The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	45582	80415	3126070	transposase	Acinetobacter_phage(28.57%)	35	NA	NA
WP_129556427.1|45582_46158_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46103_46469_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211193.1|46667_47429_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_036779326.1|47730_49257_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49628_50468_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50507_51815_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51789_52959_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|53013_53739_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54017_54407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54566_55472_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55547_55691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274979.1|55738_56578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375632.1|56570_56906_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_155084796.1|57158_57761_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.3	2.7e-27
WP_017377700.1|57718_58012_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_016210704.1|58906_60853_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|61507_64570_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|64566_65631_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|65986_66940_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|66971_68135_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|68140_68740_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|68927_69428_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|69445_70534_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|70960_72205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|72201_73044_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_016211096.1|73023_73833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|74011_74239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|74239_75190_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|75245_75797_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|75923_76346_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|76338_77085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|77127_77826_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|77836_78661_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|78990_79359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274980.1|79353_80415_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	137133	178990	3126070	transposase	Staphylococcus_phage(60.0%)	45	NA	NA
WP_054300271.1|137133_138108_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|138609_140022_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|140514_141522_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_155084800.1|141541_143062_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	1.2e-31
WP_016211018.1|144012_145329_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|145432_145816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|145950_149016_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|149084_150188_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|150211_150766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|150880_151450_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211020.1|151569_152325_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_155084801.1|152530_153553_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_098082829.1|153947_154343_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|154364_154730_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|154786_154951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|154940_155240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300544.1|155330_155777_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|155865_156441_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|156386_156752_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|157231_157798_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|157809_158595_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|159226_160150_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|160201_161197_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|161228_161723_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_032126724.1|161814_162072_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|162161_162584_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|162902_163619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|163662_163914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556431.1|163927_165355_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|165382_166825_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|166912_167251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|167335_167866_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|167926_170119_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|170161_170647_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|170916_171348_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_016210245.1|171365_172196_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|172210_172354_-	lipoprotein	NA	NA	NA	NA	NA
WP_016210239.1|172384_173269_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|173240_173462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|173635_173914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|174209_175184_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300542.1|175701_175938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|175963_176869_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016212383.1|177299_178418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|178414_178990_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	197517	258116	3126070	tRNA,tail,transposase,protease	Ostreococcus_lucimarinus_virus(14.29%)	51	NA	NA
WP_075274986.1|197517_198585_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209863.1|198637_199060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209853.1|199300_199744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209873.1|199798_200056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209868.1|200033_200660_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_016209871.1|200737_202720_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|202929_204273_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|204539_207209_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|207232_209152_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|209321_210743_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|210888_211863_+	phospholipase A	NA	NA	NA	NA	NA
WP_016209855.1|211894_212290_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209859.1|212292_212514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|212677_214339_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|214411_214702_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_016209861.1|214927_215383_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|215447_215912_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|216004_217351_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|217350_218256_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|218317_219304_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|219296_219539_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|219660_221205_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_032126611.1|221251_222538_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|222580_223975_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_075273327.1|224174_224750_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|224695_225061_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210079.1|228066_228564_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|228734_229430_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|229532_231095_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|231410_233204_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|233289_233562_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|233567_234194_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|234180_235611_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|235943_236999_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|236967_237645_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|237634_238471_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|238630_238924_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_122940784.1|239030_239837_-	trfA family protein	NA	NA	NA	NA	NA
WP_016210083.1|240141_240996_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_016210082.1|241150_242200_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_155084803.1|242215_242905_-	DedA family protein	NA	NA	NA	NA	NA
WP_016210097.1|242922_244203_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_016210096.1|244476_245838_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_032126863.1|245949_246501_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_016211802.1|251933_253205_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_016211801.1|253261_254245_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_016211800.1|254241_255027_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_032126362.1|255723_256089_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274991.1|256034_256610_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377888.1|256613_257174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556436.1|257229_258116_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	265268	301651	3126070	tRNA,transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(25.0%)	36	NA	NA
WP_054300173.1|265268_266330_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046702.1|266455_266611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|266984_268067_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_155084804.1|269857_271010_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556437.1|271052_271475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155084805.1|271744_273859_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_032126861.1|274062_274377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|274711_275598_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210630.1|276739_277855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664846.1|277793_278480_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_032126366.1|278473_279451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210638.1|279489_280653_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210640.1|281117_281342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|281727_282015_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_016210633.1|282189_282945_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556439.1|282950_283406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210637.1|283381_283858_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210636.1|283864_285442_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_032126367.1|285445_286210_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016210629.1|286263_286800_+	tim44-like domain protein	NA	NA	NA	NA	NA
WP_016210634.1|286796_287528_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_155084806.1|287636_289025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664872.1|289282_290263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211898.1|290504_291128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211899.1|291455_291749_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_105962625.1|291845_292732_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274996.1|293140_294241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126374.1|294349_295321_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664866.1|295352_295769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211609.1|296383_296692_+	double zinc ribbon family protein	NA	NA	NA	NA	NA
WP_032126373.1|296724_298911_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.0	2.7e-141
WP_016211605.1|299014_299248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211606.1|299464_299995_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_016211607.1|300023_300248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084807.1|300430_301246_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300526.1|301354_301651_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	446890	607383	3126070	tRNA,transposase	Escherichia_phage(27.91%)	171	NA	NA
WP_075275004.1|446890_447754_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|447970_449530_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|449551_450586_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|450634_451204_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|451339_452311_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|452322_453900_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|453965_454952_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_054300512.1|455283_456393_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|456498_457683_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|457760_459749_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|459957_460113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300511.1|460370_460670_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_054300510.1|460940_461123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084814.1|461179_461353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275005.1|461497_461833_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|462749_464156_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|464173_465160_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|465162_466317_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|466313_467009_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|467143_468634_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210494.1|468654_469704_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|469770_471165_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210489.1|472043_473975_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_075273353.1|473979_474510_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|474544_474739_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|474781_475141_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|475560_476556_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_032126132.1|476568_478950_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|478955_479243_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|479514_479991_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|480135_480333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|480457_481432_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|482332_482431_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210477.1|482915_484205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300575.1|484441_485134_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|485175_485949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|485950_486892_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|487024_488602_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|488811_490569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|491117_491876_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|492083_492656_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|492759_493308_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|493609_493855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|493883_494180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941726.1|494447_495371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556451.1|495849_496107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275008.1|496170_496899_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	3.3e-43
WP_032126799.1|497488_498301_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_129556452.1|499421_499769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|499771_501511_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300501.1|502015_502744_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_016212066.1|503392_504169_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_016212069.1|504380_504548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212070.1|504522_505122_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_054300500.1|505531_506260_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_032126794.1|506453_506846_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|506842_507088_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300307.1|508191_508920_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_032126154.1|509472_509667_+	addiction module toxin, HicA family	NA	A0A1X9I5T5	Streptococcus_phage	48.4	2.8e-10
WP_016212274.1|509677_510142_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	33.1	1.8e-07
WP_155084815.1|510672_511764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|512068_513094_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032126347.1|513272_514013_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	6.0e-08
WP_032126346.1|514079_514322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212315.1|514421_514856_-	DUF29 domain-containing protein	NA	A0JC30	Ralstonia_phage	39.7	9.1e-25
WP_155084989.1|515396_516368_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155084990.1|516489_516804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155084816.1|517509_518395_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007079.1|518607_518880_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	42.5	2.0e-06
WP_036781073.1|518950_519211_-	cytotoxic translational repressor of toxin-antitoxin stability system	NA	A0A1S5NR91	Burkholderia_phage	48.8	2.1e-13
WP_155084817.1|519288_519519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212159.1|521873_522071_-	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_155047059.1|522338_523253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|523362_524091_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211714.1|524581_527926_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_144019196.1|527958_528615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300201.1|528670_529399_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_155084818.1|529494_530058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211674.1|530408_530690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148037512.1|530673_530958_+	antitoxin	NA	NA	NA	NA	NA
WP_155084819.1|531042_532092_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556625.1|532306_532864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126478.1|532856_533195_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.7e-24
WP_032126479.1|533181_533535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212114.1|533531_533762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212110.1|533765_534236_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	62.5	7.6e-33
WP_054300201.1|534882_535611_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_016212024.1|536006_536255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212021.1|536251_536851_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212022.1|536850_537069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084820.1|537555_538548_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_155084821.1|538544_539279_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_033923793.1|539448_540231_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155084822.1|540477_541218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|541313_542375_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155084823.1|542427_542907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|542959_544113_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016211807.1|544403_544625_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728351.1|544512_544671_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155084824.1|544934_546947_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_075275029.1|547115_547844_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	9.6e-43
WP_155084825.1|548587_549397_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	8.5e-16
WP_032126239.1|549447_549720_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|549731_550568_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_016211646.1|550937_551177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211642.1|551169_551523_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_129556455.1|551823_552426_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211641.1|552430_552886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377362.1|552908_553511_+	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	30.8	1.5e-09
WP_036781052.1|553977_554580_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126808.1|554742_554952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211639.1|554959_555262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211644.1|555376_555643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104773.1|555750_556194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|557241_558303_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052104771.1|558656_558995_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	54.9	5.4e-25
WP_075274739.1|558987_559335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274717.1|559331_559562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274718.1|559565_560036_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	64.3	1.3e-32
WP_155084991.1|560180_560525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|560546_560912_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|560857_561433_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036780395.1|561649_561904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377363.1|561887_562244_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_075274719.1|562549_563416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|563564_564293_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211235.1|564787_565225_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|565654_567043_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211238.1|567485_568979_+	amino acid permease	NA	NA	NA	NA	NA
WP_129556456.1|569180_569930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211242.1|569973_570942_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_016211244.1|570895_571591_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_032126362.1|572203_572569_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|572514_573090_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211663.1|573773_574439_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211661.1|574503_575460_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_032126810.1|575718_576417_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211662.1|576459_577572_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_075273327.1|578176_578752_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|578697_579063_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212580.1|579150_579501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|580236_581298_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210908.1|582797_583613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126716.1|583703_584687_+	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210913.1|584857_585379_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_016210914.1|585412_585664_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.8e-20
WP_016210909.1|585669_586947_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_051307343.1|587639_588167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210906.1|588286_590599_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_032126715.1|590727_591543_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210915.1|591740_592205_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|592334_593396_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211491.1|593656_593953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211493.1|594235_595699_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211489.1|595701_596754_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_036779281.1|596743_597199_+	arginine repressor	NA	NA	NA	NA	NA
WP_016211487.1|597223_597547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|597894_598206_-	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_032126201.1|598335_599082_+	lipoprotein	NA	NA	NA	NA	NA
WP_054300148.1|599103_600165_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126197.1|600284_601238_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016212075.1|601351_601549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047032.1|601761_601995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212072.1|602024_602222_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212074.1|602308_602530_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|602556_602922_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275038.1|602867_603458_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046713.1|603595_603760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126195.1|604054_605491_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016210532.1|605532_606984_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016210537.1|607095_607383_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	617873	655023	3126070	plate,transposase	Escherichia_phage(50.0%)	38	NA	NA
WP_054300202.1|617873_618602_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_155047260.1|618695_618854_+	phosphatase	NA	NA	NA	NA	NA
WP_054300202.1|619018_619747_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_155084826.1|619789_620257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|620306_620597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275039.1|621400_621895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007066.1|621889_622228_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962625.1|622607_623493_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556462.1|623490_624336_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.8	1.4e-24
WP_016210435.1|624566_625373_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_016210431.1|625432_625825_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_016210434.1|625869_626688_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_016210429.1|626700_627684_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_016210428.1|627685_628957_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_080664841.1|628963_631468_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_016210436.1|631597_632623_+	phosphotransferase	NA	NA	NA	NA	NA
WP_016210439.1|632619_633330_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_155049107.1|633356_633608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210440.1|633607_634084_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016210438.1|634211_634595_+	response regulator	NA	NA	NA	NA	NA
WP_016210442.1|634629_635529_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_016210432.1|635574_636246_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_016210437.1|636304_636880_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.5	3.7e-58
WP_017376335.1|636978_637779_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_032126191.1|637911_638433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209533.1|638577_638898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209536.1|640759_643930_-	intracellular multiplication and macrophage-killing family protein	NA	NA	NA	NA	NA
WP_016209529.1|643942_644653_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_016209523.1|644657_646007_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209510.1|646057_646495_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209501.1|646756_648268_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_032126188.1|648273_649500_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|649493_650522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|650499_651192_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_155049805.1|651193_652666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556464.1|652655_653147_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_051307310.1|653152_654625_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032126187.1|654624_655023_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 7
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	692102	864965	3126070	tRNA,transposase,protease	Staphylococcus_phage(18.52%)	148	NA	NA
WP_080743011.1|692102_692558_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556469.1|692517_692826_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|693647_694553_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_054300173.1|694599_695661_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212599.1|695710_695920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|697154_697601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|697604_698180_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275054.1|698125_698491_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126651.1|698611_698797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209899.1|698900_699935_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|699931_700642_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209923.1|701116_701635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209901.1|701752_702085_-	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_016209920.1|702114_705069_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_016209912.1|705114_705612_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209922.1|705671_706088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209915.1|706179_707040_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126652.1|707122_707689_+	chorismate lyase	NA	NA	NA	NA	NA
WP_016209918.1|707721_708576_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_054300222.1|708617_711524_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|711584_711782_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209903.1|711788_712799_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209910.1|712795_713854_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_032126655.1|713847_714648_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209913.1|714650_715469_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209907.1|715480_716428_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_032126654.1|716435_717737_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209919.1|717915_719019_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_016209906.1|719015_719408_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209924.1|719419_720796_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209900.1|720789_722259_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_016209916.1|722450_723422_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	3.7e-34
WP_129556478.1|723658_724545_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|724844_725090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300225.1|726052_726472_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046954.1|726578_726752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126800.1|726978_727713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|727837_728899_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940948.1|729221_729926_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210599.1|730019_730733_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016210601.1|730815_731907_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210603.1|731978_732560_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210606.1|732565_733192_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210609.1|733288_734224_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_129556471.1|734583_735255_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210598.1|735396_736056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210607.1|736224_737484_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_155084829.1|737480_738566_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	3.3e-07
WP_155084830.1|738558_739440_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210612.1|739428_740679_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_075275125.1|742270_743314_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|745450_745816_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|745761_746337_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209387.1|746474_747359_-	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_016209373.1|747488_748310_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_016209389.1|748311_749349_-	asparaginase	NA	NA	NA	NA	NA
WP_016209367.1|749349_752007_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_016209375.1|752084_752894_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_032126579.1|753316_754084_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_016209372.1|754248_755127_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_016209399.1|755130_755868_+	UMP kinase	NA	NA	NA	NA	NA
WP_016209396.1|755871_756429_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_032126580.1|756445_757183_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.5	7.2e-22
WP_016209379.1|757190_757997_+	cytidylyltransferase	NA	NA	NA	NA	NA
WP_016209397.1|758084_758960_+	bacterial lipid A biosynthesis acyltransferase family protein	NA	NA	NA	NA	NA
WP_155084831.1|759080_760724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209400.1|761161_763123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209393.1|763667_764207_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_016209364.1|764203_765232_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_016209394.1|765221_766286_-	GHMP kinase	NA	NA	NA	NA	NA
WP_080664815.1|766273_768487_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_051307309.1|768488_769529_-	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_129556472.1|769867_772261_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_016209381.1|772341_772875_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_155084832.1|772926_773976_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_016209390.1|774002_774440_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_016209377.1|774439_775213_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_016209376.1|775231_776386_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_032126583.1|776598_777168_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	42.9	5.7e-27
WP_016209365.1|777191_780698_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.5	4.9e-193
WP_016209366.1|780775_781735_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_016209374.1|781709_783161_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209368.1|783196_784726_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_054300233.1|785301_786945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126585.1|787486_788407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155084833.1|788757_789573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209395.1|789864_792555_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_155084834.1|792803_794024_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|794191_795898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209398.1|796496_797723_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|798299_799274_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273456.1|799396_799696_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|799655_800111_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300559.1|800991_801540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|802255_802621_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|802566_803142_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155084835.1|803168_803885_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155084836.1|804155_804518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556627.1|804570_805176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211819.1|805394_805625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|805921_806422_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211818.1|806624_807881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777316.1|808237_808651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|810316_811291_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212172.1|811593_813066_+	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_054300271.1|813085_814060_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_036793948.1|814291_814486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|814651_815272_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_155084837.1|815590_817567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210739.1|817722_819180_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210743.1|819248_820829_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_016210744.1|820869_821355_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210746.1|821451_825348_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210741.1|825354_825678_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_054300173.1|826363_827425_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210303.1|827474_827714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307327.1|827989_829021_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.7e-35
WP_016210294.1|829338_829683_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_075273633.1|829820_830447_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_016210301.1|830496_831324_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_032126460.1|831500_831938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126457.1|832845_833265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777321.1|834309_835590_+	membrane protein	NA	NA	NA	NA	NA
WP_016210287.1|835710_836574_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_016210290.1|836662_837457_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155084838.1|837697_838696_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032126458.1|838701_840228_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_032126463.1|840308_841565_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210297.1|841621_843001_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_129556628.1|843086_843902_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.5e-32
WP_033923708.1|844106_844982_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211687.1|845237_845882_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211685.1|845912_847718_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|847741_848317_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556476.1|848861_849872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|849967_850942_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209640.1|851096_852116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209649.1|852574_853540_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209646.1|853584_854160_-	VOC family protein	NA	NA	NA	NA	NA
WP_016209651.1|854190_855465_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126159.1|856110_856824_+	aldolase	NA	NA	NA	NA	NA
WP_016209641.1|856903_857641_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016209658.1|857761_859117_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_075273478.1|859293_859965_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209661.1|860080_860956_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_016209645.1|861559_862864_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|862976_863582_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|863663_864965_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
>prophage 8
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	883757	933443	3126070	integrase,transposase	Bacillus_phage(23.08%)	51	884802:884861	907107:907696
WP_075275067.1|883757_884825_+|transposase	transposase	transposase	NA	NA	NA	NA
884802:884861	attL	TGTAAAACTCCAGATATGATCTGACAAGCTTAAATCATCTGACAACATTTGTCTGATTGA	NA	NA	NA	NA
WP_075273327.1|885580_886156_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274918.1|886101_886467_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051307360.1|887306_888236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084839.1|889327_890134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|890476_892369_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_032126157.1|892655_893060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155084840.1|893291_893813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|893802_894689_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212436.1|895027_895438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556479.1|895651_895834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274918.1|896321_896687_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|896632_897208_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|898033_899008_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080664862.1|899487_900186_+	P-loop NTPase	NA	NA	NA	NA	NA
WP_016211528.1|900166_900472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211532.1|901118_902069_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	35.8	1.8e-09
WP_155084841.1|902107_902569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211530.1|902574_903471_-	Abi family protein	NA	A3QSC6	Clostridium_virus	32.0	5.3e-35
WP_016211531.1|903824_904505_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_032126152.1|904568_905159_-|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016212424.1|905361_905640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|905632_905905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|906049_907132_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211300.1|907182_908223_-	restriction endonuclease	NA	NA	NA	NA	NA
907107:907696	attR	TCAATCAGACAAATGTTGTCAGATGATTTAAGCTTGTCAGATCATATCTGGAGTTTTACAACTTATACCTAGTCAGTTAATGTGTTACTAATTCTTTCATCGGTGTTAACTTAAGGTCTTTCATTTCTTTTTGATCAAAATAACCATCGATTAATATAGATAATATACTTCCATTTTGAAGGTATTGTTGTTTACTATTATCATTTTTTTGTTTTAGTTCTGACCACTCAGAATATTCAAAGTTGTTGTGTTTAGATATTGAATATTGCTGATTATTAATGTGATCAGCTACAGCGAAAGCATATTTATAATTGGATGATCGATCAATGATAATTCTTGATTGAGCAATTTTAAGTCTAATTGTTATTTCTGCGCGCGGTAGAAAAATAGCGTTATCTTGATTATAAATGACAATATCTTCACTAAAATTAATATTTAGCTTTGTCTGTAAATATCTAGTGCATTCTTCGCCACCATTAATGAGCAGGCTTTTTTTCTGAAACTTTTTAATTCCTTCTATAGTGGCATATTCAATAGCAGATTCTAAGGTTTTATATTTATCCTTATGTTTTGATATGATTATATTTTCA	NA	NA	NA	NA
WP_155084842.1|908734_909529_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_075275201.1|909430_910159_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016210551.1|911044_911227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210541.1|911291_911519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556629.1|911749_912496_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_026063577.1|912722_913016_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556482.1|913087_913693_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_016210545.1|913841_914819_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_032126547.1|914915_916358_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210553.1|916384_917038_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_016210552.1|917162_917729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307331.1|918088_919867_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_052104721.1|919938_921645_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.7	7.3e-25
WP_054300262.1|921636_921927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307332.1|921974_922181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|922389_922755_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273371.1|922700_923276_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212461.1|923279_923654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|924029_925004_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_054300264.1|925106_925445_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_054300265.1|925589_925850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556469.1|925809_926118_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556484.1|926619_928080_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_016211426.1|928423_929866_+	MFS transporter	NA	NA	NA	NA	NA
WP_075273490.1|930848_932141_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_054300148.1|932381_933443_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	947872	1003400	3126070	tRNA,transposase	uncultured_Mediterranean_phage(14.29%)	50	NA	NA
WP_081377899.1|947872_948736_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211781.1|949150_950398_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_129556630.1|950707_952057_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_129556486.1|952142_952490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273492.1|952580_952700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|952808_953870_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007012.1|953864_954035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|954024_954189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|954245_954611_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300269.1|954632_955001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210898.1|955912_956263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|956351_956642_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210894.1|957116_957419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300270.1|957759_958737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556487.1|958815_960153_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210903.1|960271_960643_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_016210904.1|960863_961514_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210896.1|961556_962639_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210899.1|962692_964576_+	APC family permease	NA	NA	NA	NA	NA
WP_032126790.1|965103_966009_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211091.1|966055_968536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273494.1|969600_970161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|970180_971155_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211036.1|971502_973374_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_016211039.1|973465_975211_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211043.1|975290_975740_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211035.1|975792_976008_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211042.1|976254_977271_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211037.1|977319_977949_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211040.1|978299_979511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126170.1|979738_980011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556558.1|980174_981068_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556557.1|981212_981524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212394.1|981571_982276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211450.1|983297_984320_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211448.1|984418_985627_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211446.1|985616_987344_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_129556648.1|987527_988499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|988912_989974_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126397.1|990322_990913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210561.1|991027_992362_-	dihydroorotase	NA	NA	NA	NA	NA
WP_155084844.1|992489_993131_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_016210566.1|993436_993859_+	universal stress protein	NA	NA	NA	NA	NA
WP_016210559.1|994219_995182_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_081007068.1|995220_996396_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_155084845.1|996484_998185_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_054300273.1|998184_999723_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.2	5.1e-70
WP_016210562.1|999751_1001404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210558.1|1001477_1002233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|1002513_1003400_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	1072755	1200926	3126070	tRNA,integrase,transposase,protease	Staphylococcus_phage(28.57%)	114	1125335:1125394	1145097:1145386
WP_016209432.1|1072755_1074465_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016209448.1|1074722_1076054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209449.1|1076495_1077968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1078141_1079116_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300152.1|1079789_1080155_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274897.1|1080395_1081262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273512.1|1081774_1082119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776562.1|1082271_1082463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155084851.1|1082706_1083282_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1083227_1083593_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300283.1|1083833_1084475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1084943_1085918_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155084852.1|1086384_1087665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780476.1|1087900_1089838_-	histidine kinase	NA	NA	NA	NA	NA
WP_016210517.1|1090851_1091571_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_032126504.1|1091684_1095224_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_016210525.1|1095290_1096109_+	ZipA protein	NA	NA	NA	NA	NA
WP_016210518.1|1096095_1098135_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.8	3.0e-126
WP_016210522.1|1098150_1099203_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_016210524.1|1099213_1099744_+	exsB family protein	NA	NA	NA	NA	NA
WP_129556549.1|1100282_1101168_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046739.1|1102053_1102194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210010.1|1103838_1104015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210017.1|1104190_1104574_+	hpt domain protein	NA	NA	NA	NA	NA
WP_075273518.1|1104649_1104943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210016.1|1105109_1106069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210020.1|1106669_1106825_+	putative membrane protein	NA	NA	NA	NA	NA
WP_016210025.1|1107089_1108460_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_052104723.1|1108452_1109406_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210005.1|1109386_1112191_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	2.4e-57
WP_016210027.1|1112270_1112867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|1113256_1114012_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210004.1|1114211_1114853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210021.1|1115113_1116439_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210023.1|1116435_1118493_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210007.1|1118470_1119043_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126616.1|1119098_1119458_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210019.1|1119522_1120557_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_122941592.1|1120814_1121666_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|1121760_1122744_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_016210013.1|1122900_1124568_+	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
1125335:1125394	attL	CCGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTT	NA	NA	NA	NA
WP_075274733.1|1125506_1125824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084853.1|1125842_1126418_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1126363_1126729_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300287.1|1126750_1127080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084854.1|1127488_1127992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046738.1|1128613_1128754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155084855.1|1128762_1129266_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	54.2	5.1e-43
WP_155084856.1|1129410_1129794_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|1129910_1130204_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_081377874.1|1130698_1131166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1131334_1131592_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274890.1|1131661_1132342_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_129556545.1|1132546_1132888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212209.1|1133142_1134144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1134599_1134899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|1134888_1135053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1135210_1135549_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1135508_1135964_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075274888.1|1135968_1136304_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274886.1|1136575_1137637_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211279.1|1138380_1140849_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_016211277.1|1140862_1141831_+	homoserine kinase	NA	NA	NA	NA	NA
WP_016211278.1|1141817_1143077_+	threonine synthase	NA	NA	NA	NA	NA
WP_129556646.1|1143128_1144514_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155084857.1|1145351_1145549_+	hypothetical protein	NA	NA	NA	NA	NA
1145097:1145386	attR	CCGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGT	NA	NA	NA	NA
WP_155084858.1|1145829_1146627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211170.1|1146785_1146956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036778145.1|1147587_1148709_+	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	8.7e-11
WP_016211172.1|1148758_1149955_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_080664856.1|1150143_1151208_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_051307350.1|1151191_1151938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211165.1|1151927_1152656_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211168.1|1152652_1153312_+	wbqC-like family protein	NA	NA	NA	NA	NA
WP_016211169.1|1153295_1154243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|1154242_1154758_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778065.1|1154800_1156234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210393.1|1156327_1158529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210398.1|1158729_1160322_+	B-type flagellin	NA	NA	NA	NA	NA
WP_032126669.1|1160546_1162124_+	B-type flagellin	NA	NA	NA	NA	NA
WP_122940572.1|1162242_1162668_+	flaG family protein	NA	NA	NA	NA	NA
WP_016210394.1|1162778_1164164_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_032126670.1|1164189_1164627_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210390.1|1164631_1164973_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_016210399.1|1164987_1166979_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210388.1|1167004_1167679_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210397.1|1167675_1169850_-	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_054300550.1|1170039_1170405_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1170461_1170626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1170615_1170915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155084859.1|1171047_1172601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|1172684_1173494_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_033923762.1|1173621_1173855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210769.1|1174155_1175658_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_016210773.1|1175961_1178655_+	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210771.1|1178651_1182053_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_054300162.1|1182144_1183227_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_129556544.1|1183289_1183646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274882.1|1183760_1184357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212246.1|1185292_1185949_+	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300162.1|1186052_1187135_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300271.1|1187474_1188449_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212247.1|1189076_1189832_-	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_036779544.1|1190198_1191206_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1191205_1191463_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1191827_1192802_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273524.1|1192842_1193808_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212058.1|1193963_1195514_+	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_155084860.1|1197715_1198798_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046981.1|1198887_1199064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046980.1|1199053_1199353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|1199342_1199507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1199563_1199929_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|1200062_1200926_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	1253934	1298972	3126070	integrase,transposase	Escherichia_phage(14.29%)	45	1267664:1267723	1300151:1300442
WP_054300307.1|1253934_1254663_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_155047177.1|1254709_1254856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300189.1|1254912_1255278_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036779232.1|1255560_1257120_-	APC family permease	NA	NA	NA	NA	NA
WP_016211215.1|1257480_1259451_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211211.1|1259642_1260722_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211213.1|1260770_1260977_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211210.1|1260983_1262465_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_155084862.1|1262567_1263131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|1264893_1266153_+	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211940.1|1266273_1266606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1266719_1267694_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
1267664:1267723	attL	CCATCGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGT	NA	NA	NA	NA
WP_016211341.1|1267838_1268009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211343.1|1268207_1269230_+	YHYH protein	NA	NA	NA	NA	NA
WP_016211342.1|1269237_1270920_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.1e-32
WP_016211344.1|1271080_1271899_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211347.1|1272112_1273096_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211340.1|1273088_1273310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211346.1|1273337_1273979_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_033923708.1|1274222_1275098_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032126239.1|1275662_1275935_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1275946_1276783_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_105962625.1|1278794_1279680_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1279684_1279972_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_036774554.1|1280024_1280303_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126998.1|1280401_1280749_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_032126997.1|1281070_1281310_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075273532.1|1281527_1282115_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300314.1|1282075_1282411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211315.1|1282598_1283243_-	porin family protein	NA	NA	NA	NA	NA
WP_016211316.1|1283577_1284228_-	porin family protein	NA	NA	NA	NA	NA
WP_016211319.1|1284760_1285813_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032126786.1|1285830_1288911_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_075274874.1|1289209_1289578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1289578_1290154_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1290099_1290465_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274873.1|1290486_1290984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556537.1|1291473_1291998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556536.1|1291957_1293110_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_081377871.1|1293113_1293806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1294010_1294268_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556478.1|1294457_1295344_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155084863.1|1295788_1296523_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155046734.1|1297178_1297316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1297910_1298972_-|transposase	transposase	transposase	NA	NA	NA	NA
1300151:1300442	attR	CCATCGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACG	NA	NA	NA	NA
>prophage 12
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	1329010	1375193	3126070	tRNA,transposase	Bacillus_thuringiensis_phage(25.0%)	46	NA	NA
WP_016209621.1|1329010_1330015_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209619.1|1330447_1331896_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155084865.1|1331982_1335039_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_080664820.1|1335021_1335192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046976.1|1335257_1335395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212485.1|1335691_1336225_-	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_032126753.1|1337210_1337675_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_016211466.1|1337744_1339265_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126752.1|1339352_1339955_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211464.1|1339951_1340299_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_016211465.1|1340449_1341433_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_016211462.1|1342060_1343041_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_052047087.1|1343201_1343420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047172.1|1343591_1344617_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300320.1|1345762_1346362_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155084866.1|1346653_1346884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300321.1|1347028_1347400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212346.1|1348194_1348341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1348574_1349438_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155084867.1|1349646_1350840_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_016211748.1|1350919_1352524_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211752.1|1352539_1353685_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_129556531.1|1353889_1354087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1354049_1354388_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1354347_1354803_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_081007023.1|1354977_1355634_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016212534.1|1355710_1355977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211725.1|1357547_1358462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155084868.1|1358500_1360435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211726.1|1360822_1361416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084869.1|1361587_1362184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046732.1|1362298_1362469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155084870.1|1362689_1362935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300326.1|1363036_1363501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046975.1|1363914_1364364_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_016212459.1|1364483_1364864_+	glycine-zipper containing OmpA-like membrane domain protein	NA	NA	NA	NA	NA
WP_054300328.1|1365001_1365778_-	class I SAM-dependent methyltransferase	NA	R4ZD91	Adoxophyes_honmai_entomopoxvirus	25.5	8.1e-16
WP_155046974.1|1365888_1366050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084871.1|1366201_1367410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274659.1|1367459_1368521_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211456.1|1369142_1369721_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_122942091.1|1369748_1370144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211455.1|1370249_1371707_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_016211452.1|1371768_1373256_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211454.1|1374006_1374477_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1374617_1375193_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	1388983	1439907	3126070	integrase,transposase	uncultured_Caudovirales_phage(33.33%)	50	1387013:1387072	1450316:1450604
1387013:1387072	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_129556556.1|1388983_1389559_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1389504_1389870_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080664871.1|1390301_1391924_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.9	1.9e-27
WP_051307365.1|1392873_1393134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211836.1|1393153_1393642_+	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_129556528.1|1395165_1395594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1396015_1396273_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155084872.1|1396342_1397281_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155084873.1|1397306_1398944_-	amino acid permease	NA	NA	NA	NA	NA
WP_016210800.1|1399079_1399907_-	DsbA family protein	NA	NA	NA	NA	NA
WP_075273540.1|1400273_1400885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556527.1|1401069_1401330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210799.1|1401503_1402457_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_016210791.1|1402883_1403084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307339.1|1403458_1404265_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155084874.1|1404370_1405342_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210801.1|1405323_1406295_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155084875.1|1406617_1407298_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_081007004.1|1407299_1407755_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1407714_1408053_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211352.1|1408226_1408667_-	universal stress protein	NA	NA	NA	NA	NA
WP_016211350.1|1409345_1410284_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_032127067.1|1412337_1412940_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211351.1|1412936_1413275_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_129556640.1|1413350_1414577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1414843_1415818_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211856.1|1416033_1416219_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_016211855.1|1416345_1416813_+	bacterioferritin	NA	NA	NA	NA	NA
WP_016211857.1|1416809_1417688_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_032126602.1|1417938_1419246_+	MFS transporter	NA	NA	NA	NA	NA
WP_081007004.1|1419398_1419854_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1419813_1420152_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155084876.1|1420354_1420531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|1420578_1421640_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|1422268_1423174_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211738.1|1423244_1423889_+	membrane protein	NA	NA	NA	NA	NA
WP_016211741.1|1424365_1425142_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126783.1|1425287_1426529_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211739.1|1426639_1427146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046970.1|1427262_1427511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211177.1|1428935_1430156_-	amino acid permease	NA	NA	NA	NA	NA
WP_036776658.1|1430535_1432530_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_081007029.1|1432642_1433251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126449.1|1433317_1434241_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016211180.1|1434261_1434726_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_016211178.1|1434788_1435817_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_032126448.1|1435907_1436288_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_016211182.1|1436319_1436649_+	DUF4404 family protein	NA	NA	NA	NA	NA
WP_016212475.1|1437633_1437840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556525.1|1439086_1439907_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
1450316:1450604	attR	AAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGCTGGAGCTATGTTAAAAAGCATGTTCGTCAGTATGAAGAAGAAGTTGGAGGCGTTTTAAGTCTGGATGATACCGTGGAAGAAAAGCCTTATACAGATGAGAATGATGTGGTTTGTTGGCATTATTCACACAGCAAAAGCGCTCATGTAAAGGGAATTAATATTTTGACAAGTATGGTGACTTACAAGAAAACGTCCGTACCTATTGGTTATGAAACTGTATTAAAAGAC	NA	NA	NA	NA
>prophage 15
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	1593460	1651974	3126070	tRNA,integrase,transposase,protease	Staphylococcus_phage(20.0%)	56	1595019:1595078	1625384:1625464
WP_054300271.1|1593460_1594435_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046727.1|1594678_1595023_+	hypothetical protein	NA	NA	NA	NA	NA
1595019:1595078	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_081377353.1|1595848_1596514_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274955.1|1596553_1597528_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016211144.1|1598084_1598714_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_016211152.1|1598697_1599120_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211145.1|1599126_1600866_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211153.1|1600866_1601931_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1601934_1602288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1602410_1603367_+	ferrochelatase	NA	NA	NA	NA	NA
WP_016211151.1|1603376_1603688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1603703_1604273_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211148.1|1604536_1605865_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|1606069_1607044_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210841.1|1607265_1607637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210839.1|1607695_1608469_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_129556514.1|1608620_1611077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126340.1|1611356_1612118_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_122941824.1|1612198_1613935_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016210844.1|1614119_1615247_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.2	5.7e-10
WP_016210843.1|1615333_1615564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556637.1|1616178_1616958_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016212589.1|1617432_1617870_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300363.1|1618293_1618641_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556512.1|1618586_1619162_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212275.1|1619151_1620135_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300364.1|1620250_1621129_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211335.1|1621238_1621556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126267.1|1621549_1621792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211330.1|1622139_1623240_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_098082827.1|1623414_1624716_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.9	4.1e-28
WP_052104656.1|1624792_1625296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126265.1|1625619_1626537_-	sel1 repeat family protein	NA	NA	NA	NA	NA
1625384:1625464	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCC	NA	NA	NA	NA
WP_016211336.1|1626602_1627217_-	chorismate mutase	NA	NA	NA	NA	NA
WP_016211334.1|1627265_1627454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210322.1|1628071_1628968_+	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016210320.1|1629104_1630178_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_054300366.1|1630327_1630741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300568.1|1630761_1631472_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.3	4.1e-38
WP_129556511.1|1631654_1633091_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210321.1|1633287_1634256_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_155084882.1|1634304_1634823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210327.1|1634883_1636215_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210325.1|1636350_1637727_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210326.1|1637880_1639179_-	ankyrin repeats family protein	NA	NA	NA	NA	NA
WP_032126607.1|1639518_1640802_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_016210333.1|1640875_1641505_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_016210330.1|1641708_1642092_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210332.1|1642189_1642933_+	ribonuclease T2 family protein	NA	NA	NA	NA	NA
WP_075273555.1|1643063_1643597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212498.1|1643874_1644558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126599.1|1645197_1646541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211804.1|1647235_1648621_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
WP_016211805.1|1648627_1650166_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211806.1|1650208_1650934_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_155084883.1|1651098_1651974_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	1657788	1726950	3126070	tRNA,transposase,protease	Klosneuvirus(22.22%)	60	NA	NA
WP_016211285.1|1657788_1658568_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_016211280.1|1658567_1659077_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|1659112_1659361_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_016211281.1|1659672_1660008_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_016211282.1|1660311_1661562_+	MFS transporter	NA	NA	NA	NA	NA
WP_032126762.1|1661643_1663671_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_016210148.1|1664506_1664725_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_016210147.1|1665585_1666758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777648.1|1666770_1668768_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_016210142.1|1668748_1669729_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155084884.1|1669788_1670658_-	TonB family protein	NA	NA	NA	NA	NA
WP_155084885.1|1670657_1671074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273564.1|1671054_1671474_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016210157.1|1671496_1672126_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_016210144.1|1672668_1674858_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_016210150.1|1674869_1676075_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_080664836.1|1676059_1677910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664835.1|1677897_1679124_+	MFS transporter	NA	NA	NA	NA	NA
WP_155084886.1|1679116_1680985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210149.1|1681018_1682263_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210155.1|1682268_1683078_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.9	3.8e-16
WP_016210154.1|1683116_1683809_-	haloacid dehalogenase	NA	NA	NA	NA	NA
WP_016210146.1|1683930_1684422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046720.1|1684771_1684945_+	phosphatase	NA	NA	NA	NA	NA
WP_075273565.1|1685082_1685973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046721.1|1686153_1686321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1686492_1687467_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212367.1|1687463_1688321_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209842.1|1689048_1689438_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209834.1|1689614_1690373_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209829.1|1690369_1692769_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209839.1|1694148_1695447_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209838.1|1695644_1696538_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209836.1|1696537_1697752_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_032126639.1|1697771_1699058_-	GTPase HflX	NA	NA	NA	NA	NA
WP_016209846.1|1699073_1699328_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016209830.1|1699563_1700931_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209826.1|1701261_1702284_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_016209845.1|1702806_1704282_+	APC family permease	NA	NA	NA	NA	NA
WP_129556633.1|1704498_1705395_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209827.1|1705713_1707273_+	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_016209841.1|1707348_1707543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209831.1|1707762_1708461_+	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209832.1|1708739_1709003_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209848.1|1709309_1711904_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209835.1|1711900_1712383_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209844.1|1712360_1713401_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209840.1|1713573_1714059_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_032126641.1|1714166_1716737_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_032126642.1|1716772_1717234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144019283.1|1717303_1717495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211648.1|1718713_1719253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211650.1|1719912_1721397_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211651.1|1721521_1723057_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032126362.1|1723290_1723656_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556501.1|1723601_1724177_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126540.1|1724209_1725073_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080728346.1|1725090_1725423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046723.1|1726330_1726486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210928.1|1726644_1726950_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	1747749	1792729	3126070	tRNA,transposase	Acinetobacter_phage(25.0%)	41	NA	NA
WP_075273327.1|1747749_1748325_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_059372328.1|1748328_1748796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|1749426_1749927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|1750342_1750696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211831.1|1750996_1752724_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_081007040.1|1752861_1753518_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016210510.1|1753548_1754277_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_016210506.1|1754269_1755508_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210512.1|1755643_1756681_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210515.1|1756734_1757637_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210514.1|1757745_1758999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|1759056_1762554_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_075273576.1|1762613_1763342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155084890.1|1763469_1764018_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016210508.1|1764338_1766036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1766044_1767198_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_032127044.1|1768099_1768300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047136.1|1768392_1768824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|1768991_1769357_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273298.1|1769302_1769878_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211467.1|1769952_1770519_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_032126344.1|1770521_1771610_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032126343.1|1771730_1772543_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_054300379.1|1772673_1774659_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211470.1|1774718_1775372_-	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_155084891.1|1776138_1777104_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1777144_1778119_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212421.1|1778869_1779052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377341.1|1779403_1779703_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.7	1.8e-19
WP_129556499.1|1779766_1780920_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_155084892.1|1780981_1782064_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155084893.1|1782251_1782887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1782897_1783980_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300173.1|1784282_1785344_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211841.1|1786203_1786656_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211839.1|1786773_1788246_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211840.1|1788404_1788869_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211838.1|1789339_1789513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1789824_1790799_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126143.1|1790898_1792170_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_016211422.1|1792258_1792729_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
>prophage 18
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	1797097	1827745	3126070	tRNA,transposase	Wolbachia_phage(25.0%)	27	NA	NA
WP_129556449.1|1797097_1797604_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1797618_1797984_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300380.1|1798187_1798844_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155084894.1|1799114_1799537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126139.1|1802383_1803313_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_016210804.1|1803319_1805239_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.0	4.5e-84
WP_032126141.1|1805303_1806578_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016210805.1|1806987_1807659_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_036776426.1|1807667_1808519_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_016210803.1|1808696_1809995_+	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_054300162.1|1810069_1811152_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212040.1|1811355_1812705_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_016212039.1|1812881_1813439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133287.1|1813627_1814026_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155084895.1|1814127_1815450_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	2.7e-11
WP_054300384.1|1815858_1816674_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212251.1|1816835_1817372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212250.1|1817533_1818184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084896.1|1818306_1818783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069065.1|1819010_1819223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1819613_1820891_-	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_080664858.1|1820887_1821025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211223.1|1821536_1823138_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211221.1|1823154_1824297_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211218.1|1824549_1825287_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211224.1|1825311_1826583_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_032126790.1|1826839_1827745_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	1864279	1970425	3126070	tRNA,transposase	uncultured_Mediterranean_phage(21.05%)	92	NA	NA
WP_075274825.1|1864279_1865341_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211999.1|1865884_1866238_+	ras family protein	NA	NA	NA	NA	NA
WP_016211998.1|1866227_1866791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212000.1|1866921_1867650_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016212002.1|1867769_1868048_+	DNA-J related family protein	NA	NA	NA	NA	NA
WP_129556636.1|1869001_1869310_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016210889.1|1869327_1872174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210887.1|1872683_1873634_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210886.1|1873716_1874496_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_016210883.1|1874564_1875272_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210888.1|1875232_1875484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|1875506_1875803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|1876336_1877110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|1877142_1877739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210885.1|1877796_1878678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300399.1|1879019_1879286_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300400.1|1879430_1879673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|1879729_1880257_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107517381.1|1880922_1881117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1881330_1881684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211827.1|1882015_1882636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155084898.1|1882899_1887072_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211770.1|1887271_1888405_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_016211771.1|1888418_1888607_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_075273594.1|1889912_1891283_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	4.2e-39
WP_016209929.1|1891355_1892249_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209948.1|1892357_1893275_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_016209943.1|1893326_1894082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209939.1|1894149_1895424_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209927.1|1895558_1896236_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209944.1|1896436_1897864_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209938.1|1897838_1898477_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209925.1|1898686_1898965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209935.1|1899198_1900143_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_032126634.1|1900164_1902033_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209930.1|1902053_1902407_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_016209936.1|1902445_1903561_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.6	1.4e-93
WP_016209932.1|1903743_1904784_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209945.1|1904786_1905821_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209926.1|1905817_1906879_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209931.1|1906990_1908463_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_052104625.1|1908615_1909059_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_155084899.1|1909134_1911906_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_036777555.1|1912062_1913292_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1913318_1913981_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_054300405.1|1914502_1915003_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155084900.1|1915104_1916211_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	7.3e-10
WP_075274669.1|1916415_1916718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300286.1|1917102_1917567_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105962623.1|1917730_1918883_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047120.1|1918892_1919237_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155084901.1|1919521_1920844_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	1.6e-11
WP_081007042.1|1921224_1922040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155084902.1|1924339_1927075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1927663_1928725_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126856.1|1928785_1929127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1929431_1930585_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155049815.1|1930767_1930920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212005.1|1931485_1933246_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_016210592.1|1933635_1934292_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016210586.1|1934304_1935810_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210593.1|1935831_1936362_-	colicin V production protein	NA	NA	NA	NA	NA
WP_016210590.1|1936441_1937704_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210587.1|1937878_1938739_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_032126176.1|1938840_1939623_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210588.1|1939713_1941039_-	fimV domain protein	NA	NA	NA	NA	NA
WP_016210595.1|1941406_1942585_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210594.1|1942761_1943415_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_016210596.1|1943550_1945491_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	3.1e-72
WP_129556498.1|1945487_1946096_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075275098.1|1946608_1947538_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.1e-24
WP_080728317.1|1947728_1951094_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211391.1|1951160_1951736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211393.1|1951747_1953304_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_155084903.1|1953323_1954007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084904.1|1954363_1954708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084905.1|1954939_1955503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1955588_1956741_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212252.1|1956938_1957097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212254.1|1957134_1958577_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155084906.1|1958566_1959453_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046696.1|1959619_1959784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1959773_1960073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211114.1|1960438_1963369_-	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_016211115.1|1963501_1965454_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211112.1|1965646_1966294_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211113.1|1966349_1967675_+	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_032126179.1|1967704_1967956_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_080664854.1|1967913_1968495_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_054300408.1|1968831_1969488_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_032126362.1|1969538_1969904_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275097.1|1969849_1970425_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	2000169	2174550	3126070	tRNA,transposase,protease	Staphylococcus_phage(20.0%)	174	NA	NA
WP_105962623.1|2000169_2001323_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016211588.1|2001490_2002192_-	cyclase family protein	NA	NA	NA	NA	NA
WP_032126329.1|2002267_2002897_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_129556496.1|2003082_2004321_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_016211592.1|2004595_2005258_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_016211589.1|2005247_2006480_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_032126328.1|2006608_2006860_+	VOC family protein	NA	NA	NA	NA	NA
WP_032126637.1|2007840_2008134_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_052047117.1|2008364_2008691_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155084910.1|2009180_2009516_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2009649_2010015_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2009960_2010536_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126332.1|2011182_2012382_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_016211366.1|2012634_2012922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126331.1|2012977_2014987_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_032126330.1|2015041_2016001_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_016211367.1|2016148_2016931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664860.1|2017086_2017524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2017665_2018640_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155084911.1|2018659_2019169_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2019114_2019480_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210269.1|2019517_2019868_+	L,D-transpeptidase catalytic domain protein	NA	NA	NA	NA	NA
WP_016210281.1|2019881_2021273_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_016210270.1|2021314_2024302_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210277.1|2024371_2025205_-	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210279.1|2025258_2026425_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210272.1|2026412_2027123_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210283.1|2027162_2027948_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_129556492.1|2027975_2028719_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|2028816_2031012_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_016210271.1|2031087_2031771_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_032126334.1|2031781_2032213_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_016210274.1|2032252_2032651_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_016210273.1|2033023_2033731_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210275.1|2033795_2034098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210276.1|2034153_2034630_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210284.1|2034684_2035206_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210280.1|2035287_2036382_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_054300412.1|2036618_2036933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273307.1|2037077_2037488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275091.1|2037758_2038244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155084912.1|2038876_2039047_-	phosphatase	NA	NA	NA	NA	NA
WP_054300415.1|2039195_2039897_+	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	33.0	1.6e-07
WP_032126500.1|2040030_2040747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211118.1|2040883_2042131_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126499.1|2042509_2043121_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211122.1|2043217_2044084_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|2044087_2044849_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_016211128.1|2045012_2045918_+	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211125.1|2046140_2046971_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211126.1|2047140_2047530_+	lipoprotein	NA	NA	NA	NA	NA
WP_155084913.1|2047662_2048613_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016212585.1|2048907_2049228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2049339_2050314_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155084914.1|2050683_2051136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084915.1|2051244_2051436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2051492_2051858_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275086.1|2051818_2052817_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212356.1|2052794_2053640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047081.1|2053690_2054128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212519.1|2054398_2054779_-	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_054300173.1|2054853_2055915_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212611.1|2055962_2056283_-	histidine kinase	NA	NA	NA	NA	NA
WP_081377357.1|2056766_2057168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274675.1|2057252_2057993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211088.1|2058373_2059336_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211087.1|2059555_2060551_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_016211081.1|2060578_2061514_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|2061554_2062016_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080664852.1|2061994_2063038_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_155084916.1|2063050_2064661_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_081007043.1|2064620_2066363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|2067086_2069123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211709.1|2071382_2071529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274676.1|2071687_2071885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777508.1|2071959_2072232_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_129556490.1|2073128_2074014_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212290.1|2074018_2075344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084917.1|2075460_2076069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155084918.1|2076213_2076810_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126869.1|2076787_2077027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2077547_2078123_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2078068_2078434_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126362.1|2079606_2079972_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2079917_2080493_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155084919.1|2080548_2081295_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2081463_2082438_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155084920.1|2082513_2083491_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.7	3.1e-28
WP_129556488.1|2083549_2084400_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275079.1|2084548_2085610_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126801.1|2085657_2086167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2086835_2087897_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212218.1|2089345_2089696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285943.1|2089840_2090677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211092.1|2090730_2092023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084921.1|2092258_2095015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211519.1|2096170_2096590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|2096590_2097292_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|2097552_2097759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941967.1|2097988_2098294_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126840.1|2098472_2100470_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2100453_2101500_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016212098.1|2102207_2103059_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016212100.1|2103059_2103980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212654.1|2104390_2104675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|2104666_2105122_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2105081_2105420_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212093.1|2105632_2106562_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_129556559.1|2106718_2107147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084922.1|2107227_2107668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2107705_2108611_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|2108829_2109438_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2110452_2111028_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155084923.1|2110973_2111339_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155084924.1|2111509_2112662_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	3.4e-58
WP_016211971.1|2112868_2113480_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032126649.1|2113500_2114697_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_017377024.1|2114793_2114934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211968.1|2114946_2115351_-	SufE family protein	NA	NA	NA	NA	NA
WP_075273313.1|2115476_2115815_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556562.1|2115774_2116077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|2116221_2116407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|2116976_2117558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556649.1|2117585_2118443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211960.1|2119270_2119798_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_081007045.1|2120119_2120749_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556650.1|2121581_2122556_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209885.1|2122984_2123698_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016209894.1|2123866_2124358_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209887.1|2124501_2124993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209877.1|2125195_2126086_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_080664826.1|2126263_2126863_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016209878.1|2126943_2127882_-	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	29.6	1.9e-14
WP_036777110.1|2127933_2129028_-	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_052104599.1|2129152_2130469_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	40.1	3.2e-65
WP_016209893.1|2130523_2135413_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_016209881.1|2135505_2135808_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_016209876.1|2135918_2137841_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_016209888.1|2137862_2139158_+	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_016209898.1|2139154_2140765_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_052104600.1|2140871_2141765_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_016209884.1|2141874_2142498_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036777115.1|2142574_2142775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209891.1|2142916_2143615_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016209896.1|2143761_2144331_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_122940402.1|2144645_2145269_-	porin family protein	NA	NA	NA	NA	NA
WP_032126745.1|2145477_2146080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|2146182_2146548_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046744.1|2146604_2146778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211421.1|2148051_2148276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273603.1|2149432_2149609_+	phosphatase	NA	NA	NA	NA	NA
WP_129556565.1|2149732_2150128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126686.1|2151597_2152182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274681.1|2152732_2153608_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_059372565.1|2153656_2154028_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556566.1|2153936_2154140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210465.1|2154647_2155490_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_016210463.1|2155540_2155888_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210471.1|2156078_2156966_+	ROK family protein	NA	NA	NA	NA	NA
WP_016210467.1|2157080_2157683_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210468.1|2157679_2158399_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_054300435.1|2158467_2160180_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_036777098.1|2160327_2162265_+	AsmA family protein	NA	NA	NA	NA	NA
WP_032126596.1|2162373_2163426_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_016210461.1|2163425_2163701_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016210458.1|2163781_2164330_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_155049143.1|2164646_2167241_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_080728331.1|2167405_2167897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047101.1|2168128_2169247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211720.1|2169494_2170418_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211716.1|2170431_2171355_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155049152.1|2171302_2171920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211719.1|2172261_2173089_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_105962623.1|2173397_2174550_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 21
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	2197022	2239934	3126070	transposase	Staphylococcus_phage(50.0%)	46	NA	NA
WP_054300443.1|2197022_2197301_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|2197353_2197602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2197559_2198621_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212177.1|2199616_2199790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212174.1|2199866_2200124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212205.1|2201809_2201989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|2202128_2203574_+	MFS transporter	NA	NA	NA	NA	NA
WP_036781320.1|2204132_2204360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|2204346_2204673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|2204674_2205106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084929.1|2205634_2206696_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210831.1|2206790_2207336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|2207605_2208625_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|2208611_2209034_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|2209035_2209509_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_052133275.1|2209624_2210248_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210836.1|2210277_2210952_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|2210957_2212106_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|2212102_2212564_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210830.1|2212639_2213890_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_016210824.1|2214016_2215696_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|2215805_2216672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084930.1|2216979_2217153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274920.1|2218390_2219125_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	4.8e-10
WP_036781250.1|2219220_2220006_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307345.1|2220149_2220836_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211002.1|2220869_2221268_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|2221431_2221737_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_016210998.1|2221814_2222069_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|2222222_2223884_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|2223943_2224627_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|2224626_2225715_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016211004.1|2225763_2228400_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300173.1|2228812_2229874_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300448.1|2230063_2232433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2232476_2233451_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211507.1|2233764_2235084_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|2235087_2235804_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211506.1|2235800_2236442_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_075274921.1|2236434_2236533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274922.1|2236510_2236807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211503.1|2236817_2237273_-	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_016211508.1|2237327_2237672_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211502.1|2237701_2238745_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_129556569.1|2239159_2239369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2239358_2239934_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	2311387	2370446	3126070	tRNA,transposase	Planktothrix_phage(18.18%)	55	NA	NA
WP_129556571.1|2311387_2312098_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2312126_2312531_+	RidA family protein	NA	NA	NA	NA	NA
WP_016209567.1|2313646_2314264_-	MFS transporter	NA	NA	NA	NA	NA
WP_155084936.1|2314334_2314478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126712.1|2314698_2315157_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209553.1|2315901_2316912_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	42.2	2.9e-58
WP_016209566.1|2317396_2318308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209545.1|2318633_2322128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209551.1|2322165_2323005_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.0	1.8e-45
WP_016209564.1|2323191_2323407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209547.1|2323455_2324031_-	ribonuclease HI	NA	V9M0C8	Vibrio_phage	46.6	1.3e-29
WP_016209540.1|2324027_2324366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209568.1|2324534_2325524_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.7	1.7e-18
WP_016209572.1|2325524_2326487_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-16
WP_016209559.1|2326496_2327399_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155084937.1|2327442_2328417_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212612.1|2328554_2328788_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300455.1|2328881_2329247_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2329261_2329768_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2330133_2330499_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2330444_2331020_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300550.1|2331306_2331672_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300461.1|2331728_2332037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2332128_2332704_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2332649_2333015_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|2333167_2333440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126774.1|2334048_2334384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307356.1|2334543_2336076_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_016211407.1|2336108_2336948_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211411.1|2336944_2337442_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_016211412.1|2337445_2338438_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_016211408.1|2338552_2339899_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_054300173.1|2340122_2341184_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212287.1|2341262_2342408_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_016211372.1|2348219_2349077_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016211371.1|2349063_2349987_-	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211368.1|2350183_2351575_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211369.1|2351621_2352665_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211370.1|2352707_2353151_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211374.1|2353283_2354474_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211373.1|2354528_2354675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155084938.1|2354855_2355170_-	response regulator	NA	NA	NA	NA	NA
WP_016212140.1|2355226_2356144_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_036794860.1|2356411_2356705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|2356781_2356976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212197.1|2357994_2358912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210876.1|2359377_2360220_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016210873.1|2360287_2360938_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210874.1|2360952_2361993_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210882.1|2362115_2363201_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210872.1|2363227_2364337_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210871.1|2364353_2364671_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210879.1|2364667_2365027_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_080664847.1|2368358_2369312_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_054300173.1|2369384_2370446_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	2462654	2486948	3126070	tRNA,transposase	Escherichia_phage(50.0%)	27	NA	NA
WP_054300202.1|2462654_2463383_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019244.1|2463472_2464084_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_036779399.1|2464440_2464695_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|2464793_2466578_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_016210956.1|2466666_2467386_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_155084943.1|2467568_2467775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210948.1|2467774_2468011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|2468023_2468401_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|2468907_2469726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210947.1|2469819_2470017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084944.1|2470111_2471497_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210945.1|2471623_2472214_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_054300271.1|2473024_2473999_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075274931.1|2474255_2474984_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211816.1|2476052_2476406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|2476447_2478061_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_075274932.1|2478282_2478504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2479262_2479838_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2479783_2480149_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155084945.1|2480902_2481046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211951.1|2481404_2482502_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|2482535_2483786_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_054300202.1|2483925_2484654_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212193.1|2484776_2485115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|2485182_2485569_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|2485565_2485811_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300475.1|2486219_2486948_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
>prophage 24
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	2492214	2586465	3126070	tRNA,integrase,transposase,protease	Escherichia_phage(31.25%)	93	2560991:2561050	2569232:2569519
WP_155084946.1|2492214_2492943_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.2e-42
WP_016211987.1|2493222_2494959_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_144019359.1|2495120_2495318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|2496179_2496908_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_036780855.1|2497411_2497909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212214.1|2497883_2498384_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_075274931.1|2498900_2499629_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211653.1|2499884_2500910_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_016211652.1|2501017_2502223_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211655.1|2502482_2502896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|2503024_2503594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|2503597_2503930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300480.1|2503922_2504762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211047.1|2504849_2506484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|2506845_2507349_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|2507311_2508019_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|2508087_2508948_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_016211045.1|2508928_2509702_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|2509732_2510986_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|2510985_2511948_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|2511991_2512744_+	ComF family protein	NA	NA	NA	NA	NA
WP_155084947.1|2512797_2514678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210615.1|2514825_2515296_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|2515341_2515581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777984.1|2515599_2516049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|2516269_2517694_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_016210618.1|2517758_2518808_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|2519074_2519854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556587.1|2519897_2520800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210625.1|2520858_2521605_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_016210616.1|2521853_2524664_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_081007053.1|2524898_2525759_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_032126362.1|2526114_2526480_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2526425_2527001_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155084948.1|2527071_2527509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211722.1|2527598_2530901_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	1.7e-54
WP_036780093.1|2530910_2531732_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_075274944.1|2532088_2532805_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
WP_129556588.1|2532749_2532917_+	phosphatase	NA	NA	NA	NA	NA
WP_075274943.1|2533107_2533632_-	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_087910645.1|2533917_2535070_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_032127022.1|2535132_2537319_-	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_075274942.1|2537995_2538724_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.1	2.7e-45
WP_016212339.1|2538742_2539489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275114.1|2539641_2540004_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155084949.1|2540033_2540762_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	4.7e-42
WP_016211996.1|2541145_2542093_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211997.1|2542094_2543204_-	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	24.5	4.4e-07
WP_075274940.1|2543559_2544240_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	2.0e-42
WP_087910645.1|2544267_2545421_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274939.1|2545533_2546262_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.8e-42
WP_016212238.1|2546291_2547581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212264.1|2548096_2548690_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	5.4e-28
WP_016212263.1|2548735_2549329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664881.1|2549491_2549698_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300481.1|2549787_2550516_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_155084950.1|2550527_2551472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084951.1|2551521_2552613_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155084952.1|2552577_2553024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084953.1|2553219_2553585_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2553641_2553806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2553795_2554095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155084954.1|2554084_2554765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211323.1|2554938_2556036_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	1.0e-27
WP_016211325.1|2556025_2557546_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	7.3e-85
WP_016211322.1|2557608_2558199_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_054300483.1|2558734_2559289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300484.1|2559785_2560733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212568.1|2560957_2561107_+	hypothetical protein	NA	NA	NA	NA	NA
2560991:2561050	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_016212659.1|2561251_2561497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212291.1|2561584_2561812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212294.1|2562241_2562586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274946.1|2562599_2563043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377879.1|2563264_2563489_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_016212230.1|2563544_2564993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|2566526_2566715_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046946.1|2568116_2568392_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|2568394_2568997_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_155046749.1|2569060_2569348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046945.1|2569898_2570972_+	hypothetical protein	NA	NA	NA	NA	NA
2569232:2569519	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_016211874.1|2571290_2573009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155084955.1|2573609_2574584_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	1.5e-27
WP_155046944.1|2575535_2575673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210068.1|2576859_2577435_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_016210050.1|2577510_2578386_-	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_016210054.1|2578450_2578972_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210069.1|2578956_2580039_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.6e-20
WP_016210051.1|2580279_2580684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210073.1|2581108_2581840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210076.1|2582096_2583398_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210066.1|2583539_2584208_+|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_032126425.1|2584651_2585248_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210052.1|2585268_2586465_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
>prophage 25
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	2614870	2666518	3126070	tRNA,transposase	Microbacterium_phage(11.11%)	56	NA	NA
WP_054300282.1|2614870_2615335_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155084957.1|2615391_2615871_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556590.1|2616728_2617124_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_032126312.1|2617120_2617915_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211756.1|2618093_2618819_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211759.1|2619064_2620252_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_016210935.1|2620828_2621371_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|2621367_2622054_-	acireductone synthase	NA	NA	NA	NA	NA
WP_016210942.1|2622057_2622669_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|2622715_2623735_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|2623836_2624631_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|2624668_2625475_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|2625553_2626603_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|2626800_2628060_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|2628106_2628784_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2628869_2629151_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016210940.1|2629242_2630430_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	6.4e-20
WP_016210820.1|2630666_2631608_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|2632111_2632336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|2632627_2633332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155084958.1|2633781_2634126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|2634755_2635286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779158.1|2635282_2636815_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2636811_2637762_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2638181_2638814_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2639056_2639254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2639603_2640032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155084959.1|2640070_2640808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275036.1|2640785_2641847_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212445.1|2642144_2642411_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155084960.1|2642461_2642935_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155084961.1|2643079_2643535_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	46.5	7.6e-30
WP_032126306.1|2643567_2643864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|2643968_2644613_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2644848_2645346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|2646262_2646718_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2646677_2647016_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036778253.1|2647073_2648612_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_098082804.1|2648723_2649822_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_016210987.1|2650059_2651259_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_016210981.1|2651288_2651927_+	ribonuclease T	NA	NA	NA	NA	NA
WP_155084962.1|2651942_2654126_-	hypothetical protein	NA	A0A1S5XZ05	Kurlavirus	34.9	1.1e-06
WP_032126304.1|2654363_2654708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210984.1|2654721_2655672_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_052104666.1|2655836_2656295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212032.1|2656882_2658010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|2658133_2658796_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|2658887_2659133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084963.1|2660206_2660866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|2660967_2661618_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211964.1|2661730_2662051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2662109_2663084_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126299.1|2663334_2663556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155084964.1|2663578_2664802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212028.1|2665296_2665545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2665632_2666518_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	2727210	2760596	3126070	tRNA,transposase,protease	Stx2-converting_phage(20.0%)	34	NA	NA
WP_054300173.1|2727210_2728272_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2728362_2729109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275004.1|2729233_2730097_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|2730340_2730703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273422.1|2730889_2731417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556595.1|2731561_2731978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|2734060_2734972_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|2735023_2735872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556596.1|2737118_2738087_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|2738074_2738722_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_016210370.1|2738750_2739602_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|2739616_2740894_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|2740934_2741450_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210372.1|2741528_2742590_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|2742611_2743700_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_016210378.1|2743744_2745580_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2745622_2746093_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2746129_2746465_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080664840.1|2746477_2747194_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|2747130_2748147_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|2748143_2748623_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|2748706_2751187_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2751249_2751615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273456.1|2751992_2752292_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2752251_2752707_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2752721_2753012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210570.1|2753077_2754676_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2754806_2755142_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_016210578.1|2755169_2756834_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	7.1e-33
WP_155084967.1|2756830_2757475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210582.1|2757474_2758218_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2758276_2758516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2758666_2760034_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|2760044_2760596_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 27
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	2910907	3037849	3126070	tRNA,transposase	Erwinia_phage(13.33%)	110	NA	NA
WP_075273298.1|2910907_2911483_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2911428_2911794_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155084974.1|2912067_2912727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211161.1|2912834_2913944_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|2913955_2914600_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|2914618_2915605_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|2915684_2916761_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|2916963_2917788_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|2918104_2919109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|2919317_2920283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923708.1|2920421_2921297_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2921593_2922646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211698.1|2922913_2923342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2923555_2924047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2924102_2925353_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2925455_2925674_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_052104629.1|2926116_2927142_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_036777591.1|2927591_2928446_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_016210728.1|2928500_2928971_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2929376_2930756_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2930783_2931242_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_155084975.1|2931219_2932470_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	1.3e-39
WP_017375944.1|2932628_2932865_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2932878_2933034_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2933114_2934077_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2934236_2935553_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2935562_2936231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2936593_2938408_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_129556601.1|2938525_2939302_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155084976.1|2939894_2941646_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016211544.1|2941656_2942457_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.6	5.8e-33
WP_016211545.1|2942559_2943048_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.7	2.4e-29
WP_032126435.1|2943221_2943536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375799.1|2944556_2944901_+	DMT family protein	NA	NA	NA	NA	NA
WP_016210038.1|2950593_2951556_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.0	8.8e-20
WP_016210039.1|2951742_2953002_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|2953225_2953552_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_052104566.1|2953746_2954697_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_032126434.1|2954754_2956821_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_016210049.1|2956826_2957822_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_016210042.1|2958407_2959988_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|2960144_2961554_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_016210047.1|2961613_2962747_-	cation transporter	NA	NA	NA	NA	NA
WP_016210033.1|2962886_2963711_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_016210034.1|2963938_2964568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|2964904_2965276_-	isochorismatase	NA	NA	NA	NA	NA
WP_016210046.1|2965579_2965867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126431.1|2966018_2966867_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_016210037.1|2966994_2968035_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_129556667.1|2968107_2969685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300165.1|2970328_2970988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084977.1|2971142_2972117_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.4e-28
WP_054300164.1|2972192_2973212_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556602.1|2973610_2973820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084978.1|2974694_2975777_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.5	1.7e-141
WP_075274966.1|2975824_2976886_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211201.1|2976966_2977275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211206.1|2977389_2978706_-	MFS transporter	NA	NA	NA	NA	NA
WP_155084979.1|2979167_2980454_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_016211205.1|2980526_2981423_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211203.1|2981509_2982508_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032126430.1|2982616_2983141_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_129556668.1|2983388_2984627_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_016212222.1|2985174_2985648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|2985644_2986040_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_155084980.1|2986969_2987545_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2987490_2987856_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211610.1|2988120_2990451_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_129556603.1|2990571_2992587_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155084981.1|2992770_2996163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|2996227_2996533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274968.1|2996702_2997803_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049897.1|2998050_2999307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209721.1|3000245_3001643_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.3e-77
WP_051307313.1|3001762_3002710_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|3002706_3003222_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|3003208_3004408_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|3004404_3004728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|3004729_3005959_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|3005958_3007002_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|3007001_3007685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3007681_3010171_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3010187_3010442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3010442_3010799_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|3011578_3012742_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155084982.1|3012761_3015869_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_016209723.1|3015870_3017376_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3017403_3017685_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3017833_3018175_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3018294_3020175_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_059372650.1|3020259_3021858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3021875_3022991_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|3023118_3024117_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209700.1|3024120_3024879_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3024880_3026080_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3026063_3026735_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3026756_3027533_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3027536_3028535_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3028536_3029115_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3029111_3030581_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3030624_3030912_-	trp operon repressor	NA	NA	NA	NA	NA
WP_016209699.1|3031112_3031709_+	DMT family transporter	NA	NA	NA	NA	NA
WP_054300152.1|3031735_3032101_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|3032157_3032313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273401.1|3032457_3032910_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300151.1|3032947_3033280_+	DMT family transporter	NA	NA	NA	NA	NA
WP_155047185.1|3034768_3035654_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3035840_3036062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212371.1|3036177_3036810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|3036787_3037849_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039204	Piscirickettsia salmonis strain Psal-182 chromosome, complete genome	3126070	3044704	3093232	3126070	tRNA,transposase	Staphylococcus_phage(33.33%)	51	NA	NA
WP_016211231.1|3044704_3045655_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3045654_3047733_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3047880_3048396_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3048404_3048968_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3048948_3049695_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3049834_3050287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|3050710_3051547_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3051543_3052440_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3052472_3053540_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3053558_3053927_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3053952_3055401_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3055410_3056790_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3056830_3058162_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_155084983.1|3058133_3059090_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	2.2e-10
WP_016210340.1|3059185_3059689_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3059823_3060975_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3060971_3061451_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3061597_3063919_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3063863_3064490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3064494_3065394_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3065466_3066045_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3066345_3066603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081006999.1|3066611_3066983_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.2	3.4e-20
WP_081006998.1|3067187_3067643_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	1.3e-21
WP_032126637.1|3067759_3068053_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_155046758.1|3068901_3069033_+	phosphatase	NA	NA	NA	NA	NA
WP_016212051.1|3069660_3070434_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054300271.1|3071761_3072736_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155049176.1|3073502_3073649_+	phosphatase	NA	NA	NA	NA	NA
WP_016212335.1|3073830_3074169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007065.1|3074185_3075025_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_081007013.1|3075237_3075537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|3075526_3075691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|3075747_3076113_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3077417_3078113_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3078109_3079537_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3079562_3079826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3079898_3080873_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047005.1|3080931_3081782_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|3081819_3082164_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3082160_3082997_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3082997_3083339_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3083340_3083946_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3083942_3085937_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3085956_3086898_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_052104719.1|3087125_3088550_+	MFS transporter	NA	NA	NA	NA	NA
WP_155047187.1|3089062_3090037_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_080743040.1|3090095_3090752_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_032126480.1|3090798_3091482_-	methyltransferase	NA	NA	NA	NA	NA
WP_080664873.1|3092027_3092342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144019150.1|3092251_3093232_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039205	Piscirickettsia salmonis strain Psal-182 plasmid unnamed1, complete sequence	144508	3102	107386	144508	protease,transposase,integrase,head,capsid,tail	Streptococcus_phage(32.65%)	117	74069:74128	105914:106475
WP_054300202.1|3102_3831_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211886.1|4740_5169_+	nucleotidyltransferase substrate-binding, HI0074 family protein	NA	NA	NA	NA	NA
WP_016211884.1|5165_5465_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_129556706.1|5555_6185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211885.1|6198_7239_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_033923686.1|7347_8397_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212150.1|8453_8768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212151.1|8791_9754_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_105962625.1|10355_11242_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.7	4.5e-10
WP_016212121.1|11675_12599_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016212122.1|12552_13254_-	ParA family protein	NA	J9Q7R7	Salmonella_phage	31.8	1.1e-19
WP_129556704.1|14130_14460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155084994.1|14501_15191_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_032126843.1|15494_15674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126844.1|15892_16189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212118.1|16283_16745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155084995.1|17571_18060_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300202.1|18082_18811_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|19181_21758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085009.1|22052_22208_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300202.1|22231_22960_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211936.1|23295_24318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|24430_25159_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046767.1|25311_25473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047048.1|25472_25973_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273747.1|26234_26825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084996.1|26887_28040_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_081377915.1|28294_28852_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	2.9e-47
WP_075274752.1|28887_29187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155084997.1|29183_29690_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	25.5	7.7e-07
WP_032126362.1|29704_30070_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155084998.1|30974_33026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|34701_34902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212579.1|37615_37813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|38124_39099_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016212456.1|39142_39430_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_036779532.1|39426_39828_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_155084999.1|39837_42024_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.0	2.0e-72
WP_016212404.1|42144_42378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275139.1|42992_43223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275140.1|43849_44584_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.1e-38
WP_129556710.1|44737_45208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556709.1|45288_45378_-	DUF1891 domain-containing protein	NA	NA	NA	NA	NA
WP_075275141.1|45589_47275_-	protein kinase	NA	NA	NA	NA	NA
WP_075274745.1|47557_48286_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	1.2e-37
WP_054300271.1|48921_49896_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016212365.1|50104_50347_+	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_036781349.1|50348_50675_+	potassium ABC transporter ATPase	NA	A9D9Y1	Lactobacillus_prophage	36.6	1.1e-11
WP_054300202.1|50790_51519_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212152.1|51988_52372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|52678_53056_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_032126739.1|53220_53553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|53505_53658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085000.1|53741_54323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212019.1|55334_56030_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_016212018.1|56186_56486_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|56482_56728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212017.1|56757_57156_-	hypothetical protein	NA	W8VUR5	Pseudomonas_phage	38.8	2.3e-06
WP_016212014.1|57450_57864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|57961_58690_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_105962623.1|58756_59909_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556707.1|60538_61558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|61668_62397_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_051307371.1|62603_63218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212139.1|63189_63435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212137.1|63510_64572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085001.1|66091_66820_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	8.4e-39
WP_054300202.1|67111_67840_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046765.1|67951_68146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|68882_69611_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126832.1|69721_70630_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_054300202.1|70874_71603_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211938.1|72126_72687_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007042.1|72751_73567_-	hypothetical protein	NA	NA	NA	NA	NA
74069:74128	attL	GTGATCTGGCAACCTTTTTCTAGACAAATTTTTAACTGATTTTTTGATTATGCTCGTATT	NA	NA	NA	NA
WP_105962623.1|74099_75253_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273327.1|75501_76077_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|76022_76388_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275129.1|76487_77549_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	28.0	3.1e-18
WP_052047108.1|77604_78003_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_129556716.1|78136_78427_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
WP_016210655.1|78440_79037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210663.1|79355_79667_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	4.3e-08
WP_016210667.1|79663_79987_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210658.1|79979_80375_+	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210651.1|80371_80722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210664.1|80721_81144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210669.1|81145_81469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|81525_81792_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075273774.1|83993_85151_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|85292_85658_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|85603_86179_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126790.1|86649_87555_+|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
WP_129556697.1|87939_88332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211776.1|88814_90152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211775.1|90319_90688_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_016211773.1|90789_91464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126360.1|92050_92785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211895.1|92907_93966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|94474_95221_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211897.1|95221_95626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|96019_96835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|97439_98168_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212298.1|98609_98936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307374.1|99176_99653_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_032126637.1|99767_100061_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_081377916.1|100177_100702_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.4	2.5e-29
WP_155085002.1|100933_101209_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.6	1.0e-13
WP_155085003.1|101217_101919_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_016211912.1|102008_102599_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
WP_032126795.1|102871_103132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|103135_103408_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_016211913.1|103733_104855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085004.1|105287_105548_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126637.1|105568_105862_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_081377915.1|105944_106502_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	2.9e-47
105914:106475	attR	GTGATCTGGCAACCTTTTTCTAGACAAATTTTTAACTGATTTTTTGATTATGCTCGTATTCCTCAGGTGATAAATAATCATTAGCTGAGTGAATGCGTTTTCTGTTATAAAAAACTTCGATATACTCAAAGATCGCTGATTTAGCCTCCTGTCGATTTTTAAAATTCATGTGATGAACTAACTCCGTTTTTAAGGTATGAAAGAAACTCTCTGAAACAGCGTTATCCCAGCAGTCTCCCTTACGACTCATACTTTGCTTAATTTGATGATCTTTAAGAATCTCACGATGACTTTCTGAAGCATATTGGCTTCCGCGATCTGAATGCCAAATTAACCCAGCTTTAGGCTTTCGTTTCCATAAGGCCATCAACAGAGCATCATTGACGAGTGATGCTTCCATATGATCCTCCATGGCCCAGCCAACAACTTTTCGTGAGAATAAGTCAATCACAACAGCCAAGTACAACCAGCCTTGTTGGGTCCGTATGTAGGTAATATCACCAACATATTTTTGGTTAGGGCCTGTTGCTGAAAAATTCCGGTCCAACACGTTTTTTGCAAT	NA	NA	NA	NA
WP_081377914.1|106646_106976_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155085005.1|107092_107386_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039206	Piscirickettsia salmonis strain Psal-182 plasmid unnamed2, complete sequence	53285	3915	46714	53285	transposase,head,tail,capsid	Streptococcus_phage(14.29%)	60	NA	NA
WP_054300271.1|3915_4890_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155085011.1|5100_5430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242955.1|5654_5915_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211078.1|5907_6261_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_080664851.1|6355_7165_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211068.1|7161_7974_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211075.1|7977_9219_-	MFS transporter	NA	NA	NA	NA	NA
WP_155047030.1|9433_9577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211069.1|9601_10033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085012.1|10016_10802_+	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_016211077.1|10809_11595_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211067.1|11727_12471_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211079.1|12680_12986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780299.1|13140_13443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211080.1|13481_14468_+	helix-turn-helix domain-containing protein	NA	A0A0S2MVA0	Bacillus_phage	45.4	4.3e-14
WP_155085020.1|14508_15045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210959.1|15013_15376_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.9e-24
WP_016210966.1|15368_15716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210963.1|15712_15952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085013.1|16047_16335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794070.1|16331_16616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210960.1|16617_17091_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	63.4	4.9e-32
WP_129556726.1|17205_17598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210972.1|17745_17973_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210974.1|17981_18389_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_129556725.1|18505_19186_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	39.3	3.3e-37
WP_016210977.1|19364_19658_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_155047026.1|19875_20058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046773.1|20202_20382_-	phosphatase	NA	NA	NA	NA	NA
WP_129556723.1|20476_20794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126134.1|21094_21478_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	5.6e-26
WP_155085014.1|21565_22018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|22054_22783_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_129556745.1|22927_23206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|23249_24224_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_032126136.1|24277_24823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212186.1|24879_25110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212188.1|25287_26028_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_032126137.1|26091_27141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126138.1|27906_28170_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_016211928.1|28720_29161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211925.1|29153_29939_-	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	28.7	9.7e-17
WP_032126737.1|32686_33415_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155085015.1|33455_33608_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_032126737.1|33703_34432_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155085016.1|34495_35002_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	47.9	1.5e-34
WP_155085017.1|35122_36457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211137.1|36647_36959_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_155085018.1|36955_37279_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	3.0e-12
WP_016211139.1|37271_37667_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211129.1|37663_38014_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211141.1|38013_38436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126913.1|38437_38761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|38817_39084_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_155085019.1|39087_41166_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	33.0	2.5e-56
WP_036776958.1|41158_41500_+|tail	phage minor tail family protein	tail	NA	NA	NA	NA
WP_016210666.1|41496_42168_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|42136_42883_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_054300696.1|42872_43430_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_075275194.1|43426_46714_+	host specificity protein J	NA	A0A0R6PIC0	Moraxella_phage	33.2	5.2e-112
