_2140709_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_017375750.1|2140786_2141308_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375751.1|2141353_2142247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|2142243_2143065_-	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_155046605.1|2143259_2143409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|2143636_2144467_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046606.1|2145872_2146043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242841.1|2146195_2147599_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_144420645.1|2147708_2148965_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080963644.1|2148936_2149668_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_017376088.1|2149679_2150957_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_017376087.1|2151056_2151431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376086.1|2151515_2152403_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376085.1|2152460_2153189_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_036771725.1|2153185_2154295_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376083.1|2154446_2154875_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_144420777.1|2154969_2155326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376081.1|2155318_2156530_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376080.1|2156526_2157315_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376079.1|2157477_2158272_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376078.1|2158721_2159462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376077.1|2159465_2161964_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376076.1|2162226_2163183_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_036771709.1|2163166_2163928_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_048875955.1|2164135_2165110_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_048875954.1|2165218_2165974_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2166098_2166344_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_017376072.1|2166403_2168677_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_036772670.1|2168731_2169034_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_016211261.1|2169274_2169568_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_065653731.1|2169738_2169918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420644.1|2169993_2170605_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376068.1|2170851_2172168_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2172178_2172547_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376067.1|2172577_2173240_-	adenylate kinase	NA	NA	NA	NA	NA
WP_144420776.1|2173662_2174241_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376065.1|2174220_2174628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999977.1|2174751_2175048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2175094_2175970_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876123.1|2176039_2178220_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_017376060.1|2178323_2179673_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_036772012.1|2179746_2180436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|2180568_2181756_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376055.1|2182274_2182919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|2182915_2184229_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|2184433_2184607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|2184876_2185350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420642.1|2185494_2185689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|2185953_2186829_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016210558.1|2187015_2187771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376051.1|2187844_2189497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376050.1|2189536_2191075_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	2.1e-71
WP_087910638.1|2191074_2192775_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_075275404.1|2192863_2194039_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_017376046.1|2194077_2195040_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_017376045.1|2195317_2195740_-	universal stress protein	NA	NA	NA	NA	NA
WP_017376044.1|2196045_2196687_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017376043.1|2196815_2198150_+	dihydroorotase	NA	NA	NA	NA	NA
WP_048875952.1|2198264_2198900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771517.1|2199644_2200781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771498.1|2200964_2202695_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_017376037.1|2202684_2203893_+	MFS transporter	NA	NA	NA	NA	NA
WP_075275290.1|2203991_2204993_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420641.1|2205236_2205872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2205891_2206866_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875951.1|2206909_2207746_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376035.1|2207891_2208311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|2208587_2209268_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875949.1|2209233_2209584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376032.1|2209616_2210828_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376031.1|2211168_2211798_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376030.1|2211846_2212863_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_016211035.1|2213109_2213325_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376029.1|2213377_2213827_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_027243175.1|2213906_2215652_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376026.1|2215743_2217615_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_053093667.1|2218059_2218776_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378197.1|2220213_2221083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2221039_2221267_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378198.1|2222235_2223150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875948.1|2223195_2224218_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_048875947.1|2224286_2225336_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155052687.1|2225964_2226135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243219.1|2226419_2226728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2226894_2228298_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046608.1|2228390_2228555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771959.1|2228876_2229101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|2229111_2230323_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036774710.1|2230717_2231617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375571.1|2231790_2232192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|2232438_2233482_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376859.1|2233601_2233838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376860.1|2234626_2236180_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_082300723.1|2238360_2238588_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971648.1|2239458_2240433_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_017375736.1|2241159_2242242_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_017375735.1|2242284_2242935_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375734.1|2243157_2243529_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_027243178.1|2243639_2245001_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_155046609.1|2246721_2246928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2247238_2248321_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2248317_2248629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2249674_2250649_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999976.1|2251655_2252435_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|2252896_2254114_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	2266963	2327931	3195235	integrase,transposase	Staphylococcus_phage(30.0%)	47	2274816:2274875	2325237:2325997
WP_144420638.1|2266963_2268046_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2268042_2268354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243152.1|2269851_2270787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774146.1|2271379_2272525_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_048875940.1|2274767_2275931_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
2274816:2274875	attL	GTCTTAGAGGTCATTGAAGGAGATCAGACGCTCAACCAAATATGCTCGAAATATGAGCTA	NA	NA	NA	NA
WP_144420637.1|2275959_2276184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|2277531_2278707_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420636.1|2279052_2281563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|2281621_2282434_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377669.1|2282874_2283579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2283628_2284603_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420634.1|2284707_2286039_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420774.1|2286237_2286306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375857.1|2286437_2287880_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420773.1|2288271_2289684_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375855.1|2290373_2290820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|2291414_2292263_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017376916.1|2292516_2293575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927497.1|2293566_2295273_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_036774028.1|2295344_2297078_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_017376912.1|2297374_2297941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376911.1|2298065_2298719_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_027243158.1|2298745_2300206_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376909.1|2300302_2301280_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_048875878.1|2301749_2303153_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063577.1|2303678_2303972_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_026063576.1|2304198_2304963_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_017376905.1|2305170_2305398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|2305461_2305644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376903.1|2306206_2306386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376902.1|2306449_2306761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|2307615_2308320_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376899.1|2308517_2308658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772665.1|2309062_2309587_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144420633.1|2309733_2310990_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|2311057_2311537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2311977_2313381_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243186.1|2313795_2316177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377475.1|2316683_2318576_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_036771639.1|2318747_2319722_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377472.1|2320025_2320832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377471.1|2320900_2321512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377467.1|2322993_2323290_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_075275282.1|2323286_2324129_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|2324519_2325305_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_080999974.1|2325309_2326713_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2325237:2325997	attR	TAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCCTTCAATGACCTCTAAGACTAATGGCACTACCTTAAGGAGCGGATGAACATTTTTTATTGCTATTTTTCTTCATTCTTTTAGTTATTTCTGCCTTTTCCAATTCCCTGCTTTTATTCAGTCGCCTGAATGCTTTGGGACGTTTTTTAACAGCCCGAGGTTCAATCCGTCCAGGCCTATTCCCAACCTTGTTTTTTATGATTGCATGCAACAATATTGCATGGGCTTTATTACAGTCTGCCGAGAAACTGAGTAATGACACAAAGCTATTAAATAACTGTATTACATCCTTGAAACTAACCTGTATAGGAAGGCGTTCAGTATTACGACAAGCTTCTGCAATAAGCGTTCTAATTAAGTTGTATGCTAAAAAGTGTACTGCAATTTCTTTATGTACCATGTCAGGTGTCTTACTTCTTAAATGATCCATTGACATAATGGTTTTTAAGCTGTTGAAATTGATTTCAATGTGCCACCTTTGTTTGTAATGATTAGCCAATGCAACTTTATTGTATTTTTTATGATCTTGAAAAGTTGTTACATAAACCTCCCCTTTGATTTTGAACTCTCTTACCGTCATTTGATCAGGATAACTATCGTATGTTTCTTGTGTCATCCAGTCAGGTTTGTGAGGCTTTTTCCAAATGACAAGGTGATTTTTTGAACCCAACTTCCTTCCTTTACGAAAGTCATACTTCCTCTGTGAATGTGCTTTAAAAATA	NA	NA	NA	NA
WP_048875933.1|2326986_2327931_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	2348773	2376426	3195235	protease,transposase	Staphylococcus_phage(25.0%)	28	NA	NA
WP_017377305.1|2348773_2350075_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_016209647.1|2350156_2350762_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377304.1|2350874_2352179_-	trigger factor	NA	NA	NA	NA	NA
WP_017377303.1|2352779_2353655_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_075275279.1|2353770_2354442_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377301.1|2354621_2355977_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_017377300.1|2356097_2356835_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_144420629.1|2356913_2357630_-	aldolase	NA	NA	NA	NA	NA
WP_036771756.1|2358278_2359553_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2359583_2360159_+	VOC family protein	NA	NA	NA	NA	NA
WP_017377295.1|2360203_2361169_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_027243030.1|2361632_2362541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875931.1|2362928_2363180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377293.1|2363324_2363753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|2363738_2364683_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046611.1|2364887_2365040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910637.1|2365068_2365803_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_017377288.1|2365897_2366158_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999973.1|2366376_2367342_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_146619452.1|2367318_2367615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|2367805_2368255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|2368514_2368943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|2369038_2369539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|2369475_2369637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420627.1|2370517_2370739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093666.1|2372237_2372915_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_081377824.1|2374229_2374568_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2375451_2376426_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 30
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	2415670	2543134	3195235	transposase,tRNA	Burkholderia_virus(25.0%)	106	NA	NA
WP_080999971.1|2415670_2417074_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377224.1|2417187_2417763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|2419008_2419236_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377221.1|2419525_2420065_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_027243151.1|2420374_2421862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300719.1|2421913_2422339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2422557_2423961_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377217.1|2423957_2424335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243150.1|2424294_2424840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|2425235_2426462_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377214.1|2427062_2428715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046613.1|2428651_2428846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963645.1|2429178_2430369_-	MFS transporter	NA	NA	NA	NA	NA
WP_027243147.1|2430617_2433290_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_027243146.1|2433578_2434415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420769.1|2435075_2435966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2436434_2437409_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876012.1|2437893_2439297_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|2439442_2440846_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420624.1|2440930_2442745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999970.1|2444656_2446060_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376197.1|2446093_2447623_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_017376198.1|2447658_2449119_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_027242908.1|2449093_2450053_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_017376200.1|2450130_2453637_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.6	1.9e-192
WP_017376201.1|2453660_2454230_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	43.4	3.4e-27
WP_027242907.1|2454443_2455598_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_017376204.1|2455616_2456390_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|2456389_2456836_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017376206.1|2456853_2457903_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_017376207.1|2458013_2458547_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_036771893.1|2458627_2461045_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_027242906.1|2461329_2462397_+	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_017376209.1|2464599_2465664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376210.1|2465653_2466682_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_017376211.1|2466678_2467218_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_017376212.1|2467754_2469665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242905.1|2469712_2469901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420622.1|2470109_2471687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771906.1|2471783_2472659_-	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_080963646.1|2472747_2473647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063514.1|2473561_2474308_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.0	6.6e-23
WP_017376216.1|2474315_2474873_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_017376217.1|2474876_2475614_-	UMP kinase	NA	NA	NA	NA	NA
WP_017376218.1|2475617_2476496_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_017376219.1|2476660_2477428_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_017376220.1|2477834_2478644_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376221.1|2478721_2481379_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_017376222.1|2481382_2482420_+	asparaginase	NA	NA	NA	NA	NA
WP_017376223.1|2482421_2483243_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376224.1|2483373_2484258_+	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_036773116.1|2484570_2485545_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|2485597_2486593_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2486635_2487610_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376319.1|2488234_2488915_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_017376318.1|2488914_2489724_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027242903.1|2489797_2493478_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_026063524.1|2493487_2494975_-	ribonuclease G	NA	NA	NA	NA	NA
WP_017376313.1|2494984_2495602_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_017376312.1|2495671_2496190_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376311.1|2496186_2497086_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2497101_2498145_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376309.1|2498342_2498630_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_017376308.1|2498750_2500211_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_027242902.1|2500290_2501727_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_036771325.1|2501851_2502826_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420621.1|2505016_2505778_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2506935_2507163_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377706.1|2508116_2508329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|2508346_2508664_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242901.1|2508690_2509380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377709.1|2509720_2509924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420768.1|2510055_2510991_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047927332.1|2511003_2511786_-	lipoprotein	NA	NA	NA	NA	NA
WP_017377712.1|2511915_2512227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242900.1|2512570_2512897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377714.1|2512921_2513377_-	arginine repressor	NA	NA	NA	NA	NA
WP_017377715.1|2513366_2514419_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377716.1|2514421_2515885_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377787.1|2516019_2516247_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377718.1|2517663_2518128_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036773913.1|2518384_2519200_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377721.1|2519328_2521641_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_017377722.1|2521757_2522285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377723.1|2522976_2524254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377724.1|2524264_2524516_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377725.1|2524549_2525071_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377726.1|2525240_2526227_-	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377727.1|2526317_2527133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773915.1|2527561_2527957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2527929_2528157_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_047927746.1|2529125_2529713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|2530315_2530987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875918.1|2531131_2531713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420767.1|2531755_2532433_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243185.1|2532711_2533668_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_017377736.1|2533727_2534393_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017377737.1|2534426_2534972_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_155046615.1|2535251_2535413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774946.1|2536109_2536724_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_144420620.1|2536650_2537853_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875923.1|2537838_2538834_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875916.1|2538837_2539242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2540209_2540437_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971647.1|2541405_2542002_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046616.1|2541970_2543134_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	31.4	2.1e-20
>prophage 31
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	2552855	2604269	3195235	transposase,tRNA	Bacillus_phage(20.0%)	55	NA	NA
WP_048876031.1|2552855_2554259_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963580.1|2554364_2554589_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|2554771_2555593_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377842.1|2555738_2555993_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377841.1|2556381_2558166_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_017377840.1|2558254_2558974_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_027243134.1|2559135_2559342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243135.1|2559341_2559578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|2559590_2559944_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243136.1|2560481_2561315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377835.1|2561407_2561605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063682.1|2561702_2563088_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377833.1|2563214_2563805_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_017377223.1|2564836_2565124_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2565183_2565348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|2565344_2566715_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|2567081_2568494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|2568563_2569334_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_027243138.1|2569826_2570114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|2571590_2571884_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_144420618.1|2571841_2572663_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_026063680.1|2572807_2573032_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155046618.1|2573286_2573814_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_080999968.1|2573990_2574251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420617.1|2574169_2574325_+	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|2574423_2575398_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999967.1|2576726_2576876_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377700.1|2576992_2577286_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017376598.1|2578094_2578670_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|2578747_2579623_-	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376596.1|2579687_2580308_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027243040.1|2580292_2581375_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376593.1|2581608_2582013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376591.1|2583503_2584805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376590.1|2584951_2585620_+	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_144420764.1|2586552_2587116_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376588.1|2587172_2588369_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_017376587.1|2588493_2589858_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376586.1|2589854_2590946_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376585.1|2591200_2591851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|2592043_2592238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|2592345_2592498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376583.1|2592764_2593892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063543.1|2593981_2594815_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376581.1|2594818_2595469_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_017376580.1|2595458_2596298_-	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_016210074.1|2596303_2596930_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376579.1|2597090_2597633_+	septation protein A	NA	NA	NA	NA	NA
WP_017376578.1|2597716_2598019_+	YciI family protein	NA	NA	NA	NA	NA
WP_144420763.1|2598036_2598279_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376576.1|2598377_2598650_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_017376575.1|2598688_2599327_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376574.1|2599359_2600451_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376573.1|2600622_2602365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2603294_2604269_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 32
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	2613563	2732024	3195235	transposase,tRNA	Staphylococcus_phage(29.63%)	107	NA	NA
WP_080999966.1|2613563_2614913_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242585.1|2615210_2615768_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376558.1|2615861_2616368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376557.1|2616872_2617568_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_144420615.1|2617698_2618487_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_048876031.1|2618520_2619924_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875857.1|2620347_2621322_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017377787.1|2621578_2621806_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377821.1|2622893_2623424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377820.1|2623420_2624953_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2624949_2625900_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2626320_2626953_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2627195_2627393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2627742_2628171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|2628248_2629244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856754.1|2629388_2629640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|2629744_2630389_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2630624_2631122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2631633_2632608_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017377700.1|2632978_2633272_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017375632.1|2634084_2634420_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377815.1|2634740_2636279_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_144420614.1|2636431_2637530_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_036773165.1|2637768_2638968_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_027243005.1|2638998_2639625_+	ribonuclease T	NA	NA	NA	NA	NA
WP_017377811.1|2639653_2640538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275272.1|2640671_2640902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|2641039_2642281_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_144420613.1|2642560_2642932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|2645063_2645225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|2645600_2646728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|2646844_2647507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|2647592_2647853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|2648271_2649033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377799.1|2651094_2651754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377798.1|2651854_2652505_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_075275388.1|2652652_2653342_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377795.1|2653364_2654528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|2654732_2654984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046691.1|2655507_2656104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2656303_2657278_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376009.1|2658632_2658923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376008.1|2659245_2660283_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376007.1|2660313_2661768_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376006.1|2661777_2662962_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376005.1|2663035_2664043_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376004.1|2664111_2666115_-	transketolase	NA	NA	NA	NA	NA
WP_017376003.1|2666566_2667727_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_017376001.1|2667963_2669079_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376000.1|2669241_2669766_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_017375999.1|2669765_2670296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2671955_2672831_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420759.1|2672951_2673452_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376501.1|2673448_2673715_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_048875903.1|2673880_2674855_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_075275269.1|2675034_2675655_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|2675961_2677365_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771922.1|2678199_2679390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377263.1|2679956_2680424_-	DoxX family protein	NA	NA	NA	NA	NA
WP_017377264.1|2680925_2681180_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377265.1|2681381_2681885_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_036771941.1|2682101_2682707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2682867_2683551_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|2683626_2684406_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_017377269.1|2684392_2685253_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377270.1|2685376_2685742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377271.1|2686127_2686457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|2686867_2687842_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_144420611.1|2688376_2688577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155052690.1|2688609_2689941_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	2.4e-36
WP_017377275.1|2691023_2691746_+	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377276.1|2691737_2692106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243089.1|2692368_2693670_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377277.1|2693765_2694209_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_017377278.1|2694212_2694722_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377279.1|2694714_2697528_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_048875900.1|2698024_2698957_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377282.1|2699061_2699988_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_017377283.1|2700166_2701705_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2701878_2702139_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377686.1|2703413_2704022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2704068_2704797_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_155046620.1|2705043_2705181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377696.1|2706343_2706883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|2707117_2708029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377698.1|2708288_2708585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910634.1|2708929_2710083_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377702.1|2710679_2711228_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_144420757.1|2711331_2711895_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377704.1|2712112_2712871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|2714146_2714374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|2714596_2714776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971672.1|2715031_2716288_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875897.1|2716355_2717000_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_017378393.1|2717804_2718011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816949.1|2719011_2719410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378390.1|2719603_2721181_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_017378389.1|2721314_2722256_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378388.1|2722257_2723031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963621.1|2724639_2724846_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_016211707.1|2725112_2725400_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_017378384.1|2725405_2727787_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378383.1|2727799_2728795_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_016210495.1|2728926_2729286_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378382.1|2729328_2729523_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075273353.1|2729557_2730088_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378381.1|2730092_2732024_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
>prophage 33
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	2769802	2822831	3195235	transposase	Staphylococcus_phage(50.0%)	45	NA	NA
WP_048875857.1|2769802_2770777_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378343.1|2770933_2772508_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_017378342.1|2772732_2773011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378341.1|2773080_2773956_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_016210208.1|2773965_2775126_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_017378340.1|2775240_2776389_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_017378339.1|2776399_2779201_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_017378338.1|2779307_2780006_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_017378337.1|2780018_2781782_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_016210223.1|2781785_2782133_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_017378336.1|2782126_2782501_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_017378335.1|2783448_2784732_+	citrate synthase	NA	NA	NA	NA	NA
WP_017378334.1|2785141_2786437_+	MFS transporter	NA	NA	NA	NA	NA
WP_017378333.1|2786792_2787338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242732.1|2787925_2788447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420607.1|2788458_2789838_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_017378329.1|2790073_2790508_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_017378328.1|2790504_2791857_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_027242734.1|2791856_2792972_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_017378326.1|2792972_2793989_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_017378325.1|2793978_2795649_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_017378324.1|2795668_2796004_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_036772382.1|2796031_2797471_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_047927447.1|2797467_2798514_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017378320.1|2798656_2800153_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017378319.1|2800448_2801450_+	glucokinase	NA	NA	NA	NA	NA
WP_080963617.1|2801555_2802167_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_144420755.1|2802287_2802665_-	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_027242736.1|2802715_2804122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378315.1|2804115_2805183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378314.1|2805289_2806891_-	APC family permease	NA	NA	NA	NA	NA
WP_027242737.1|2807139_2808057_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242738.1|2808125_2809820_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.3e-20
WP_017378310.1|2810054_2810984_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048876031.1|2811014_2812418_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378308.1|2812648_2813353_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_017378307.1|2813419_2814076_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_036774478.1|2814086_2814968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242739.1|2815138_2817808_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036771639.1|2818168_2819143_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_036771744.1|2819222_2820194_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2820247_2821222_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772729.1|2821341_2821563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420754.1|2821626_2821935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|2821859_2822831_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	2837397	2891658	3195235	transposase	Staphylococcus_phage(37.5%)	51	NA	NA
WP_026063658.1|2837397_2838126_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_027243070.1|2838435_2838690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2839403_2842058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378171.1|2842096_2842387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2842503_2843802_+	MFS transporter	NA	NA	NA	NA	NA
WP_036772686.1|2844372_2844861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420604.1|2844841_2845144_+	VUT family protein	NA	NA	NA	NA	NA
WP_075275265.1|2845390_2845879_+	VUT family protein	NA	NA	NA	NA	NA
WP_027243073.1|2845912_2846551_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243074.1|2846672_2847212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2847301_2848528_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_155046619.1|2849140_2849398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420603.1|2849484_2850384_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420602.1|2850528_2850795_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2850786_2850936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2851163_2852039_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2852168_2852396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815640.1|2852462_2852657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2852715_2853690_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963634.1|2853727_2853916_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_017376778.1|2853916_2855689_-	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_144420601.1|2855678_2856671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376776.1|2857278_2857971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376774.1|2858457_2859027_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_036771639.1|2859023_2859998_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_080999963.1|2860037_2860541_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856766.1|2860631_2862035_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2862733_2862919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|2863024_2864428_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420599.1|2864432_2865005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375939.1|2865038_2866466_-	amino acid permease	NA	NA	NA	NA	NA
WP_036772717.1|2867751_2870121_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.4	3.7e-160
WP_017375937.1|2870196_2871015_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_027243188.1|2871366_2871912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971669.1|2872394_2873633_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2873609_2874584_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017375625.1|2874676_2874904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376551.1|2874908_2875400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243039.1|2876072_2876960_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_027243038.1|2877049_2878540_-	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_017376549.1|2878563_2879445_-	ROK family protein	NA	NA	NA	NA	NA
WP_017376548.1|2879441_2880164_-	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376547.1|2880863_2881655_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016210862.1|2881841_2882087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420598.1|2882238_2882469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376543.1|2882498_2883278_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_047927468.1|2883303_2883609_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_144420752.1|2883605_2884499_-	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_027243035.1|2884854_2886153_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376538.1|2888755_2889937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|2890230_2891658_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	2899244	2948945	3195235	transposase,tRNA	Bodo_saltans_virus(14.29%)	43	NA	NA
WP_062312049.1|2899244_2900612_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243033.1|2901104_2901584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875888.1|2901763_2903827_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_144420751.1|2903835_2904561_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_017375919.1|2905188_2905902_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017375920.1|2905906_2906437_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375921.1|2906671_2906905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971668.1|2907017_2907266_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_144420596.1|2908073_2910266_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_017375924.1|2910283_2910592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2911245_2912955_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017378284.1|2913148_2913304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2914706_2915582_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243077.1|2915907_2916669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2916893_2917625_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_017376852.1|2917621_2918158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376851.1|2918211_2918976_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376850.1|2918978_2920556_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376849.1|2920562_2921039_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2921014_2921446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376847.1|2921478_2922234_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|2922408_2922696_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_027243078.1|2923078_2923303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2923642_2924806_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243079.1|2924840_2925818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2925811_2926498_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017376843.1|2926436_2927552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2927831_2928437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243081.1|2928674_2929124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2930976_2931630_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_027243083.1|2931742_2932294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2932393_2933368_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243084.1|2933653_2934178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376838.1|2934875_2935700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875886.1|2935955_2936312_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053856766.1|2936308_2937712_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243085.1|2937831_2938392_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_017376236.1|2938549_2939116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243087.1|2941936_2942632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376234.1|2942672_2942885_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376229.1|2944457_2945567_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376228.1|2945622_2947104_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_048876031.1|2947541_2948945_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 36
NZ_CP039112	Piscirickettsia salmonis strain Psal-135 chromosome, complete genome	3195235	3076627	3141876	3195235	protease,transposase	Hokovirus(14.29%)	55	NA	NA
WP_017376170.1|3076627_3077728_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
WP_017376171.1|3078085_3079060_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771588.1|3079196_3080075_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_016209597.1|3080082_3080313_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771607.1|3080366_3081371_-	OmpA family protein	NA	NA	NA	NA	NA
WP_036771589.1|3081589_3082417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420747.1|3082498_3083887_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_017376176.1|3084174_3085575_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_017376177.1|3085669_3086596_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_027242699.1|3086592_3087729_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_027242700.1|3087725_3088733_-	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242701.1|3088729_3089893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376183.1|3089902_3090754_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242702.1|3090785_3091958_-	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_065653741.1|3091954_3093343_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_017376186.1|3093371_3093779_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_017376187.1|3093798_3094806_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376188.1|3094802_3095675_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_036771610.1|3095671_3096532_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_065653742.1|3096533_3098804_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_017376192.1|3098805_3099951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376193.1|3099997_3100483_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_027242703.1|3100522_3101146_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376237.1|3106825_3107578_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243062.1|3108909_3109533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243063.1|3109637_3110426_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243064.1|3110425_3111157_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376241.1|3111190_3112918_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_017376242.1|3112931_3113993_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376243.1|3114307_3115522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376244.1|3115654_3116179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063518.1|3116796_3117645_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376247.1|3117631_3118330_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_017376248.1|3118384_3119146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376249.1|3119138_3119561_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376250.1|3119690_3120242_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376251.1|3120297_3121260_-	TonB family protein	NA	NA	NA	NA	NA
WP_144420746.1|3121260_3121476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376253.1|3121662_3122472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|3122451_3123294_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376255.1|3123290_3124535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376256.1|3124673_3125762_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376257.1|3125779_3126280_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376258.1|3126467_3127067_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376259.1|3127072_3128236_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376260.1|3128268_3129222_+	glutathione synthase	NA	NA	NA	NA	NA
WP_017376261.1|3129585_3130650_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027243065.1|3130646_3133709_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_144420745.1|3133861_3134314_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243066.1|3134345_3134702_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772645.1|3135120_3135894_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376269.1|3138517_3138808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|3139032_3139908_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|3139904_3140462_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|3140472_3141876_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039113	Piscirickettsia salmonis strain Psal-135 plasmid unnamed1, complete sequence	186021	0	52409	186021	transposase,terminase,portal	Streptococcus_phage(47.37%)	58	NA	NA
WP_017377655.1|1412_1658_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|1654_2041_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772434.1|2128_2857_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_080963659.1|2835_3456_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377658.1|3801_4488_+	Fic family protein	NA	NA	NA	NA	NA
WP_082304501.1|5437_5800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|5802_7542_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046629.1|7943_8096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929558.1|8123_8807_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_036771347.1|8888_9866_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_081000019.1|9941_10112_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|10152_10881_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_036771293.1|11426_11693_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772437.1|11988_13887_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017377694.1|14308_15037_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_082884401.1|15134_15257_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046630.1|15673_15838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375754.1|15858_17145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771359.1|17327_18056_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_036771347.1|18183_19161_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046631.1|19235_19886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126795.1|22517_22778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772441.1|22781_23054_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_017375910.1|23129_23858_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_048876229.1|24427_25399_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048876208.1|26263_27091_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_036771289.1|27944_28415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046633.1|29308_29452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242940.1|30658_31258_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_017375850.1|31611_32388_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_036771279.1|32748_33477_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_155046634.1|33546_33747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876229.1|33665_34637_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_027242938.1|35050_35419_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_017375972.1|35420_35729_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017375841.1|36173_36383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|36689_36908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242936.1|36904_37357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420845.1|37484_37715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876207.1|38220_39696_-	response regulator	NA	NA	NA	NA	NA
WP_017375966.1|39696_40263_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_144420846.1|40407_40872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375964.1|40876_41302_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
WP_036817204.1|41572_42568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619517.1|42797_42950_-	phosphatase	NA	NA	NA	NA	NA
WP_081078123.1|42979_43342_+	HigA family addiction module antidote protein	NA	A0A2I7RIN6	Vibrio_phage	46.6	3.5e-06
WP_026063496.1|44220_44586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242932.1|44718_44946_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242931.1|44954_45362_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_027242930.1|45507_46890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375952.1|47079_47283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242929.1|47478_47862_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|47948_48431_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|48433_49765_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_047927581.1|49969_50404_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_087910668.1|50490_50877_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|50914_51649_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|51695_52409_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
>prophage 2
NZ_CP039113	Piscirickettsia salmonis strain Psal-135 plasmid unnamed1, complete sequence	186021	57501	183403	186021	portal,head,integrase,capsid,tail,transposase	Streptococcus_phage(31.67%)	120	70525:70584	122790:123304
WP_017377509.1|57501_58230_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_075275482.1|58323_59298_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_027242596.1|59611_59974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|60013_60523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420849.1|60754_61735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|62200_63178_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|63658_64636_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046636.1|64650_64812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243211.1|65029_65284_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_027243212.1|65273_65561_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_036771347.1|66055_67033_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_027243215.1|67144_68167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774350.1|68649_69378_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
70525:70584	attL	CGTATAGCGAAAATCTCGGGGGATTGCCCCCGTGATGGGCATTGTGGTTCTGTCGCAATT	NA	NA	NA	NA
WP_048876194.1|70617_71151_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_080963665.1|71331_71673_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_080963664.1|71853_72120_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_027243206.1|72192_74058_-	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_047927778.1|74225_74510_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|74853_75582_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046637.1|75663_76155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|76887_77115_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876191.1|78666_79095_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_081000015.1|79030_79417_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|79446_80175_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|80186_80336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|80582_81311_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036774388.1|82688_83651_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027242592.1|83674_84004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|84070_85111_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_144420833.1|85124_85316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774378.1|85520_86090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774316.1|86132_86432_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774376.1|86428_86857_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774373.1|87166_87895_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_048876188.1|88068_88842_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_027243202.1|89555_90491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|90765_91494_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243201.1|91659_91899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929623.1|91962_95304_+	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_036772541.1|95461_96190_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_144420834.1|96483_96879_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036815648.1|96931_97660_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772541.1|98143_98872_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_027243197.1|99042_99612_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_087910667.1|99616_100300_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_036772541.1|100451_101180_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_080963627.1|101198_101417_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774644.1|102396_103458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|103966_104713_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_027243200.1|104713_105118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|105424_106399_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_036771293.1|106938_107205_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771296.1|107500_109396_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_048876182.1|109751_111647_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017375632.1|112346_112682_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017375836.1|112876_113080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243203.1|113173_113968_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
WP_080999971.1|118018_119422_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000017.1|119686_119938_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_048875857.1|120338_121313_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.2e-26
WP_048876221.1|122300_122756_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
WP_016212398.1|122850_123312_-	hypothetical protein	NA	NA	NA	NA	NA
122790:123304	attR	AATTGCGACAGAACCACAATGCCCATCACGGGGGCAATCCCCCGAGATTTTCGCTATACGGTTAAAAAATAATTTTTTCTTTAGAAAAGAAATTATTATTGCTAACTACTCTAAAGTCATAATAATGACCGTACATTCCTCCACCATTATCTCCCTGTCTATGAGCTAAATATGCAGGATCTTCTGCTTTTGCACTTTTATCGATTTTTTGACATATTTTATCAATAGCGTTCATTTGACTTTGACTAACATCATAATAGTTATCTTTGCCTCCAACATTATTTATATAAATAACATTTACAAGGCGAGCTGGATGATATGCACATGTGAAGCCTTCAGGTGCTTGTCCATCAGAACATCGCGCTGAATAATAAGATGTTTGATCAAAAGGATCTCCTCCTCCTTCAGGATAGACTTTATGCGTTGCTCCTCCACAAACAATCCAAGGACTCCAGGCAACTGCCCAGCCACTTGATATAACACTTAACACAATCACTCCAATAGTTTTTTTTATA	NA	NA	NA	NA
WP_036773695.1|125372_127445_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_017377509.1|127474_128203_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_144420837.1|128344_129277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377511.1|129306_130035_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|130037_130310_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|131160_131889_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017375558.1|132001_132565_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|133713_134442_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155052706.1|135146_135791_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377667.1|136460_136631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377666.1|136775_137033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036815609.1|138933_139389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816769.1|139632_140031_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_047927763.1|140027_140291_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_048876259.1|140782_141799_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_027243195.1|142124_143171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|143536_144511_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
WP_017375692.1|144654_144888_+	hypothetical protein	NA	Q7Y5W4	Haemophilus_phage	42.6	1.3e-06
WP_017375691.1|144911_145613_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	37.6	9.6e-32
WP_036773107.1|145596_145914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|146201_147176_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242588.1|147514_147868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771953.1|147884_150164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|150626_151601_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_075275454.1|151650_152190_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_027242598.1|152203_152788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375778.1|153172_153484_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_017375779.1|153480_153906_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375780.1|154084_154480_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375781.1|154476_154827_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375782.1|154826_155249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375783.1|155250_155574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375784.1|155630_155897_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036771950.1|155900_157979_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375786.1|157971_158313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375787.1|158309_158981_+|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_144420832.1|158910_159696_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375789.1|159685_160243_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_027242568.1|160239_162930_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375652.1|162988_163417_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|163444_164422_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017377525.1|164805_165603_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_075275471.1|166143_167118_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.3e-26
WP_155046640.1|167753_167921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876214.1|167889_168618_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.1e-38
WP_017377521.1|169126_169480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|170407_171136_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243190.1|171718_175063_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_048876213.1|175371_176262_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275473.1|177500_177677_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_027243191.1|177793_178501_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_048876212.1|178454_179333_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_144420840.1|179363_179795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|180177_180882_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_036772541.1|180893_181622_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|181651_182041_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|182063_182792_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|182794_183403_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
>prophage 1
NZ_CP039115	Piscirickettsia salmonis strain Psal-135 plasmid unnamed3, complete sequence	50691	2917	16713	50691	capsid,transposase,head,tail	Moraxella_phage(18.18%)	18	NA	NA
WP_036771347.1|2917_3895_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017375652.1|3922_4351_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242568.1|4409_7100_-	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375789.1|7096_7654_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_144420832.1|7643_8429_-	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375787.1|8358_9030_-|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_017375786.1|9026_9368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771950.1|9360_11439_-|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375784.1|11442_11709_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_017375783.1|11765_12089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375782.1|12090_12513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375781.1|12512_12863_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375780.1|12859_13255_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375779.1|13433_13859_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375778.1|13855_14167_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_027242598.1|14551_15136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275454.1|15149_15689_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_036771639.1|15738_16713_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
>prophage 1
NZ_CP039116	Piscirickettsia salmonis strain Psal-135 plasmid unnamed4, complete sequence	33468	3315	19337	33468	transposase,capsid,integrase,head,terminase,tail	unidentified_phage(35.71%)	21	NA	NA
WP_036771330.1|3315_4290_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212329.1|4825_5416_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_027242955.1|5646_5907_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211078.1|5899_6253_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_069971681.1|6429_7404_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_027242954.1|7936_8302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242953.1|8446_8701_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_080963620.1|8684_9041_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_036771330.1|9138_10113_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242951.1|10738_11605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242950.1|11817_12201_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242949.1|12287_12770_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242948.1|12772_12958_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_036771330.1|12977_13952_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_075275490.1|14048_14441_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242946.1|14476_15058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|15438_16413_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_144420855.1|16486_16702_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027242945.1|17505_18021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242944.1|18366_18924_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242943.1|18920_19337_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
