The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	45582	58682	3052697	transposase	Moraxella_phage(25.0%)	17	NA	NA
WP_075273371.1|45582_46158_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46103_46469_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211193.1|46667_47429_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_036779326.1|47730_49257_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49628_50468_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50507_51815_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51789_52959_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|53013_53739_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54017_54407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54594_55500_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55547_55691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273385.1|55738_56542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007063.1|56569_57055_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	52.0	1.3e-40
WP_032126362.1|57092_57458_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|57403_57979_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007062.1|57942_58272_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.0	7.7e-08
WP_017377700.1|58388_58682_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
>prophage 2
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	152596	201593	3052697	transposase,protease	Bacillus_phage(50.0%)	57	NA	NA
WP_054300545.1|152596_153658_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_098082829.1|154052_154448_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|154469_154835_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|154891_155056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|155045_155345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300544.1|155435_155882_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|156377_156944_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|156955_157741_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|158372_159296_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|159347_160343_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|160374_160869_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_032126724.1|160960_161218_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|161307_161730_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|162048_162765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|162808_163060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300543.1|163064_164501_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|164528_165971_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|166058_166397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|166481_167012_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|167072_169265_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|169307_169793_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|170062_170494_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036778324.1|170511_171342_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|171356_171500_-	lipoprotein	NA	NA	NA	NA	NA
WP_016210239.1|171530_172415_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|172386_172608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|172781_173060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300542.1|173740_173977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|174002_174908_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_129556686.1|175338_176220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|176453_177029_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|176974_177340_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300541.1|177667_178447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126848.1|178980_179781_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_016211858.1|179999_180758_+	ion transporter	NA	NA	NA	NA	NA
WP_016211859.1|180834_181122_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_075273327.1|181125_181701_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|181646_182012_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728339.1|182075_182348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300540.1|182615_182840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300539.1|183855_185199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210775.1|185491_186085_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_017377589.1|186053_186707_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016210784.1|186884_187856_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210782.1|187878_188775_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_016210786.1|188933_189380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779493.1|189376_190018_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016210789.1|190127_190706_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_016210776.1|191181_191619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047085.1|191943_193284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210785.1|193547_194942_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_054300538.1|196390_197458_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209863.1|197510_197933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209853.1|198173_198617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209873.1|198671_198929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209868.1|198906_199533_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_016209871.1|199610_201593_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
>prophage 3
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	217478	271377	3052697	tail,transposase,tRNA	Acinetobacter_phage(50.0%)	44	NA	NA
WP_016209854.1|217478_218465_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|218457_218700_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|218821_220366_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_032126611.1|220412_221699_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|221741_223136_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|223159_223339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|223335_223911_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|223856_224222_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210079.1|227227_227725_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|227895_228591_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|228693_230256_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|230571_232365_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|232450_232723_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|232728_233355_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|233341_234772_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|235104_236160_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|236128_236806_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|236795_237632_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|237791_238085_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_122940784.1|238191_238998_-	trfA family protein	NA	NA	NA	NA	NA
WP_016210083.1|239302_240157_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_016210082.1|240311_241361_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_054300536.1|241411_242068_-	DedA family protein	NA	NA	NA	NA	NA
WP_016210097.1|242085_243366_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_016210096.1|243639_245001_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_155046933.1|245274_245952_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_016211802.1|251384_252656_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_036778206.1|252712_253696_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_016211800.1|253692_254478_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_032126362.1|255174_255540_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273371.1|255485_256061_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300535.1|256064_256784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|256928_257129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|257176_257638_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|258061_259543_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|259605_260715_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|260812_262774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|263303_263708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|263760_264822_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046934.1|265185_265356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|265729_266812_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_105962623.1|268314_269467_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046935.1|269509_269932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|270224_271377_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 4
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	435008	547260	3052697	transposase,protease,tRNA	Escherichia_phage(32.14%)	105	NA	NA
WP_054300513.1|435008_435872_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|436088_437648_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|437669_438704_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|438752_439322_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|439457_440429_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|440440_442018_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|442083_443070_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_054300512.1|443401_444511_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|444616_445801_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|445878_447867_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|448075_448231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300511.1|448488_448788_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_054300510.1|449058_449241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|449297_449663_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|450579_451986_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|452003_452990_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|452992_454147_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|454143_454839_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|454973_456464_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210494.1|456484_457534_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|457600_458995_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210489.1|459873_461805_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_075273353.1|461809_462340_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|462374_462569_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|462611_462971_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|463390_464386_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_036777440.1|464398_466780_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|466785_467073_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|467344_467821_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|467965_468163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|468287_469262_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|470162_470261_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300507.1|470745_472035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300575.1|472271_472964_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|473005_473779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|473780_474722_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|474854_476432_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|476641_478399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|478947_479706_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|479913_480486_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|480589_481138_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|481439_481685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|481713_482010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941726.1|482277_483201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300506.1|483679_484087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|484158_484887_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_032126799.1|484967_485780_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_129556452.1|486900_487248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|487250_488990_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046941.1|489391_489655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300500.1|490326_491055_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_054300502.1|491084_491762_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.8	2.9e-09
WP_016212477.1|491934_492180_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_032126794.1|492176_492569_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_054300501.1|492580_493309_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_016212066.1|493669_494446_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_016212069.1|494657_494825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212070.1|494799_495399_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_054300500.1|495808_496537_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_017375910.1|497065_497794_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|498692_499421_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211714.1|499495_502840_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|503456_504185_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155046942.1|505117_506004_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|506389_507118_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016212268.1|507274_507859_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_016212269.1|507862_508546_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|509027_509756_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211759.1|510087_511275_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_016211756.1|511520_512246_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_032126312.1|512424_513219_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_129556590.1|513215_513611_-	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_129556490.1|514294_515180_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046943.1|516950_517091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275117.1|517123_517546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211905.1|517789_518200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|518530_519106_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|519051_519417_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300493.1|519478_519691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300492.1|519849_520860_-	protein kinase	NA	NA	NA	NA	NA
WP_016210676.1|521163_523245_-	kinase domain protein	NA	NA	NA	NA	NA
WP_016210671.1|523700_524960_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_036778297.1|525092_525566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210672.1|525574_526957_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_016210677.1|526949_527564_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_016210675.1|527643_528360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210679.1|528527_530852_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.9	2.0e-17
WP_054300491.1|531527_533288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126421.1|533491_534583_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210055.1|534850_535489_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016210070.1|535527_535800_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_032126423.1|535893_536157_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210060.1|536153_536456_-	YciI family protein	NA	NA	NA	NA	NA
WP_016210053.1|536539_537082_-	septation protein A	NA	NA	NA	NA	NA
WP_016210074.1|537243_537870_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_036778098.1|537875_538715_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.3	1.4e-08
WP_016210061.1|538704_539349_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.8e-19
WP_032126424.1|539361_540186_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_016210057.1|540194_540704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210065.1|540844_541504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210075.1|541757_542849_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_016210064.1|542845_544210_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_016210052.1|544334_545531_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
WP_032126425.1|545551_546148_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210066.1|546591_547260_-|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
>prophage 5
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	555734	602624	3052697	transposase,integrase	Escherichia_phage(27.27%)	43	560174:560233	572162:572449
WP_032126790.1|555734_556640_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211874.1|556683_558402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|558720_559800_-	hypothetical protein	NA	NA	NA	NA	NA
560174:560233	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_016212522.1|560344_560599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300489.1|560695_561298_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_155046946.1|561300_561576_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032126389.1|562977_563166_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212230.1|564699_566148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|566203_567357_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_081007057.1|567414_567831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007056.1|569155_569365_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375841.1|569666_569876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|570182_570401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776735.1|570397_570850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212294.1|570863_571208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046947.1|571637_571805_+	phosphatase	NA	NA	NA	NA	NA
WP_016212659.1|571942_572188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212568.1|572332_572482_-	hypothetical protein	NA	NA	NA	NA	NA
572162:572449	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACG	NA	NA	NA	NA
WP_054300484.1|572706_573654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300483.1|574150_574705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211322.1|575240_575831_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211325.1|575893_577414_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	7.3e-85
WP_016211323.1|577403_578501_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	1.0e-27
WP_016211722.1|579928_583231_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	1.7e-54
WP_036780093.1|583240_584062_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_054300201.1|584165_584894_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_054300482.1|584923_586213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007054.1|586728_587961_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	1.1e-27
WP_080664881.1|588123_588330_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300481.1|588419_589148_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_081007053.1|589249_590110_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_016210616.1|590344_593155_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_016210625.1|593403_594150_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_129556587.1|594208_595111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|595210_595576_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|595521_596097_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_051307334.1|596113_596893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210618.1|597159_598209_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_016210617.1|598273_599698_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_036777984.1|599918_600368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210624.1|600386_600626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210615.1|600671_601142_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_075273327.1|602048_602624_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	618718	651905	3052697	transposase,tRNA	Escherichia_phage(57.14%)	34	NA	NA
WP_054300202.1|618718_619447_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_036780855.1|620058_620556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212214.1|620530_621031_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_054300202.1|621189_621918_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019359.1|622062_622260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300478.1|622421_624158_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_054300477.1|624437_625166_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016211623.1|625888_627529_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_036779883.1|627641_628991_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.2	2.1e-75
WP_016211625.1|628987_629857_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_054300475.1|630340_631069_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016212196.1|631477_631723_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_016212195.1|631719_632106_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212193.1|632173_632512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|632634_633363_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211949.1|633502_634753_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_016211951.1|634786_635884_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_054300202.1|636060_636789_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_032126570.1|637005_637305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211816.1|637317_637671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|637712_639326_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_054300202.1|639531_640260_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019244.1|640747_641359_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_036779399.1|641715_641970_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|642068_643853_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_036779389.1|643941_644661_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210951.1|644843_645050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210948.1|645049_645286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|645298_645676_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|646182_647001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210947.1|647094_647292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210946.1|647386_648772_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210945.1|648898_649489_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_054300202.1|651176_651905_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
>prophage 7
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	730303	784985	3052697	transposase,tRNA	Agrobacterium_phage(14.29%)	50	NA	NA
WP_081007050.1|730303_730831_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|730887_731253_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211061.1|731314_731668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211058.1|731788_732322_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_032126660.1|732460_734098_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.2	5.8e-88
WP_016211065.1|734102_734324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211066.1|734421_735435_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_016211063.1|735597_737826_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.0	1.0e-82
WP_032126658.1|737806_738511_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|738745_739075_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_054300464.1|740155_741217_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126663.1|741243_741486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126664.1|742204_742888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212048.1|743081_743639_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_054300173.1|744402_745464_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664847.1|745536_746490_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_054300463.1|746990_749720_+	kinase	NA	NA	NA	NA	NA
WP_016210879.1|749822_750182_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210871.1|750178_750496_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210872.1|750512_751622_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210882.1|751648_752734_-	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210874.1|752856_753897_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210873.1|753911_754562_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210876.1|754629_755472_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_054300462.1|755937_756855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|757873_758068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036794860.1|758144_758438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|758705_759623_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_016211373.1|760173_760320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211374.1|760374_761565_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211370.1|761697_762141_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211369.1|762183_763227_-	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211368.1|763273_764665_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211371.1|764861_765785_+	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211372.1|765771_766629_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016212287.1|772440_773586_-|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_054300173.1|773664_774726_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211408.1|774949_776296_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_016211412.1|776410_777403_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_016211411.1|777406_777904_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_016211407.1|777900_778740_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_051307356.1|778772_780305_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_032126774.1|780464_780800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080728364.1|781696_781969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|782121_782487_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|782432_783008_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300461.1|783099_783408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|783464_783830_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212572.1|783959_784352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|784409_784985_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	841959	873722	3052697	transposase,tRNA	Catovirus(20.0%)	31	NA	NA
WP_016211428.1|841959_844023_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.8	3.8e-36
WP_054300173.1|844293_845355_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300457.1|845515_846805_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300148.1|846992_848054_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273329.1|848101_849403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300455.1|849363_849729_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|849743_850250_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300454.1|850239_850590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|850691_851057_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|851002_851578_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046950.1|851567_851822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300452.1|851871_852933_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210196.1|852890_853244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779341.1|853597_855808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210188.1|855808_856495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210198.1|856806_857358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210195.1|857374_857776_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_016210190.1|857966_858842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126472.1|859061_859712_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_036778866.1|860174_862763_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.9	3.3e-122
WP_016210199.1|862868_863630_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_016210206.1|863626_864163_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	38.4	8.4e-20
WP_016210205.1|864211_865168_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.6	5.3e-49
WP_016210187.1|865248_868434_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_016210201.1|868437_869493_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	3.4e-49
WP_036778872.1|869722_870328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778869.1|870371_871034_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_016210194.1|871068_871416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210193.1|871472_871634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126474.1|872005_872455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|872836_873722_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	879642	925449	3052697	transposase	Staphylococcus_phage(41.67%)	44	NA	NA
WP_081007004.1|879642_880098_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|880057_880396_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300449.1|880525_881305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|881324_882299_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_054300448.1|882342_884712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|884901_885963_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300447.1|886375_889012_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_080664849.1|889060_890149_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016210997.1|890148_890832_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_032126469.1|890891_892553_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210998.1|892706_892961_+	LapA family protein	NA	NA	NA	NA	NA
WP_016211001.1|893038_893344_+	competence protein ComEA	NA	NA	NA	NA	NA
WP_016211002.1|893507_893906_+	VOC family protein	NA	NA	NA	NA	NA
WP_155046951.1|893987_894251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781250.1|895057_895843_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054300446.1|895938_896673_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	1.1e-09
WP_016210826.1|898103_898970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210824.1|899079_900759_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210830.1|900885_902136_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_032126465.1|902211_902673_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210835.1|902669_903818_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_016210836.1|903823_904498_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_052133275.1|904527_905151_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210828.1|905266_905740_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_016210832.1|905741_906164_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210829.1|906150_907170_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_054300445.1|907439_907991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|908085_909147_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212318.1|909675_910107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|910108_910435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781320.1|910421_910649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|911495_912941_-	MFS transporter	NA	NA	NA	NA	NA
WP_016212205.1|913080_913260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046952.1|914945_915107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212177.1|915279_915453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212179.1|915875_916028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300444.1|916448_917510_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|917467_917716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300443.1|917768_918047_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211538.1|918285_919209_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_054300442.1|919903_922000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300441.1|922281_922644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300440.1|922788_924000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|924296_925449_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
>prophage 10
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	960848	997946	3052697	transposase,protease,tRNA	Bacillus_phage(33.33%)	35	NA	NA
WP_026063519.1|960848_961265_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300357.1|961313_962189_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032126686.1|962739_963324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212526.1|964655_965189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273603.1|965312_965489_-	phosphatase	NA	NA	NA	NA	NA
WP_105962625.1|965568_966454_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126745.1|967635_968238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122940402.1|968446_969070_+	porin family protein	NA	NA	NA	NA	NA
WP_016209896.1|969384_969954_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016209891.1|970100_970799_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_036777115.1|970940_971141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209884.1|971217_971841_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052104600.1|971950_972844_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_016209898.1|972950_974561_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_016209888.1|974557_975853_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_016209876.1|975874_977797_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_016209881.1|977907_978210_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_016209893.1|978302_983192_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_052104599.1|983246_984563_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	40.1	3.2e-65
WP_036777110.1|984687_985782_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_016209878.1|985833_986772_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	29.6	1.9e-14
WP_080664826.1|986852_987452_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016209877.1|987618_988509_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_016209887.1|988711_989203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209894.1|989346_989838_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|990006_990720_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556650.1|991148_992123_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_054300433.1|992452_992683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007045.1|992982_993612_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211960.1|993933_994461_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_054300573.1|994724_995858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|995885_996467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|997036_997222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300431.1|997366_997669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007044.1|997628_997946_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	1001068	1044993	3052697	transposase	Staphylococcus_phage(50.0%)	44	NA	NA
WP_129556499.1|1001068_1002222_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_155046705.1|1002327_1002495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|1002440_1003016_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|1003056_1003665_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032126790.1|1003833_1004739_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_129556560.1|1004708_1005245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556559.1|1005325_1005754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212093.1|1005910_1006840_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_075273313.1|1007052_1007391_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1007350_1007806_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212654.1|1007797_1008082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212100.1|1008492_1009413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212098.1|1009413_1010265_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1010985_1012032_+	glutathione synthase	NA	NA	NA	NA	NA
WP_032126840.1|1012015_1014013_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_122941967.1|1014191_1014497_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|1014726_1014933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|1015193_1015895_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046956.1|1016837_1017002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300430.1|1017471_1020228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778728.1|1020463_1021756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300429.1|1021809_1022070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300428.1|1022370_1022934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211709.1|1023078_1023225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|1025484_1027521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007043.1|1028244_1029987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300426.1|1029946_1031581_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_080664852.1|1031593_1032637_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|1032615_1033077_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_016211081.1|1033117_1034053_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211087.1|1034080_1035076_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_054300425.1|1035283_1036246_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126778.1|1036424_1036619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046957.1|1036833_1037685_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_052047048.1|1037740_1038241_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212611.1|1038337_1038658_+	histidine kinase	NA	NA	NA	NA	NA
WP_054300423.1|1038705_1039767_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212519.1|1039841_1040222_+	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_054300422.1|1040492_1040930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300421.1|1040980_1041826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274673.1|1041803_1042802_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1042762_1043128_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046958.1|1043073_1043634_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300417.1|1044018_1044993_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 12
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	1057662	1122552	3052697	transposase,tRNA	Bacillus_phage(30.0%)	59	NA	NA
WP_016210280.1|1057662_1058757_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_016210284.1|1058838_1059360_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210276.1|1059414_1059891_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210275.1|1059946_1060249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210273.1|1060313_1061021_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210274.1|1061393_1061792_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_032126334.1|1061831_1062263_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_016210271.1|1062273_1062957_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_016210285.1|1063023_1065219_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_129556492.1|1065316_1066060_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210283.1|1066087_1066873_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_016210272.1|1066912_1067623_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210279.1|1067610_1068777_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210277.1|1068830_1069664_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210270.1|1069733_1072721_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210281.1|1072762_1074154_+	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_075273303.1|1074167_1074884_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_016211367.1|1075039_1075822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126330.1|1075969_1076929_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_036779263.1|1076983_1078993_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_016211366.1|1079048_1079336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126332.1|1079588_1080788_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_075273298.1|1081434_1082010_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300410.1|1081955_1082321_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|1082454_1083318_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|1083548_1083842_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_155046959.1|1084500_1084674_+	phosphatase	NA	NA	NA	NA	NA
WP_129556495.1|1084822_1085080_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211589.1|1085202_1086435_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_016211592.1|1086424_1087087_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_129556496.1|1087361_1088600_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_032126329.1|1088785_1089415_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211588.1|1089490_1090192_+	cyclase family protein	NA	NA	NA	NA	NA
WP_129556499.1|1090359_1091512_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016212343.1|1091751_1092558_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_016209808.1|1093862_1094231_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_016209824.1|1094227_1095046_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_016209813.1|1095146_1095962_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_016209801.1|1096246_1098301_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_032126324.1|1098300_1098723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209805.1|1098901_1100395_-	neurotransmitter symporter family protein	NA	NA	NA	NA	NA
WP_016209818.1|1100527_1101343_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_016209799.1|1101438_1101855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209815.1|1102241_1102781_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_054300409.1|1103098_1104811_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	4.3e-25
WP_016209812.1|1105257_1107081_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	9.7e-44
WP_016209821.1|1107170_1107503_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016209800.1|1107533_1108130_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_036777933.1|1108126_1109251_+	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_016209822.1|1109386_1110034_+	methyltransferase domain protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_016209810.1|1110090_1112004_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	6.9e-117
WP_016209803.1|1112208_1113246_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209820.1|1113304_1116604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209817.1|1117305_1118274_-	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_016209809.1|1118380_1118869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209823.1|1119293_1119737_+	response regulator	NA	NA	NA	NA	NA
WP_075273327.1|1120958_1121534_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1121479_1121845_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300408.1|1121895_1122552_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
>prophage 13
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	1131090	1196902	3052697	transposase,tRNA	uncultured_Mediterranean_phage(28.57%)	52	NA	NA
WP_155046942.1|1131090_1131976_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273597.1|1131966_1133811_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|1134082_1135057_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556498.1|1135236_1135845_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036778626.1|1135841_1137782_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_016210594.1|1137917_1138571_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_016210595.1|1138747_1139926_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210588.1|1140293_1141619_+	fimV domain protein	NA	NA	NA	NA	NA
WP_032126176.1|1141709_1142492_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210587.1|1142593_1143454_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_016210590.1|1143628_1144891_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210593.1|1144970_1145501_+	colicin V production protein	NA	NA	NA	NA	NA
WP_016210586.1|1145522_1147028_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210592.1|1147040_1147697_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016212005.1|1148086_1149847_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_105962623.1|1150747_1151900_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_032126856.1|1152205_1152547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1152607_1153669_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300406.1|1153969_1156705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|1159004_1159820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273595.1|1160228_1161599_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.6e-12
WP_054300405.1|1161654_1162155_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016209947.1|1162676_1163339_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_036777555.1|1163365_1164595_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209940.1|1164751_1167523_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_052104625.1|1167598_1168042_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209931.1|1168194_1169667_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_016209926.1|1169778_1170840_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209945.1|1170836_1171871_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209932.1|1171873_1172914_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_036777579.1|1173096_1174212_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.9	4.8e-94
WP_016209930.1|1174250_1174604_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_036777561.1|1174624_1176493_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209935.1|1176514_1177459_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_016209925.1|1177692_1177971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1178180_1178819_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209944.1|1178793_1180221_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209927.1|1180421_1181099_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209939.1|1181233_1182508_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209943.1|1182575_1183331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209948.1|1183382_1184300_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_054300404.1|1184408_1185302_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075273594.1|1185374_1186745_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	4.2e-39
WP_054300403.1|1186784_1187759_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	2.0e-27
WP_016211771.1|1188051_1188240_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_016211770.1|1188253_1189387_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_054300402.1|1189586_1193732_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211823.1|1193766_1193955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300401.1|1194334_1194616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1194947_1195301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1195514_1195709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|1196374_1196902_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	1250324	1287621	3052697	transposase	Bacillus_phage(50.0%)	35	NA	NA
WP_032126790.1|1250324_1251230_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1251458_1252730_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_054300386.1|1252754_1253492_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1253744_1254887_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1254903_1256505_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1257016_1257154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1257150_1258428_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|1258777_1258960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273583.1|1259506_1259788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|1260119_1261025_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1261253_1262525_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_054300386.1|1262549_1263287_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1263539_1264682_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1264698_1266300_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1266811_1266949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1266945_1268223_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|1268572_1268755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273583.1|1269301_1269583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|1269914_1270820_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1271048_1272320_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_054300386.1|1272344_1273082_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1273334_1274477_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1274493_1276095_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1276606_1276744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1276740_1278018_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|1278367_1278550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273583.1|1279096_1279378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046960.1|1279504_1280158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212251.1|1280319_1280856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300384.1|1281017_1281833_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273581.1|1282241_1283609_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	1.6e-11
WP_052133287.1|1283664_1284063_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212039.1|1284251_1284809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212040.1|1284985_1286335_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_054300162.1|1286538_1287621_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
>prophage 15
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	1294377	1349968	3052697	transposase,tRNA	Vibrio_phage(18.18%)	51	NA	NA
WP_032126139.1|1294377_1295307_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_054300383.1|1295402_1297883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300382.1|1298153_1298576_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300380.1|1298846_1299503_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1299706_1300072_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|1300086_1300593_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211414.1|1300808_1301627_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|1301734_1302196_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211415.1|1302212_1303136_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211417.1|1303159_1304209_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_051307357.1|1304345_1304939_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211422.1|1304961_1305432_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_032126143.1|1305520_1306792_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_054300250.1|1306891_1307551_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_075273327.1|1307540_1308116_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1308061_1308427_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211838.1|1309136_1309310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211840.1|1309780_1310245_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211839.1|1310403_1311876_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211841.1|1311993_1312446_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|1313305_1314367_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|1314669_1315752_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300381.1|1315762_1316410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300380.1|1316873_1317530_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962623.1|1317858_1319011_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016211470.1|1319613_1320267_+	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_054300379.1|1320326_1322312_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_032126343.1|1322442_1323255_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_032126344.1|1323375_1324464_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_016211467.1|1324466_1325033_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_081007013.1|1325107_1325407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|1326825_1327191_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046961.1|1327358_1327763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032127044.1|1327882_1328083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212482.1|1328297_1328441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1328984_1330137_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_054300378.1|1330146_1331844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210507.1|1333699_1334248_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_075273576.1|1334375_1335104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|1335163_1338661_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_016210514.1|1338718_1339972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210515.1|1340080_1340983_-	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210512.1|1341036_1342074_-	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210506.1|1342209_1343448_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210510.1|1343440_1344169_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_081007040.1|1344199_1344856_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211831.1|1344993_1346721_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016211829.1|1347021_1347375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|1347790_1348291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046962.1|1348942_1349389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1349392_1349968_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	1370754	1411212	3052697	transposase,protease,tRNA	Klosneuvirus(25.0%)	34	NA	NA
WP_016210928.1|1370754_1371060_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_054300375.1|1371274_1371475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728346.1|1372281_1372614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1372631_1373495_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556556.1|1373527_1374103_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1374048_1374414_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211651.1|1374647_1376183_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016211650.1|1376307_1377792_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211648.1|1378451_1378991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126643.1|1380194_1380401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126642.1|1380470_1380932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300374.1|1380967_1383538_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	5.1e-30
WP_016209840.1|1383645_1384131_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_016209844.1|1384303_1385344_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209835.1|1385321_1385804_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209848.1|1385800_1388395_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209832.1|1388701_1388965_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209831.1|1389243_1389942_-	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209841.1|1390161_1390356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209827.1|1390431_1391991_-	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_129556633.1|1392309_1393206_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209845.1|1393422_1394898_-	APC family permease	NA	NA	NA	NA	NA
WP_016209826.1|1395420_1396443_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_016209830.1|1396773_1398141_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209846.1|1398376_1398631_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126639.1|1398646_1399933_+	GTPase HflX	NA	NA	NA	NA	NA
WP_016209836.1|1399952_1401167_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_016209838.1|1401166_1402060_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209839.1|1402257_1403556_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209829.1|1404935_1407335_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209834.1|1407331_1408090_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209842.1|1408266_1408656_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_054300373.1|1409383_1410241_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|1410237_1411212_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 17
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	1439133	1564881	3052697	transposase,integrase,protease,tRNA	Staphylococcus_phage(16.0%)	114	1480440:1480499	1560897:1561862
WP_016211285.1|1439133_1439913_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_016211286.1|1439930_1440278_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_016211289.1|1440389_1440662_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211767.1|1442278_1443088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211764.1|1443638_1444460_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126803.1|1444660_1445893_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_032126804.1|1446015_1446891_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211806.1|1447055_1447781_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_081007037.1|1447823_1449362_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211804.1|1449368_1450754_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
WP_036780332.1|1451448_1452792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212498.1|1453431_1454115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273555.1|1454392_1454926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210332.1|1455056_1455800_-	ribonuclease T2 family protein	NA	NA	NA	NA	NA
WP_016210330.1|1455897_1456281_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210333.1|1456484_1457114_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_032126607.1|1457187_1458471_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_054300368.1|1458810_1460109_+	ankryin	NA	NA	NA	NA	NA
WP_016210325.1|1460262_1461639_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210327.1|1461774_1463106_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_054300367.1|1463166_1463685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210321.1|1463733_1464702_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_129556511.1|1464898_1466335_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300568.1|1466517_1467228_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.3	4.1e-38
WP_054300366.1|1467248_1467662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210320.1|1467811_1468885_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_016210322.1|1469021_1469918_-	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016211334.1|1470247_1470436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211336.1|1470484_1471099_+	chorismate mutase	NA	NA	NA	NA	NA
WP_032126265.1|1471164_1472082_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_052104656.1|1472405_1472909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082827.1|1472985_1474287_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.9	4.1e-28
WP_016211330.1|1474461_1475562_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_032126267.1|1476197_1476440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300365.1|1476433_1476751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300364.1|1476860_1477739_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075273553.1|1477912_1478839_+	MFS transporter	NA	NA	NA	NA	NA
WP_155046964.1|1478828_1479404_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300363.1|1479349_1479697_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212589.1|1480120_1480558_+	MFS transporter	NA	NA	NA	NA	NA
1480440:1480499	attL	TACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAG	NA	NA	NA	NA
WP_129556637.1|1481032_1481812_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1480440:1480499	attL	TACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAG	NA	NA	NA	NA
WP_016210843.1|1482426_1482657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210844.1|1482743_1483871_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.2	5.7e-10
WP_129556513.1|1484046_1485792_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_032126340.1|1485872_1486634_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_155046965.1|1486913_1489370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210839.1|1489521_1490295_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016210841.1|1490353_1490725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1490938_1491913_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211148.1|1492117_1493446_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|1493709_1494279_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211151.1|1494294_1494606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1494615_1495572_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1495684_1496038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211153.1|1496041_1497106_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211145.1|1497106_1498846_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_036779218.1|1498852_1499275_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211144.1|1499258_1499888_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_054300271.1|1500444_1501419_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007035.1|1501458_1502124_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300361.1|1502101_1502398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273651.1|1502949_1503987_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300359.1|1504345_1504918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664876.1|1505141_1507004_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_081377865.1|1507362_1507647_+|transposase	transposase	transposase	NA	NA	NA	NA
1507100:1507389	attR	TACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_032126362.1|1509006_1509372_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
1507100:1507389	attR	TACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_129556638.1|1509950_1510631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273551.1|1510630_1510933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211974.1|1511032_1512154_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_054300357.1|1512436_1513312_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212011.1|1513545_1514667_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_016212013.1|1514888_1515272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212012.1|1515287_1515965_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_054300276.1|1516008_1516983_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_016211994.1|1518461_1518998_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_032126537.1|1519034_1519220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211991.1|1519460_1520366_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126538.1|1521274_1522693_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_081007034.1|1522957_1523242_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_080728343.1|1523223_1523364_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_052104693.1|1523445_1527312_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_016211564.1|1527477_1528353_+	ParA family protein	NA	NA	NA	NA	NA
WP_016211563.1|1528385_1528547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300355.1|1528757_1528943_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|1528932_1529508_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1529453_1529819_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046966.1|1529779_1530160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1530232_1531207_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046967.1|1531345_1531960_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	40.1	1.5e-33
WP_054300353.1|1532010_1532238_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300565.1|1538264_1538765_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_016210112.1|1539458_1540886_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.0	2.5e-55
WP_122943012.1|1541002_1541458_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_016210108.1|1541643_1542909_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	9.1e-49
WP_016210114.1|1543001_1544261_+	calcineurin-like phosphoesterase	NA	NA	NA	NA	NA
WP_016210107.1|1544332_1544605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210101.1|1544894_1546391_-	flagellin domain protein	NA	NA	NA	NA	NA
WP_016210113.1|1548021_1549071_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.5	7.9e-30
WP_016210110.1|1549258_1550014_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	5.4e-65
WP_036777611.1|1550074_1551664_-	APC family permease	NA	NA	NA	NA	NA
WP_016210106.1|1551846_1552938_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_016210105.1|1552957_1553278_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210099.1|1553361_1554639_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_017377579.1|1554660_1555497_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210111.1|1555503_1557138_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_054300275.1|1557442_1558318_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016210117.1|1558553_1558913_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210103.1|1559194_1560553_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_075273327.1|1560905_1561481_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1561426_1561792_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046968.1|1562300_1563453_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.4	2.2e-57
WP_155066176.1|1563462_1563732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1563994_1564360_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1564305_1564881_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	1569730	1618087	3052697	transposase,tRNA	Staphylococcus_phage(20.0%)	40	NA	NA
WP_105962623.1|1569730_1570883_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046942.1|1571268_1572155_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300349.1|1573306_1575031_-	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	25.6	1.7e-05
WP_032126825.1|1575582_1576896_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.5e-51
WP_155049129.1|1576912_1577050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211481.1|1577128_1578271_+	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_098082850.1|1578345_1578522_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_052104609.1|1578557_1579190_-	MarC family protein	NA	NA	NA	NA	NA
WP_032126823.1|1579300_1580023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211482.1|1580011_1582285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1582420_1582759_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1582718_1583174_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212267.1|1583340_1583700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1583980_1584628_+	LysE family translocator	NA	NA	NA	NA	NA
WP_054300161.1|1585254_1586316_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211733.1|1586930_1587755_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_054300347.1|1587810_1589202_-	protein kinase	NA	NA	NA	NA	NA
WP_016211732.1|1589623_1590322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047160.1|1590638_1590938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211399.1|1591072_1591816_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016211403.1|1591829_1592873_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_016211405.1|1593008_1594781_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_129556522.1|1594987_1596220_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_054300271.1|1597530_1598505_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211669.1|1599329_1599680_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211666.1|1599834_1602654_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211664.1|1603026_1603755_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211555.1|1604005_1605364_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_032126677.1|1605438_1606002_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211557.1|1606196_1607426_-	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_016211554.1|1607471_1608098_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_032126678.1|1608424_1609435_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_054300346.1|1609445_1610321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1610467_1611550_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300345.1|1611631_1612711_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1612847_1613213_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1613158_1613734_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1614424_1615399_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1615953_1617015_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1617112_1618087_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 19
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	1646632	1691022	3052697	transposase	Staphylococcus_phage(50.0%)	42	NA	NA
WP_105962625.1|1646632_1647518_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300343.1|1647522_1647750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007030.1|1647785_1648757_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051307341.1|1649450_1651049_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_016210848.1|1651215_1652400_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1652983_1653538_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210850.1|1653786_1655040_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210851.1|1655024_1655696_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210847.1|1655718_1656723_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210849.1|1656751_1658200_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210855.1|1658317_1659295_+	DMT family transporter	NA	NA	NA	NA	NA
WP_155046969.1|1659448_1660265_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1660285_1661260_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273543.1|1661299_1661542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776661.1|1662526_1662856_-	DUF4404 family protein	NA	NA	NA	NA	NA
WP_032126448.1|1662887_1663268_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_016211178.1|1663358_1664387_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016211180.1|1664449_1664914_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_032126449.1|1664934_1665858_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_081007029.1|1665924_1666533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776658.1|1666645_1668640_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211177.1|1669031_1670252_+	amino acid permease	NA	NA	NA	NA	NA
WP_155046970.1|1671676_1671925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046971.1|1672002_1672548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126783.1|1672658_1673900_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211741.1|1674045_1674822_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126790.1|1675985_1676891_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1677880_1678219_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1678178_1678634_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126602.1|1678786_1680094_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211857.1|1680344_1681223_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_016211855.1|1681219_1681687_-	bacterioferritin	NA	NA	NA	NA	NA
WP_016211856.1|1681813_1681999_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_054300339.1|1682214_1683186_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.2e-25
WP_129556640.1|1683743_1684970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211351.1|1685045_1685384_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_032127067.1|1685380_1685983_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211349.1|1685979_1687974_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211350.1|1688037_1688976_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211352.1|1689654_1690095_+	universal stress protein	NA	NA	NA	NA	NA
WP_075273313.1|1690268_1690607_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007028.1|1690566_1691022_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	1701322	1770177	3052697	transposase,tRNA	Cedratvirus(14.29%)	58	NA	NA
WP_036779544.1|1701322_1702330_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1702329_1702587_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046972.1|1702846_1703437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300334.1|1704960_1705449_-	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_051307365.1|1705468_1705729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211834.1|1705986_1706301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212185.1|1709674_1710664_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1710997_1711183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046973.1|1711539_1711698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1711864_1713820_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016210749.1|1714118_1714580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210752.1|1714749_1715547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556641.1|1717923_1719186_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_016211454.1|1723140_1723611_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_016211452.1|1724361_1725849_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211455.1|1725910_1727368_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_122942091.1|1727473_1727869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211456.1|1727896_1728475_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_054300330.1|1729096_1730158_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274658.1|1730207_1731413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046974.1|1731564_1731726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300328.1|1731836_1732613_+	class I SAM-dependent methyltransferase	NA	R4ZD91	Adoxophyes_honmai_entomopoxvirus	25.5	8.1e-16
WP_016212459.1|1732750_1733131_-	glycine-zipper containing OmpA-like membrane domain protein	NA	NA	NA	NA	NA
WP_155046975.1|1733250_1733700_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_054300326.1|1734113_1734578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300325.1|1734679_1734952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273534.1|1735145_1736027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|1736389_1737415_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_054300323.1|1737658_1738252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300322.1|1738639_1740574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211725.1|1740612_1741527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|1743097_1743364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007023.1|1743440_1744097_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016212446.1|1744131_1744893_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.1	1.2e-48
WP_016212445.1|1745255_1745522_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1745767_1746223_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1746182_1746521_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556531.1|1746483_1746681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211752.1|1746885_1748031_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211748.1|1748046_1749651_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211749.1|1749730_1750924_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_032126540.1|1751132_1751996_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300321.1|1753170_1753542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300320.1|1753759_1754359_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047087.1|1754336_1754555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|1755005_1756031_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_054300318.1|1756178_1757156_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211465.1|1757783_1758767_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_016211464.1|1758917_1759265_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_032126752.1|1759261_1759864_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211466.1|1759951_1761472_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126753.1|1761541_1762006_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_054300317.1|1762962_1763496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046976.1|1763792_1763930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007073.1|1763995_1764166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777066.1|1764148_1767205_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209619.1|1767291_1768740_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209621.1|1769172_1770177_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 21
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	1798750	1842523	3052697	transposase	Escherichia_phage(33.33%)	40	NA	NA
WP_054300202.1|1798750_1799479_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_081007021.1|1799471_1800038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126786.1|1800336_1803417_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016211319.1|1803434_1804487_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211316.1|1805019_1805670_+	porin family protein	NA	NA	NA	NA	NA
WP_016211315.1|1806004_1806649_+	porin family protein	NA	NA	NA	NA	NA
WP_054300314.1|1806836_1807172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273532.1|1807132_1807720_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126997.1|1807937_1808177_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_032126998.1|1808498_1808846_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_036774554.1|1808944_1809223_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1809275_1809563_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|1809566_1810453_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033923708.1|1812915_1813791_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211346.1|1814322_1814964_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_016211340.1|1814991_1815213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211347.1|1815205_1816189_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211344.1|1816402_1817221_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_054300313.1|1817381_1819064_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	1.6e-32
WP_054300312.1|1819071_1820094_-	YHYH protein	NA	NA	NA	NA	NA
WP_016211341.1|1820292_1820463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1820607_1821582_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016211940.1|1821695_1822028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|1822148_1823408_-	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_054300310.1|1825209_1825734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211210.1|1825836_1827318_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_052104715.1|1827324_1827531_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211211.1|1827579_1828659_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211215.1|1828850_1830821_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_054300309.1|1831181_1832741_+	APC family permease	NA	NA	NA	NA	NA
WP_054300308.1|1833035_1833266_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300307.1|1833295_1834024_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_054300306.1|1834126_1834351_+	DDE endonuclease	NA	NA	NA	NA	NA
WP_016211983.1|1834598_1835258_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556643.1|1835353_1836718_+	histidine kinase	NA	NA	NA	NA	NA
WP_016212551.1|1837175_1837670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211946.1|1839025_1839781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556540.1|1839999_1840395_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211947.1|1840387_1841533_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_033923708.1|1841647_1842523_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	1886927	1905709	3052697	transposase	Staphylococcus_phage(50.0%)	17	NA	NA
WP_032126540.1|1886927_1887791_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300189.1|1887924_1888290_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1888346_1888511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046980.1|1888500_1888800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046981.1|1888789_1888966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300299.1|1889055_1890138_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212058.1|1892339_1893890_-	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_075273524.1|1894045_1895011_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1895051_1896026_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_098082828.1|1896390_1896648_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|1896647_1897655_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212247.1|1898021_1898777_+	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|1899404_1900379_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300162.1|1900718_1901801_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212246.1|1901904_1902561_-	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300297.1|1903496_1904564_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|1904626_1905709_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
>prophage 23
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	1950220	1960568	3052697	transposase	Acinetobacter_phage(50.0%)	15	NA	NA
WP_054300294.1|1950220_1951282_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300293.1|1951553_1951919_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1951975_1952140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007016.1|1952129_1952303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007069.1|1952275_1952428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300292.1|1952883_1953885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779544.1|1954139_1955147_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1955146_1955404_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007015.1|1955615_1956041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1956533_1957686_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_054300288.1|1957695_1958385_-	hypothetical protein	NA	A0A0N7AE80	Bacillus_phage	28.2	3.2e-08
WP_054300287.1|1958793_1959123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1959144_1959510_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1959455_1960031_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300285.1|1960031_1960568_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	2026603	2081518	3052697	transposase,protease,tRNA	Orpheovirus(16.67%)	56	NA	NA
WP_016209434.1|2026603_2028025_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_129556553.1|2028114_2029707_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_016209439.1|2029870_2030497_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_054300277.1|2030577_2033259_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_016209445.1|2033741_2034698_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_016209435.1|2034798_2035170_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.1e-05
WP_016209404.1|2035196_2036060_+	chemotaxis phosphatase CheX family protein	NA	NA	NA	NA	NA
WP_016209416.1|2036049_2036835_-	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_016209413.1|2037123_2037609_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_016209443.1|2037683_2038205_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016209405.1|2038250_2039144_-	cheW-like domain protein	NA	NA	NA	NA	NA
WP_016209406.1|2039140_2039962_-	ParA family protein	NA	Q8JL10	Natrialba_phage	32.2	5.0e-16
WP_016209408.1|2040276_2040447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209427.1|2040600_2042004_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_052047073.1|2042097_2043348_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080664816.1|2043334_2044066_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_016209424.1|2044077_2045355_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
WP_016209433.1|2045454_2045829_-	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209412.1|2045913_2046801_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209436.1|2046858_2047587_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_129556555.1|2047583_2048714_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209444.1|2048844_2049273_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_032126508.1|2049367_2049727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209447.1|2049716_2050928_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016209421.1|2050924_2051713_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_016209411.1|2051875_2052670_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_054300276.1|2052875_2053850_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_155049809.1|2054024_2055320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2055323_2055623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2055612_2055777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2055833_2056199_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211553.1|2056538_2057279_-	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_016211549.1|2057282_2059787_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211548.1|2060049_2061006_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211550.1|2060989_2061751_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_054300275.1|2061828_2062704_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2062828_2063074_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_016211262.1|2063133_2065407_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_075273504.1|2065461_2065815_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211261.1|2066004_2066298_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_032126515.1|2066470_2066650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307354.1|2066725_2067301_-	DedA family protein	NA	NA	NA	NA	NA
WP_032126514.1|2067583_2068900_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2068910_2069279_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_016211265.1|2069309_2069972_-	adenylate kinase	NA	NA	NA	NA	NA
WP_054300274.1|2070146_2070512_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2070457_2071033_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126519.1|2071200_2071920_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_016211478.1|2071899_2072715_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126518.1|2072731_2074933_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211474.1|2075015_2076365_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_016211473.1|2076439_2077039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211476.1|2077022_2077232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777061.1|2077549_2078737_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211932.1|2078932_2080222_+	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_129556478.1|2080632_2081518_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	2094054	2135868	3052697	transposase,tRNA	Moraxella_phage(16.67%)	39	NA	NA
WP_054300173.1|2094054_2095116_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776407.1|2095364_2096501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211446.1|2096684_2098412_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_016211448.1|2098401_2099610_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211450.1|2099708_2100731_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_155047009.1|2101506_2101680_+	phosphatase	NA	NA	NA	NA	NA
WP_052104774.1|2101824_2102457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2102504_2103566_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126170.1|2103729_2104002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211040.1|2104229_2105441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211037.1|2105791_2106421_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211042.1|2106469_2107486_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211035.1|2107732_2107948_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211043.1|2108000_2108450_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211039.1|2108529_2110275_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211036.1|2110366_2112238_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_054300271.1|2112585_2113560_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273494.1|2113579_2114140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211091.1|2115204_2117685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2117759_2118665_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016210899.1|2119164_2121048_-	APC family permease	NA	NA	NA	NA	NA
WP_016210896.1|2121101_2122184_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210904.1|2122226_2122877_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210903.1|2123097_2123469_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_129556487.1|2123587_2124925_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_054300270.1|2125003_2125981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210894.1|2126321_2126624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210902.1|2127134_2127389_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210898.1|2127477_2127828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300269.1|2128739_2129108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2129129_2129495_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2129551_2129716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007012.1|2129705_2129876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|2129870_2130932_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273492.1|2131040_2131160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556486.1|2131250_2131598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556630.1|2131683_2133033_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211781.1|2133342_2134590_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_054300173.1|2134806_2135868_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	2156726	2284291	3052697	transposase,integrase,protease,tRNA	Staphylococcus_phage(12.5%)	117	2184919:2184978	2214147:2214736
WP_075273313.1|2156726_2157065_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300265.1|2157024_2157285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300264.1|2157429_2157768_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_054300263.1|2157755_2158196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2158267_2159242_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212461.1|2159617_2159992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2159995_2160571_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2160516_2160882_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051307332.1|2161090_2161297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300262.1|2161344_2161635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104721.1|2161626_2163333_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.7	7.3e-25
WP_051307331.1|2163404_2165183_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_016210552.1|2165537_2166104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210553.1|2166228_2166882_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_054300261.1|2166908_2168351_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210545.1|2168447_2169425_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_129556482.1|2169573_2170179_+	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_026063577.1|2170250_2170544_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556629.1|2170770_2171517_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_017376905.1|2171747_2171975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|2172039_2172222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|2172658_2173213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046716.1|2173910_2174057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046984.1|2174478_2175597_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052047108.1|2176408_2176807_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273488.1|2176862_2177498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2177582_2177948_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2177893_2178469_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211578.1|2178538_2178883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|2178898_2179093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|2179159_2179513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300258.1|2179610_2180390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211585.1|2180451_2181009_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_075273486.1|2181243_2182218_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.2e-29
WP_054300257.1|2182194_2183004_-	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.6	1.8e-29
WP_016211583.1|2183280_2184189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211579.1|2184256_2184742_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
2184919:2184978	attL	TGTAAAACTCCAGATATGATCTGACAAGCTTAAATCATCTGACAACATTTGTCTGATTGA	NA	NA	NA	NA
WP_054300162.1|2184952_2186035_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036781361.1|2186305_2186695_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_054300237.1|2186714_2187776_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046986.1|2187964_2188851_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212302.1|2189035_2189335_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_081007067.1|2189555_2195030_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_036780532.1|2195541_2196582_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_054300162.1|2196684_2197767_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036781387.1|2197859_2198132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|2198124_2198403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126152.1|2198605_2199196_+|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016211531.1|2199259_2199940_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_054300254.1|2200293_2201190_+	Abi family protein	NA	A3QSC6	Clostridium_virus	31.6	6.9e-35
WP_016211534.1|2201195_2201705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300253.1|2201691_2202642_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	34.7	6.9e-09
WP_016211528.1|2204496_2204802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664862.1|2204782_2205481_-	P-loop NTPase	NA	NA	NA	NA	NA
WP_032126157.1|2206344_2206749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|2207035_2208928_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_036780074.1|2209270_2210077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307360.1|2211168_2212098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2212186_2213092_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046987.1|2214182_2214866_-|transposase	transposase	transposase	NA	NA	NA	NA
2214147:2214736	attR	TCAATCAGACAAATGTTGTCAGATGATTTAAGCTTGTCAGATCATATCTGGAGTTTTACACCTAAGCTCTTCAAAAGCTATTTGATTTGACCGCACAAGTAATTTATATTTGAGTGCAAAGTGGTTAAGTTGTGCTTTTACACTCAATGTTTCTAGTTTACAAAATGCCACGATTGATGCAAAAATATGATTGCATTGTGACCGAACAGTTTTAGTCGGTGATTTTGCTAAACTTGCATTTTGTTTAATCGACTTATGATATTCTTCAATTTTCCATCGTTTTTGATAGATTTTGTAAAGCCCATCACCATCCGTCTCTAAATCATTTGTTATTAAATAGAGGTGACCTGTTGACCCGTCTTCGTTTGTGAAGATCTTTTTCATTAATCGCACTGGGAAATTAATTCCCTGAAGATATACATCTATGGCCTCACTATCTTTTAAATCAAGAGATTTGACTGGCTGGTAATTTCTATTGATTTTATCATCTAAACTGCAAGCAACTGTTCGATTAGATTTTATTCCTAAAATAAACAACTTATTTAACTTGGCATGAATATAATTCATGTTTTCTTTTGAACTGAACCAGT	NA	NA	NA	NA
WP_155046988.1|2214881_2215250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372266.1|2215582_2216068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300251.1|2216157_2217672_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_016209659.1|2217798_2218827_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_016209654.1|2218891_2220034_+	galactokinase	NA	NA	NA	NA	NA
WP_016209656.1|2220152_2221856_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209642.1|2221852_2223973_+	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209652.1|2223969_2225319_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209662.1|2225290_2227438_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209657.1|2227865_2228261_+	CrcB family protein	NA	NA	NA	NA	NA
WP_016209643.1|2228269_2229154_-	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_075273480.1|2229185_2231084_-	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_016209655.1|2231166_2231439_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_032126161.1|2231542_2233975_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209663.1|2234042_2235344_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_016209647.1|2235425_2236031_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209645.1|2236143_2237448_-	trigger factor	NA	NA	NA	NA	NA
WP_016209661.1|2238051_2238927_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_075273478.1|2239042_2239714_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209658.1|2239890_2241246_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_016209641.1|2241366_2242104_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032126159.1|2242183_2242897_-	aldolase	NA	NA	NA	NA	NA
WP_016209651.1|2243542_2244817_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2244847_2245423_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209649.1|2245467_2246433_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209640.1|2246891_2247911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300250.1|2248329_2248989_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_129556449.1|2248978_2249485_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|2249499_2249865_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046989.1|2250355_2251420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300248.1|2251652_2252627_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	3.1e-28
WP_155046989.1|2252719_2253784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|2254016_2254991_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_129556476.1|2255288_2256299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211684.1|2256843_2257419_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016211685.1|2257442_2259248_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211687.1|2259278_2259923_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_054300245.1|2260178_2261054_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556628.1|2261258_2262074_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.5e-32
WP_016210297.1|2262159_2263539_-	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_032126463.1|2263595_2264852_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_032126458.1|2264932_2266459_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_054300244.1|2266464_2267463_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_016210290.1|2267703_2268498_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210287.1|2268586_2269450_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_036777321.1|2269570_2270851_-	membrane protein	NA	NA	NA	NA	NA
WP_032126457.1|2271895_2272315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126460.1|2273222_2273660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210301.1|2273836_2274664_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_075273633.1|2274713_2275340_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_016210294.1|2275477_2275822_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_051307327.1|2276139_2277171_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.7e-35
WP_016210303.1|2277446_2277686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2277735_2278797_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210741.1|2279482_2279806_+	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_016210746.1|2279812_2283709_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_054300242.1|2283754_2284291_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 27
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	2291100	2362261	3052697	transposase,tRNA	Staphylococcus_phage(42.86%)	57	NA	NA
WP_054300271.1|2291100_2292075_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212172.1|2292094_2293567_-	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_054300271.1|2293869_2294844_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300240.1|2295143_2295347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273460.1|2295603_2296488_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036777316.1|2296797_2297211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211818.1|2297567_2298824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|2299026_2299527_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_054300238.1|2299823_2300102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273458.1|2300374_2300590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|2300642_2301704_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2301730_2302306_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2302251_2302617_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300559.1|2303332_2303881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|2304761_2305217_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273456.1|2305176_2305476_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300276.1|2305598_2306573_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_016209398.1|2307155_2308382_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|2308980_2310687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007011.1|2310854_2312075_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209395.1|2312323_2315014_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_016209384.1|2315305_2316121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300234.1|2316471_2317413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300233.1|2317954_2319598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209368.1|2320173_2321703_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_054300232.1|2321738_2323190_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209366.1|2323164_2324124_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_016209365.1|2324201_2327708_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.5	4.9e-193
WP_032126583.1|2327731_2328301_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	42.9	5.7e-27
WP_054300231.1|2328513_2329668_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_016209377.1|2329686_2330460_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_016209390.1|2330459_2330897_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_016209391.1|2330923_2331973_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_016209381.1|2332024_2332558_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_129556472.1|2332638_2335032_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_051307309.1|2335370_2336411_+	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_016209394.1|2338613_2339678_+	GHMP kinase	NA	NA	NA	NA	NA
WP_016209364.1|2339667_2340696_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_016209393.1|2340692_2341232_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_016209400.1|2341776_2343738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300230.1|2344175_2345807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209397.1|2345927_2346803_-	bacterial lipid A biosynthesis acyltransferase family protein	NA	NA	NA	NA	NA
WP_016209379.1|2346890_2347697_-	cytidylyltransferase	NA	NA	NA	NA	NA
WP_032126580.1|2347704_2348442_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.5	7.2e-22
WP_016209396.1|2348458_2349016_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_016209399.1|2349019_2349757_-	UMP kinase	NA	NA	NA	NA	NA
WP_016209372.1|2349760_2350639_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_032126579.1|2350813_2351581_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_016209375.1|2352003_2352813_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_054300229.1|2352890_2355548_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_016209389.1|2355548_2356586_+	asparaginase	NA	NA	NA	NA	NA
WP_016209373.1|2356587_2357409_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_016209387.1|2357538_2358423_+	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2358560_2359136_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2359081_2359447_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300228.1|2360352_2361606_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_155046990.1|2361583_2362261_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	2367125	2413636	3052697	transposase,protease,tRNA	Prochlorococcus_phage(33.33%)	48	NA	NA
WP_016210607.1|2367125_2368385_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210598.1|2368553_2369213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556471.1|2369354_2370026_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210609.1|2370385_2371321_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_016210606.1|2371417_2372044_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_054300226.1|2372049_2372631_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210601.1|2372702_2373794_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210599.1|2373876_2374590_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_122940948.1|2374683_2375388_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300148.1|2375710_2376772_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126800.1|2376896_2377631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046954.1|2377857_2378031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300225.1|2378137_2378557_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|2379519_2379765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|2380064_2380950_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300223.1|2381187_2382159_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	1.3e-34
WP_016209900.1|2382350_2383820_-	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_016209924.1|2383813_2385190_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209906.1|2385201_2385594_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209919.1|2385590_2386694_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_032126654.1|2386872_2388174_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209907.1|2388181_2389129_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_016209913.1|2389140_2389959_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_032126655.1|2389961_2390762_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209910.1|2390755_2391814_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_016209903.1|2391810_2392821_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209904.1|2392827_2393025_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_054300222.1|2393085_2395992_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209918.1|2396033_2396888_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_032126652.1|2396920_2397487_-	chorismate lyase	NA	NA	NA	NA	NA
WP_016209915.1|2397569_2398430_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016209922.1|2398521_2398938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300221.1|2398997_2399495_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_054300220.1|2399540_2402495_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_016209901.1|2402524_2402857_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_016209923.1|2402974_2403493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209908.1|2403967_2404678_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209899.1|2404674_2405709_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_032126651.1|2405812_2405998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2406118_2406484_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2406429_2407005_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212369.1|2407008_2407455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212599.1|2408689_2408899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2408948_2410010_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|2410056_2410962_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2411754_2412093_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2412052_2412508_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2412661_2413636_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 29
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	2482469	2524911	3052697	transposase,tRNA	Synechococcus_phage(50.0%)	47	NA	NA
WP_081007066.1|2482469_2482808_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300215.1|2482802_2483297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|2484100_2484391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007010.1|2484440_2485061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210530.1|2485901_2486582_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_016210535.1|2486578_2487391_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_054300212.1|2487464_2491145_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_036776217.1|2491154_2492642_-	ribonuclease G	NA	NA	NA	NA	NA
WP_054300211.1|2492651_2493269_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016210528.1|2493338_2493857_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210536.1|2493853_2494753_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2494768_2495812_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210537.1|2496001_2496289_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210532.1|2496400_2497852_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_032126195.1|2497893_2499330_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_155046713.1|2499624_2499789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300210.1|2499926_2500115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007009.1|2500071_2500242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2500231_2500396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2500452_2500818_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212074.1|2500844_2501066_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_142396463.1|2501152_2501269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126198.1|2501379_2501580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212075.1|2501825_2502023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779278.1|2502136_2503090_+	DMT family transporter	NA	NA	NA	NA	NA
WP_054300148.1|2503209_2504271_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300208.1|2504248_2505040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|2505169_2505481_+	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_155046991.1|2505828_2506152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779281.1|2506176_2506632_-	arginine repressor	NA	NA	NA	NA	NA
WP_016211489.1|2506621_2507674_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_016211493.1|2507676_2509140_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211491.1|2509422_2509719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2509979_2511041_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210915.1|2511170_2511635_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_032126715.1|2511832_2512648_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210906.1|2512776_2515089_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_051307343.1|2515208_2515736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210909.1|2516428_2517706_+	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_016210914.1|2517711_2517963_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.8e-20
WP_016210913.1|2517996_2518518_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_032126716.1|2518688_2519672_-	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210908.1|2519762_2520578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2521789_2522851_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212580.1|2523586_2523937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2524024_2524390_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273438.1|2524335_2524911_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	2529407	2576960	3052697	transposase,integrase	Escherichia_phage(47.06%)	53	2539288:2539347	2552023:2552283
WP_054300202.1|2529407_2530136_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211244.1|2530537_2531233_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_016211242.1|2531186_2532155_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_129556456.1|2532198_2532948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211238.1|2533149_2534643_-	amino acid permease	NA	NA	NA	NA	NA
WP_129556626.1|2535085_2536474_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211235.1|2536903_2537341_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_054300202.1|2537835_2538564_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300206.1|2538849_2539086_+	hypothetical protein	NA	NA	NA	NA	NA
2539288:2539347	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_155046992.1|2539552_2540092_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	30.5	8.7e-09
WP_032126362.1|2540052_2540418_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2540363_2540939_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300203.1|2541421_2541880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556455.1|2541884_2542487_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211642.1|2542787_2543141_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_016211646.1|2543133_2543373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211918.1|2543744_2544713_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_051307368.1|2544712_2545993_-	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_054300202.1|2546699_2547428_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_075273432.1|2547738_2548473_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_016212023.1|2548469_2549462_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_054300201.1|2549857_2550586_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_054300200.1|2550887_2551466_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	3.9e-47
WP_155046993.1|2551458_2551821_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	37.6	1.3e-13
WP_016212024.1|2551965_2552214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780881.1|2552210_2552810_-	AAA family ATPase	NA	NA	NA	NA	NA
2552023:2552283	attR	TGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGAGCTTGGTCACGTATTGGATAACGTCCTTTTTTGGAGCCTTCTAACAGTTGTTGAATTTCAGGAGTAGTTAGAAAATCCCGATCTCGCTCATGACCATCACATGCCAGAGAATGTTCTACTTCAACACTCATCGCTGCAAACCTTTTTTCAGCTCAAACCCTAAGTTAACTCCTTTTAGCCATTGAGGGAGTGATTTACTC	NA	NA	NA	NA
WP_016212022.1|2552809_2553028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126737.1|2553257_2553986_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300198.1|2554397_2554727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|2554877_2555606_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016210935.1|2555992_2556535_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|2556531_2557218_-	acireductone synthase	NA	NA	NA	NA	NA
WP_036778484.1|2557221_2557833_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|2557879_2558899_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|2559000_2559795_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|2559816_2560623_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|2560701_2561751_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|2561948_2563208_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|2563254_2563932_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2564017_2564299_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_155046994.1|2564390_2565545_-	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.6	2.1e-20
WP_016210820.1|2565814_2566756_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|2567259_2567484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|2567775_2568480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300196.1|2568894_2569533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|2569867_2570398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300195.1|2570394_2571927_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2571923_2572874_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2573294_2573927_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2574169_2574367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2574716_2575145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155074366.1|2575183_2575921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2575898_2576960_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	2580172	2632382	3052697	transposase,tRNA	Staphylococcus_phage(22.22%)	52	NA	NA
WP_081007004.1|2580172_2580628_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2580587_2580926_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036778253.1|2580983_2582522_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_098082804.1|2582633_2583732_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_016210987.1|2583969_2585169_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_016210981.1|2585198_2585837_+	ribonuclease T	NA	NA	NA	NA	NA
WP_016210983.1|2585852_2588036_-	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	1.1e-06
WP_032126304.1|2588273_2588618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300193.1|2589663_2589870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104666.1|2590034_2590493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212032.1|2591080_2592208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|2592331_2592994_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|2593085_2593331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211963.1|2594404_2595064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|2595165_2595816_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211964.1|2595928_2596249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2596307_2597282_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126299.1|2597532_2597754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300192.1|2597776_2597998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300191.1|2598042_2598999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300190.1|2599493_2600456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046995.1|2600582_2601468_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210162.1|2602153_2603191_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_032126295.1|2603221_2604676_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_016210181.1|2604685_2605870_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_016210176.1|2605943_2606951_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210183.1|2607019_2609023_-	transketolase	NA	NA	NA	NA	NA
WP_016210174.1|2609473_2610634_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	8.2e-121
WP_036776947.1|2610870_2611986_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210172.1|2612148_2612673_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	59.6	6.9e-51
WP_016210163.1|2612672_2613203_+	ferric uptake regulator family protein	NA	NA	NA	NA	NA
WP_016210178.1|2613292_2613760_-	DoxX family protein	NA	NA	NA	NA	NA
WP_016210161.1|2614261_2614516_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210179.1|2614716_2615220_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_129556592.1|2615510_2616041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2616201_2616885_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210164.1|2616960_2617740_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_032126297.1|2617726_2618587_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_016210177.1|2618711_2619077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210175.1|2619462_2619792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300188.1|2620105_2621665_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	50.4	9.9e-37
WP_054300148.1|2621910_2622972_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211784.1|2623525_2624248_+	aquaporin family protein	NA	M1HH19	Acanthocystis_turfacea_Chlorella_virus	35.8	1.6e-26
WP_016211783.1|2624239_2624605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126294.1|2624885_2626163_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211782.1|2626762_2626945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2627006_2627372_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273426.1|2627317_2627893_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047233.1|2627889_2628531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210766.1|2628619_2629063_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_032126291.1|2629066_2629576_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_016210756.1|2629568_2632382_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A167RAL2	Powai_lake_megavirus	26.5	1.3e-76
>prophage 32
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	2662448	2698777	3052697	transposase,protease,tRNA	Stx2-converting_phage(20.0%)	37	NA	NA
WP_054300173.1|2662448_2663510_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2663600_2664347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300186.1|2664615_2665335_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|2665578_2665941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273422.1|2666127_2666655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556595.1|2666799_2667216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|2669298_2670210_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|2670261_2671110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|2671554_2672265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556596.1|2672356_2673325_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|2673312_2673960_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_036779767.1|2673988_2674840_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|2674854_2676132_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|2676172_2676688_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_054300183.1|2676766_2677828_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|2677849_2678938_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_036777788.1|2678982_2680818_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2680860_2681331_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2681367_2681703_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080664840.1|2681715_2682432_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|2682368_2683385_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|2683381_2683861_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|2683944_2686425_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2686487_2686853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273418.1|2687191_2687530_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2687489_2687945_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2687959_2688250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777784.1|2688315_2689914_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2690044_2690380_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_036777781.1|2690407_2692072_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	5.4e-33
WP_016210581.1|2692068_2692713_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|2692712_2693456_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2693514_2693754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2693904_2695272_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|2695282_2695834_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126278.1|2695914_2696898_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|2697019_2698777_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 33
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	2849013	2914585	3052697	transposase	Erwinia_phage(18.18%)	55	NA	NA
WP_054300168.1|2849013_2849877_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2850173_2851226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211698.1|2851493_2851922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2852135_2852627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2852682_2853933_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2854035_2854254_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_036777591.1|2854711_2855566_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_016210728.1|2855620_2856091_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2856415_2857795_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2857822_2858281_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2858258_2859476_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2859667_2859904_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2859917_2860073_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2860153_2861116_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2861275_2862592_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2862601_2863270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2863632_2865447_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_054300166.1|2865564_2866353_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211543.1|2866933_2868685_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016211544.1|2868695_2869496_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.6	5.8e-33
WP_016211545.1|2869598_2870087_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.7	2.4e-29
WP_017375799.1|2871595_2871940_+	DMT family protein	NA	NA	NA	NA	NA
WP_016210038.1|2877633_2878596_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.0	8.8e-20
WP_016210039.1|2878782_2880042_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|2880265_2880592_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_052104566.1|2880786_2881737_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_032126434.1|2881794_2883861_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_016210049.1|2883866_2884862_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_016210042.1|2885447_2887028_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|2887184_2888594_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_016210047.1|2888653_2889787_-	cation transporter	NA	NA	NA	NA	NA
WP_016210033.1|2889926_2890751_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_016210034.1|2890978_2891608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|2891944_2892316_-	isochorismatase	NA	NA	NA	NA	NA
WP_016210046.1|2892619_2892907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126431.1|2893058_2893907_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_016210037.1|2894034_2895075_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_129556667.1|2895147_2896725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300165.1|2897368_2898028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2898182_2899157_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|2899232_2900252_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047000.1|2900299_2900446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047001.1|2900650_2900836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2901734_2902817_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300161.1|2902864_2903926_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211201.1|2904006_2904315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211206.1|2904429_2905746_-	MFS transporter	NA	NA	NA	NA	NA
WP_081007001.1|2906207_2907494_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211205.1|2907566_2908463_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211203.1|2908549_2909548_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032126430.1|2909656_2910181_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_129556668.1|2910428_2911667_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_016212222.1|2912214_2912688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|2912684_2913080_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2914009_2914585_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP039186	Piscirickettsia salmonis strain Psal-159 chromosome, complete genome	3052697	2924713	3025585	3052697	transposase,tRNA	Staphylococcus_phage(35.71%)	103	NA	NA
WP_081007000.1|2924713_2925802_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300157.1|2926025_2927306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2928138_2928504_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2928449_2929025_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2929307_2929673_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047002.1|2929687_2930293_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036776867.1|2930663_2932061_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.8e-77
WP_051307313.1|2932180_2933128_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|2933124_2933640_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|2933626_2934826_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|2934822_2935146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|2935147_2936377_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|2936376_2937420_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|2937419_2938103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|2938099_2940589_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|2940605_2940860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|2940860_2941217_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|2941996_2943160_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|2943179_2946287_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|2946288_2947794_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|2947821_2948103_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|2948251_2948593_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|2948712_2950593_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_075274705.1|2950677_2952276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|2952293_2953409_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|2953536_2954535_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209700.1|2954538_2955297_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|2955298_2956498_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|2956481_2957153_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|2957174_2957951_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|2957954_2958953_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|2958954_2959533_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|2959529_2960999_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|2961042_2961330_-	trp operon repressor	NA	NA	NA	NA	NA
WP_054300271.1|2961461_2962436_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209699.1|2962636_2963233_+	DMT family transporter	NA	NA	NA	NA	NA
WP_054300152.1|2963259_2963625_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|2963681_2963837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273401.1|2963981_2964434_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300151.1|2964471_2964804_+	DMT family transporter	NA	NA	NA	NA	NA
WP_155047003.1|2966292_2967178_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|2967364_2967586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212371.1|2967701_2968334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2968311_2969373_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776841.1|2969812_2970352_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|2970436_2970973_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|2971624_2971927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|2972376_2972685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556607.1|2973005_2973455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|2973737_2974448_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|2974674_2975073_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_016211231.1|2975940_2976891_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|2976890_2978969_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|2979116_2979632_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|2979640_2980204_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|2980184_2980931_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|2981070_2981523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|2981658_2982495_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|2982491_2983388_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|2983420_2984488_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|2984506_2984875_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|2984900_2986349_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|2986358_2987738_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|2987778_2989110_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|2989081_2990041_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|2990133_2990637_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|2990771_2991923_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|2991919_2992399_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|2992545_2994867_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|2994811_2995438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|2995442_2996342_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|2996414_2996993_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|2997293_2997551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081006999.1|2997559_2997931_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.2	3.4e-20
WP_081006998.1|2998135_2998591_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	1.3e-21
WP_032126637.1|2998707_2999001_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_155046758.1|2999849_2999981_+	phosphatase	NA	NA	NA	NA	NA
WP_016212051.1|3000608_3001382_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126148.1|3001923_3002106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3002709_3003684_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3004778_3005117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007065.1|3005133_3005973_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_155047004.1|3006185_3006692_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300144.1|3006706_3007072_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3008376_3009072_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3009068_3010496_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3010521_3010785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3010857_3011832_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047005.1|3011890_3012741_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|3012939_3013914_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007064.1|3013953_3014229_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3014225_3015062_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3015062_3015404_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3015405_3016011_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3016007_3018002_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3018021_3018963_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_052104719.1|3019190_3020615_+	MFS transporter	NA	NA	NA	NA	NA
WP_155047006.1|3021021_3021162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3021415_3022390_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3022448_3023105_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_032126480.1|3023151_3023835_-	methyltransferase	NA	NA	NA	NA	NA
WP_080664873.1|3024380_3024695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556613.1|3024589_3025585_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039187	Piscirickettsia salmonis strain Psal-159 plasmid unnamed1, complete sequence	158207	2231	115203	158207	integrase,protease,head,transposase,tail,capsid	Streptococcus_phage(25.0%)	118	49319:49378	119962:120600
WP_054300202.1|2231_2960_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|3163_5740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047021.1|6034_6190_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300202.1|6213_6942_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075273830.1|6971_7304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047014.1|7374_7716_-	hypothetical protein	NA	A0A1B1IQX9	uncultured_Mediterranean_phage	60.3	1.7e-21
WP_054300202.1|7871_8600_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075273834.1|8806_9373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273836.1|9715_10777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|10806_11889_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300202.1|12008_12737_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046765.1|13623_13818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047015.1|14198_14522_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212122.1|15398_16100_+	ParA family protein	NA	J9Q7R7	Salmonella_phage	31.8	1.1e-19
WP_016212121.1|16053_16977_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_105962625.1|17410_18296_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.7	4.5e-10
WP_054300271.1|18940_19915_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016212151.1|20005_20968_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|20991_21306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|21369_22344_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_033923686.1|22468_23518_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|23626_24667_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|24680_25310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|25400_25700_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211886.1|25696_26125_-	nucleotidyltransferase substrate-binding, HI0074 family protein	NA	NA	NA	NA	NA
WP_052104769.1|27122_28046_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_129556707.1|28360_29380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|29761_30915_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_054300202.1|30981_31710_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212014.1|31807_32221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047016.1|32624_32852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927838.1|32881_33127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|33123_33423_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_016212019.1|33579_34275_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_081377351.1|35088_35868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|35951_36104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126739.1|36056_36389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|36553_36931_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_016212152.1|37237_37621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273842.1|38090_38819_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	5.4e-38
WP_036781349.1|38934_39261_-	potassium ABC transporter ATPase	NA	A9D9Y1	Lactobacillus_prophage	36.6	1.1e-11
WP_016212365.1|39262_39505_-	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_155047017.1|40858_41038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273844.1|41516_43151_+	protein kinase	NA	NA	NA	NA	NA
WP_129556709.1|43362_43452_+	DUF1891 domain-containing protein	NA	NA	NA	NA	NA
WP_129556710.1|43532_44003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273857.1|44156_44891_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	8.4e-39
WP_016212404.1|45667_45901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273881.1|46021_48208_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.2	9.2e-73
WP_036779532.1|48217_48619_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_016212456.1|48615_48903_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_054300271.1|48946_49921_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
49319:49378	attL	AGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAA	NA	NA	NA	NA
WP_016212579.1|50520_50718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|52223_52424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212061.1|53193_55236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|56428_56794_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274751.1|56739_57315_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.1e-08
WP_075274752.1|57311_57611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047018.1|57646_58450_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.9e-55
WP_129556718.1|58483_59669_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_075273741.1|59878_60613_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046767.1|60943_61105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047048.1|61104_61605_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273747.1|61866_62457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273741.1|62586_63321_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075273749.1|63542_64268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047019.1|64757_64910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273751.1|64922_66653_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300477.1|66812_67541_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	7.1e-38
WP_155047020.1|67697_68621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273755.1|68861_69518_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.2	2.9e-30
WP_016211955.1|69654_70635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211956.1|71091_71820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211953.1|71877_72357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377344.1|73479_74607_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273757.1|74846_75296_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273760.1|75639_78042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210338.1|78144_78282_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273592.1|78380_79355_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_081377345.1|79351_79876_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.5	1.4e-27
WP_032126637.1|79992_80286_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_075273762.1|80351_81623_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.3	1.1e-22
WP_052047108.1|81678_82077_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273764.1|82132_82501_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_016210655.1|82514_83111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273766.1|83561_84623_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273768.1|84626_84896_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	31.3	2.2e-05
WP_016210667.1|84892_85216_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210658.1|85208_85604_+	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210651.1|85600_85951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210664.1|85950_86373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210669.1|86374_86698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|87051_88077_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273770.1|88196_88481_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075273774.1|90682_91840_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_087910645.1|92002_93156_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_032126362.1|93228_93594_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273438.1|93539_94115_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.0	1.3e-07
WP_032126790.1|94585_95491_+|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
WP_129556697.1|95875_96268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211776.1|96750_98088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|98395_99421_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016211775.1|99715_100084_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_016211773.1|100185_100860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126360.1|101446_102181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211895.1|102303_103362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|103870_104617_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211897.1|104617_105022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377346.1|105415_106132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047010.1|106276_106519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|107051_108077_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_052104629.1|108898_109924_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212298.1|110203_110530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307374.1|110770_111247_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_155047011.1|111361_112514_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	9.8e-58
WP_075273780.1|112523_113231_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_052104629.1|113369_114395_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273782.1|114774_115203_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	34.0	3.0e-12
119962:120600	attR	AGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
