The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	45576	89169	3142986	transposase	Moraxella_phage(20.0%)	43	NA	NA
WP_075273371.1|45576_46152_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46097_46463_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036776493.1|46661_47423_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_036779326.1|47724_49251_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49622_50462_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50501_51809_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51783_52953_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|53007_53733_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54011_54401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54588_55494_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55541_55685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047031.1|55732_56329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|56563_57717_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_016210704.1|58611_60558_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|61212_64275_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|64271_65336_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|65691_66645_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|66676_67840_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|67845_68445_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|68632_69133_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|69150_70239_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|70377_71622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|71618_72461_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_036777711.1|72440_73250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|73417_73645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|73645_74596_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|74651_75203_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|75329_75752_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|75744_76491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|76533_77232_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|77242_78067_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|78396_78765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|78759_79821_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|79870_80101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|80230_81445_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|81745_82807_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_036777695.1|82820_84548_+	oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_016211245.1|84581_85313_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|85312_86101_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211251.1|86205_86829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|87148_87361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047032.1|87516_88578_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047033.1|88572_89169_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	127259	181534	3142986	transposase	Staphylococcus_phage(42.86%)	58	NA	NA
WP_054300271.1|127259_128234_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209611.1|128482_128674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047035.1|128753_128933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209580.1|129024_129549_+	ankyrin repeat family protein	NA	NA	NA	NA	NA
WP_016209612.1|129932_130301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209595.1|130338_130611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300576.1|130701_131997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211692.1|132632_133535_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.4	1.6e-18
WP_051307362.1|133591_134443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211694.1|135022_137032_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	3.0e-110
WP_054300271.1|137069_138044_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|138545_139958_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|140450_141458_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|141477_142998_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_016211018.1|143948_145265_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|145368_145752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|145886_148952_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|149020_150124_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|150147_150702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|150816_151386_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211020.1|151505_152261_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_155047036.1|152427_153327_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047037.1|153471_153777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082829.1|154171_154567_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|154588_154954_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|155010_155175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|155164_155464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300544.1|155554_156001_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|156496_157063_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|157074_157860_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|158491_159415_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|159466_160462_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|160493_160988_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_036778333.1|161079_161337_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|161426_161849_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|162167_162884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|162927_163179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778330.1|163183_164620_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|164647_166090_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|166177_166516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|166600_167131_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|167191_169384_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|169426_169912_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|170181_170613_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036778324.1|170630_171461_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|171475_171619_-	lipoprotein	NA	NA	NA	NA	NA
WP_052104672.1|171649_172534_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|172505_172727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|172900_173179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|174149_175055_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_036780891.1|175111_176290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|176286_176862_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155053570.1|176960_177173_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300541.1|177500_178280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126848.1|178813_179614_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_052104671.1|179832_180591_+	ion transporter	NA	NA	NA	NA	NA
WP_016211859.1|180667_180955_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_075273327.1|180958_181534_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	200550	271547	3142986	transposase,tail,protease,tRNA	Acinetobacter_phage(25.0%)	58	NA	NA
WP_016209871.1|200550_202533_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|202742_204086_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|204352_207022_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|207045_208965_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|209134_210556_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|210701_211676_+	phospholipase A	NA	NA	NA	NA	NA
WP_054300537.1|211707_212115_+	glyoxalase	NA	NA	NA	NA	NA
WP_016209859.1|212393_212615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|212778_214440_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|214512_214803_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_036776911.1|215028_215484_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|215548_216013_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|216105_217452_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|217451_218357_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|218418_219405_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|219397_219640_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|219761_221306_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_036776914.1|221352_222639_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|222681_224076_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|224099_224279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|224275_224455_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_054300181.1|224458_224740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|224796_225162_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210079.1|228167_228665_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|228835_229531_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|229633_231196_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|231511_233305_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|233390_233663_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|233668_234295_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|234281_235712_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|236044_237100_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|237068_237746_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|237735_238572_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|238731_239025_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_122940784.1|239131_239938_-	trfA family protein	NA	NA	NA	NA	NA
WP_016210083.1|240242_241097_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_036776920.1|241251_242301_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_036776924.1|242351_243008_-	DedA family protein	NA	NA	NA	NA	NA
WP_016210097.1|243025_244306_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_016210096.1|244579_245941_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_032126863.1|246340_246892_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_016211802.1|252323_253595_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_036778206.1|253651_254635_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_016211800.1|254631_255417_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_032126362.1|256113_256479_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|256424_257000_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300535.1|257003_257723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|257867_258068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|258115_258577_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|259000_260482_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|260544_261654_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|261751_263713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|264242_264647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047045.1|264699_265395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|265371_266346_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_098082809.1|266516_266867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|267809_268892_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_129556499.1|270394_271547_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
>prophage 4
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	300496	360356	3142986	transposase	Bodo_saltans_virus(20.0%)	57	NA	NA
WP_054300526.1|300496_300793_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962174.1|300941_301106_-	phosphatase	NA	NA	NA	NA	NA
WP_016211026.1|301204_301609_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075273367.1|301901_302678_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_155047049.1|302686_304768_+	protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	4.0e-17
WP_016211031.1|304932_305412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211032.1|305721_306519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211033.1|306630_307923_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_032126377.1|308088_309090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211034.1|309206_309386_+	rubredoxin	NA	NA	NA	NA	NA
WP_016211023.1|309396_309831_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_016211029.1|310044_310407_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.6e-25
WP_016212102.1|310580_312221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|313731_314884_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556441.1|318312_319539_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126490.1|319887_320853_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_016210868.1|320849_321149_+	pilZ domain protein	NA	NA	NA	NA	NA
WP_036778898.1|321180_321960_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_016210861.1|321985_322216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|322367_322613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210870.1|322764_323556_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016212128.1|324469_325216_+	solute symporter family protein	NA	NA	NA	NA	NA
WP_032126495.1|325306_326191_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_054300397.1|326596_326842_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046705.1|327082_327250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|327195_327771_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047050.1|327823_328561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777815.1|328564_328849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210128.1|328942_329206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|329572_330391_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|330463_332836_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_036777812.1|333548_334976_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|335010_336033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|336049_336427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|337389_337755_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|337700_338276_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210122.1|338515_339208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|339834_340809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|340798_342571_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|342571_342919_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_036777821.1|343168_344395_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|344484_345783_-	MFS transporter	NA	NA	NA	NA	NA
WP_081007061.1|345816_346566_-	queuosine precursor transporter	NA	A0A1W7AG82	Streptococcus_virus	30.4	3.9e-15
WP_016210137.1|346546_347098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007060.1|347324_348623_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|348739_349030_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_155047051.1|349341_350211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047052.1|350355_351084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777801.1|351946_352165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212044.1|352938_353193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|353915_354902_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|355039_355234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007059.1|355916_356978_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_016211797.1|357139_358543_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|358593_359169_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|359114_359429_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047053.1|359469_360356_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	444588	545060	3142986	transposase,tRNA,integrase	Escherichia_phage(43.75%)	108	511375:511434	525586:525759
WP_054300513.1|444588_445452_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|445668_447228_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|447249_448284_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|448332_448902_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|449037_450009_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|450020_451598_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|451663_452650_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_054300512.1|452981_454091_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|454196_455381_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|455458_457447_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|457655_457811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047055.1|458081_458369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|458406_458772_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|458717_459293_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047056.1|459282_459645_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|460561_461968_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|461985_462972_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|462974_464129_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|464125_464821_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|464955_466446_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_036777447.1|466466_467516_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|467582_468977_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_036777444.1|469855_471787_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.6	1.0e-120
WP_075273353.1|471791_472322_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|472356_472551_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|472593_472953_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|473372_474368_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_036777440.1|474380_476762_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|476767_477055_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|477326_477803_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|477947_478145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|478269_479244_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|480144_480243_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780545.1|480727_481438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047057.1|481601_482018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300575.1|482254_482947_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|482988_483762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|483763_484705_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|484837_486415_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|486624_488382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|488930_489689_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|489896_490469_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|490572_491121_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|491422_491668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|491696_491993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779353.1|492260_493172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300506.1|493662_494070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|494141_494870_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_032126799.1|494950_495763_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_155047058.1|496824_497187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|497189_498929_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046941.1|499330_499594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300500.1|500265_500994_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_016212070.1|501403_502003_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_016212069.1|501977_502145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212066.1|502356_503133_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_054300501.1|503493_504222_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|504233_504626_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|504622_504868_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017375910.1|505028_505757_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211714.1|505831_509176_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|510424_511000_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|510945_511311_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
511375:511434	attL	ATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATAATCTCACCGGAATAATGCT	NA	NA	NA	NA
WP_155047059.1|511589_512504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212159.1|512771_512969_+	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_054300201.1|513328_514057_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_155047060.1|514086_514761_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	45.9	5.2e-27
WP_016212024.1|514905_515154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780881.1|515150_515750_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212022.1|515749_515968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212023.1|516742_517735_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_075273432.1|517731_518466_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_155047061.1|518726_518993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047062.1|519137_519296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047063.1|519318_519570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300477.1|520019_520748_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_051307368.1|521454_522735_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_016211918.1|522734_523703_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211646.1|524074_524314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211642.1|524306_524660_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_017375910.1|524962_525691_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155047064.1|526160_526469_-	hypothetical protein	NA	NA	NA	NA	NA
525586:525759	attR	ATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATAATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTTTTACCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCC	NA	NA	NA	NA
WP_155047065.1|526630_527308_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.1	7.0e-40
WP_155047066.1|527801_528530_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.5e-43
WP_016212269.1|528698_529382_+	Fic family protein	NA	NA	NA	NA	NA
WP_016212268.1|529385_529970_+	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_017375910.1|530126_530855_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155047064.1|531323_531632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556455.1|531882_532485_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054300203.1|532489_532948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781052.1|534324_534927_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211639.1|535306_535609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211644.1|535723_535990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104773.1|536097_536541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|536602_537488_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047067.1|537588_538482_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047259.1|538626_538842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104771.1|539291_539630_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	54.9	5.4e-25
WP_075274739.1|539622_539970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274717.1|539966_540197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274718.1|540200_540671_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	64.3	1.3e-32
WP_075274740.1|540815_541181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780395.1|541325_541580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377363.1|541563_541920_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_075274719.1|542225_543092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047068.1|543577_543778_+	HNH endonuclease	NA	A0A2H4PHY5	Pseudomonas_phage	64.3	3.5e-16
WP_155047069.1|543865_544219_+	hypothetical protein	NA	Q6DMU4	Streptococcus_phage	34.8	8.2e-08
WP_054300202.1|544331_545060_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
>prophage 6
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	552759	600712	3142986	transposase,tRNA	Synechococcus_phage(33.33%)	51	NA	NA
WP_054300202.1|552759_553488_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211663.1|553581_554247_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211661.1|554311_555268_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_032126810.1|555526_556225_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211662.1|556267_557380_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_075273327.1|557984_558560_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|558505_558871_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212580.1|558958_559309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|560044_561106_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210908.1|562317_563133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126716.1|563223_564207_+	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210913.1|564377_564899_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_036779246.1|564932_565187_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.4e-20
WP_155053577.1|565189_566467_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_051307343.1|567159_567687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210906.1|567806_570119_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_032126715.1|570247_571063_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210915.1|571260_571725_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|571854_572916_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211491.1|573176_573473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211493.1|573755_575219_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211489.1|575221_576274_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_036779281.1|576263_576719_+	arginine repressor	NA	NA	NA	NA	NA
WP_155047071.1|576743_577067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|577414_577726_-	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_054300208.1|577855_578647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779278.1|579804_580758_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016212075.1|580871_581069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126198.1|581314_581515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142396463.1|581625_581742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212074.1|581828_582050_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|582076_582442_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|582498_582663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047072.1|582652_582967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046713.1|583104_583269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126195.1|583563_585000_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016210532.1|585041_586493_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016210537.1|586604_586892_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|587081_588125_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210536.1|588140_589040_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210528.1|589036_589555_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210527.1|589624_590242_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_036776217.1|590251_591739_+	ribonuclease G	NA	NA	NA	NA	NA
WP_016210534.1|591748_595429_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_036776215.1|595502_596315_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210530.1|596311_596992_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_155047260.1|597832_597991_-	phosphatase	NA	NA	NA	NA	NA
WP_155047073.1|598183_598741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|598790_599081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300215.1|599884_600379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007066.1|600373_600712_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	622182	724778	3142986	tRNA,transposase,protease,plate	Prochlorococcus_phage(17.65%)	108	NA	NA
WP_016209523.1|622182_623532_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209510.1|623582_624020_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209501.1|624281_625793_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_036778935.1|625798_627025_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|627018_628047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|628024_628717_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_155049805.1|628718_630191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778941.1|630183_630672_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_051307310.1|630677_632150_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032126187.1|632149_632548_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016209524.1|632544_634233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209506.1|634214_635171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|635213_635729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|635833_636766_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209534.1|636985_637372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209530.1|637388_638033_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209504.1|638213_639053_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_016209502.1|639128_639731_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209512.1|639731_640586_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209537.1|640942_641254_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209519.1|641278_642670_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|642825_643557_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_129556465.1|643553_644126_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|644112_644670_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_016209498.1|644675_645656_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209539.1|645795_646596_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_036780687.1|646599_647367_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209535.1|647363_647828_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_016209507.1|647850_648504_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209517.1|648507_648855_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209505.1|648888_649140_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|649216_650485_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209527.1|650487_651246_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209508.1|651307_652198_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|652248_652932_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_075273445.1|653017_653275_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155047218.1|653547_655716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210408.1|655707_656580_-	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_016210409.1|656747_658577_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210411.1|658739_659381_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_075273448.1|659622_660153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|660170_660344_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_016210402.1|660402_661452_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210405.1|661458_662409_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210406.1|662462_663407_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210415.1|663434_664172_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|664260_664503_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|664577_665801_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210400.1|665832_666681_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210401.1|666677_667730_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_032126181.1|667850_668471_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_036780649.1|668486_669473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|669583_670039_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|669998_670337_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|671101_672007_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155047217.1|672081_673143_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212599.1|673192_673402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|674636_675083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|675086_675662_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|675607_675973_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126651.1|676093_676279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209899.1|676382_677417_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|677413_678124_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209923.1|678598_679117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209901.1|679234_679567_-	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_036777003.1|679596_682551_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_054300221.1|682596_683094_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209922.1|683153_683570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209915.1|683661_684522_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126652.1|684604_685171_+	chorismate lyase	NA	NA	NA	NA	NA
WP_016209918.1|685203_686058_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_155047216.1|686099_689006_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|689066_689264_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209903.1|689270_690281_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209910.1|690277_691336_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_032126655.1|691329_692130_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209913.1|692132_692951_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209907.1|692962_693910_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_032126654.1|693917_695219_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209919.1|695397_696501_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_016209906.1|696497_696890_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209924.1|696901_698278_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209900.1|698271_699741_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_032126362.1|700198_700564_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|700509_701085_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300223.1|701179_702151_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	1.3e-34
WP_129556478.1|702387_703274_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|703573_703819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300225.1|704781_705201_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046954.1|705307_705481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126800.1|705707_706442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|706566_707628_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940948.1|707950_708655_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210599.1|708748_709462_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016210601.1|709544_710636_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210603.1|710707_711289_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210606.1|711294_711921_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_155053578.1|712017_712953_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_129556471.1|713312_713984_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_036778813.1|714125_714785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210607.1|714953_716213_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210611.1|716209_717295_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210605.1|717287_718169_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210612.1|718157_719408_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_054300237.1|720693_721755_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047215.1|721732_722986_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_032126362.1|723891_724257_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|724202_724778_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	760195	808120	3142986	transposase,tRNA	Staphylococcus_phage(42.86%)	37	NA	NA
WP_016209374.1|760195_761647_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209368.1|761682_763212_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_155047212.1|763787_765431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047211.1|765972_766914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209384.1|767264_768080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209395.1|768371_771062_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_081007011.1|771310_772531_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|772698_774405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209398.1|775003_776230_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|776782_777757_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273456.1|777879_778179_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047210.1|778138_778501_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962625.1|778562_779448_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047266.1|780556_780988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|781703_782069_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|782014_782590_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300237.1|782616_783678_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556478.1|783792_784679_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047209.1|785028_785583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211819.1|785801_786032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|786328_786829_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211818.1|787031_788288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777316.1|788644_789058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273460.1|789367_790252_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300240.1|790508_790712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|791011_791986_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047208.1|792288_793761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|793780_794755_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210742.1|794905_795181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|795346_795967_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_054300241.1|796285_798262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210739.1|798417_799875_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210743.1|799943_801524_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_054300242.1|801564_802101_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210746.1|802146_806043_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210741.1|806049_806373_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_054300237.1|807058_808120_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	824801	933585	3142986	transposase,protease,integrase	Staphylococcus_phage(26.67%)	102	887266:887325	908460:909562
WP_033923708.1|824801_825677_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211687.1|825932_826577_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211685.1|826607_828413_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|828436_829012_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_155047207.1|829556_830630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|830739_831714_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046989.1|831946_833011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|833103_834078_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046989.1|834310_835375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|835865_836231_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047206.1|836245_836755_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|836790_837765_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300250.1|837847_838507_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_016209640.1|838925_839945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209649.1|840403_841369_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209646.1|841413_841989_-	VOC family protein	NA	NA	NA	NA	NA
WP_016209651.1|842019_843294_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126159.1|843939_844653_+	aldolase	NA	NA	NA	NA	NA
WP_016209641.1|844732_845470_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016209658.1|845590_846946_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_075273478.1|847122_847794_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209661.1|847909_848785_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_016209645.1|849388_850693_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|850805_851411_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|851492_852794_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_032126161.1|852861_855294_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209655.1|855397_855670_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075273480.1|855752_857651_+	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_016209643.1|857682_858567_+	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_016209657.1|858575_858971_-	CrcB family protein	NA	NA	NA	NA	NA
WP_016209662.1|859398_861546_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209652.1|861517_862867_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209642.1|862863_864984_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209656.1|864980_866684_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209654.1|866802_867945_-	galactokinase	NA	NA	NA	NA	NA
WP_016209659.1|868009_869038_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_036776625.1|869164_870679_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_059372266.1|870768_871254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275067.1|871586_872654_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|873716_874622_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_051307360.1|874738_875668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780074.1|876759_877566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|877908_879801_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_032126157.1|880087_880492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923634.1|880696_881245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|881234_882121_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212436.1|882459_882870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047205.1|883044_883266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|883753_884119_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|884064_884640_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080664862.1|885813_886512_+	P-loop NTPase	NA	NA	NA	NA	NA
WP_016211528.1|886492_886798_+	hypothetical protein	NA	NA	NA	NA	NA
887266:887325	attL	CGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACT	NA	NA	NA	NA
WP_054300271.1|887357_888332_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300253.1|888550_889501_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	34.7	6.9e-09
WP_016211534.1|889487_889997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211530.1|890002_890899_-	Abi family protein	NA	A3QSC6	Clostridium_virus	32.0	5.3e-35
WP_016211531.1|891252_891933_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155047204.1|891996_892554_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0V4T7	Roseobacter_phage	33.3	8.4e-15
WP_054300271.1|892577_893552_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212424.1|893895_894174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|894166_894439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|894556_895639_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036780532.1|895716_896757_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_081007067.1|897268_902743_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_016212302.1|902963_903263_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_155047203.1|903563_904625_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036781361.1|904644_905034_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_155047202.1|905316_906381_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.2	4.7e-139
WP_016211579.1|906885_907371_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211583.1|907438_908347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|908551_909526_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211584.1|909698_910052_+	hypothetical protein	NA	NA	NA	NA	NA
908460:909562	attR	CGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTCTCTAGTTCGCCTTTTGACTTAGAGGGTAGAGATGGTTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGGTTATCAGAGGGAGACTCGCTCAGATCAATTGCTAGAGCACTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
WP_016211586.1|910118_910313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211578.1|910328_910673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|910742_911318_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|911263_911629_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155049808.1|911713_912322_+	DNA polymerase	NA	NA	NA	NA	NA
WP_052047108.1|912406_912805_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046984.1|913616_914735_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046716.1|915156_915303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|916000_916555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|916991_917174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376905.1|917238_917466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556629.1|917696_918443_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_026063577.1|918669_918963_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556482.1|919034_919640_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_016210545.1|919788_920766_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_155047199.1|920862_922305_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210553.1|922331_922985_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_036779374.1|923109_923676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307331.1|924030_925809_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_052104721.1|925880_927587_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.7	7.3e-25
WP_054300262.1|927578_927869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|928331_928697_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|928642_929218_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212461.1|929221_929596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|929971_930946_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_054300263.1|931017_931458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047198.1|931445_931613_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300265.1|931757_932018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|931977_932316_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962625.1|932699_933585_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	954127	999250	3142986	transposase,tRNA	Escherichia_phage(16.67%)	44	NA	NA
WP_054300173.1|954127_955189_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211781.1|955405_956653_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036779112.1|956875_958312_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_129556486.1|958397_958745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273492.1|958835_958955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|959063_960125_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007012.1|960119_960290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|960279_960444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|960500_960866_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300269.1|960887_961256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047196.1|961400_961982_-	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_017375910.1|962052_962781_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016210898.1|963037_963388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|963476_963767_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210894.1|964241_964544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300270.1|964884_965862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556487.1|965940_967278_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210903.1|967396_967768_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_016210904.1|967989_968640_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210896.1|968682_969765_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210899.1|969818_971702_+	APC family permease	NA	NA	NA	NA	NA
WP_033923708.1|972311_973187_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155047195.1|973199_974102_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211091.1|974176_976657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273494.1|977721_978282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|978872_979934_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275207.1|979981_980431_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211036.1|980778_982650_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_036779409.1|982741_984487_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211043.1|984566_985016_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211035.1|985068_985284_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211042.1|985530_986547_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211037.1|986595_987225_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211040.1|987575_988787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126170.1|989014_989287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047067.1|989450_990344_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556557.1|990488_990800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104774.1|990847_991480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047009.1|991624_991798_-	phosphatase	NA	NA	NA	NA	NA
WP_016211450.1|992573_993596_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211448.1|993694_994903_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211446.1|994892_996620_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_036776407.1|996803_997940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|998188_999250_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	1011758	1066647	3142986	tRNA,transposase,protease	Orpheovirus(16.67%)	56	NA	NA
WP_129556478.1|1011758_1012645_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211932.1|1013055_1014345_-	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_036777061.1|1014540_1015728_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211476.1|1016045_1016255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211473.1|1016238_1016838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211474.1|1016912_1018262_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_032126518.1|1018344_1020546_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211478.1|1020562_1021378_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126519.1|1021357_1022077_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_075273327.1|1022244_1022820_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1022765_1023131_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211265.1|1023305_1023968_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|1023998_1024367_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_032126514.1|1024377_1025694_-	MFS transporter	NA	NA	NA	NA	NA
WP_051307354.1|1025976_1026552_+	DedA family protein	NA	NA	NA	NA	NA
WP_032126515.1|1026627_1026807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|1026979_1027273_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_075273504.1|1027462_1027816_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211262.1|1027870_1030144_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_016211259.1|1030203_1030449_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_054300275.1|1030573_1031449_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211550.1|1031526_1032288_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_016211548.1|1032271_1033228_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211549.1|1033490_1035995_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211553.1|1035998_1036739_+	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_054300209.1|1037078_1037444_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1037500_1037665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1037654_1037954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126933.1|1037957_1039259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1039427_1040402_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209411.1|1040607_1041402_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_016209421.1|1041564_1042353_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_036776605.1|1042349_1043561_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_032126508.1|1043550_1043910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209444.1|1044004_1044433_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_129556555.1|1044563_1045694_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209436.1|1045690_1046419_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_016209412.1|1046476_1047364_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209433.1|1047448_1047823_+	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209424.1|1047922_1049200_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
WP_080664816.1|1049211_1049943_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_129556554.1|1049914_1051180_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_016209427.1|1051273_1052677_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_016209408.1|1052830_1053001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209406.1|1053315_1054137_+	ParA family protein	NA	Q8JL10	Natrialba_phage	32.2	5.0e-16
WP_016209405.1|1054133_1055027_+	cheW-like domain protein	NA	NA	NA	NA	NA
WP_016209443.1|1055072_1055594_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_036776598.1|1055668_1056154_+	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_155047194.1|1056442_1057201_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_016209404.1|1057190_1058054_-	chemotaxis phosphatase CheX family protein	NA	NA	NA	NA	NA
WP_016209435.1|1058080_1058452_-	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.1e-05
WP_016209445.1|1058552_1059509_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_054300277.1|1059991_1062673_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_016209439.1|1062753_1063380_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_129556553.1|1063543_1065136_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_016209434.1|1065225_1066647_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	1081685	1210901	3142986	protease,transposase,tRNA	Staphylococcus_phage(21.43%)	103	NA	NA
WP_016209432.1|1081685_1083395_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016209448.1|1083652_1084984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209449.1|1085425_1086898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|1087613_1087979_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273508.1|1088219_1089086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273512.1|1089598_1089943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776562.1|1090095_1090287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1090530_1091106_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1091051_1091417_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300283.1|1091657_1092299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1092766_1093741_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047193.1|1094954_1096343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780476.1|1096578_1098516_-	histidine kinase	NA	NA	NA	NA	NA
WP_016210517.1|1099529_1100249_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_032126504.1|1100362_1103902_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_016210525.1|1103968_1104787_+	ZipA protein	NA	NA	NA	NA	NA
WP_016210518.1|1104773_1106813_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.8	3.0e-126
WP_016210522.1|1106828_1107881_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_016210524.1|1107891_1108422_+	exsB family protein	NA	NA	NA	NA	NA
WP_016210010.1|1110059_1110236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780418.1|1110411_1110795_+	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_075273518.1|1110870_1111164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155053573.1|1111330_1112302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210020.1|1113020_1113176_+	putative membrane protein	NA	NA	NA	NA	NA
WP_016210025.1|1113440_1114811_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_052104723.1|1114803_1115757_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036779556.1|1115737_1118542_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.0	3.1e-57
WP_016210027.1|1118621_1119218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|1119607_1120363_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155047191.1|1120760_1121492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210021.1|1121752_1123078_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210023.1|1123074_1125132_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210007.1|1125109_1125682_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126616.1|1125737_1126097_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210019.1|1126161_1127196_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_122941592.1|1127453_1128305_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|1128399_1129383_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_016210013.1|1129539_1131207_+	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
WP_155047190.1|1132145_1132463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556556.1|1132481_1133057_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1133002_1133368_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300287.1|1133389_1133719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047175.1|1134127_1135450_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_032126362.1|1135980_1136346_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1136291_1136867_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047189.1|1136926_1137100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047265.1|1137389_1137983_+	reverse transcriptase	NA	A0A0N7AE80	Bacillus_phage	28.9	4.0e-07
WP_105962623.1|1137991_1139145_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_081007015.1|1139637_1140063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1140274_1140532_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|1140531_1141539_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300292.1|1141793_1142795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007069.1|1143250_1143403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007016.1|1143375_1143549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047188.1|1143538_1143703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300293.1|1143759_1144125_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300294.1|1144396_1145458_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211279.1|1146201_1148670_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_016211277.1|1148683_1149652_+	homoserine kinase	NA	NA	NA	NA	NA
WP_016211278.1|1149638_1150898_+	threonine synthase	NA	NA	NA	NA	NA
WP_129556646.1|1150949_1152335_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_036781047.1|1153652_1154510_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_036778145.1|1155122_1156244_+	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	8.7e-11
WP_016211172.1|1156293_1157490_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_080664856.1|1157678_1158743_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_051307350.1|1158726_1159473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778066.1|1159462_1160191_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211168.1|1160187_1160847_+	wbqC-like family protein	NA	NA	NA	NA	NA
WP_155046736.1|1160824_1161778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|1161777_1162293_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778065.1|1162335_1163769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210393.1|1163862_1166064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210398.1|1166552_1168145_+	B-type flagellin	NA	NA	NA	NA	NA
WP_032126669.1|1168369_1169947_+	B-type flagellin	NA	NA	NA	NA	NA
WP_122940572.1|1170058_1170484_+	flaG family protein	NA	NA	NA	NA	NA
WP_016210394.1|1170594_1171980_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_032126670.1|1172005_1172443_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210390.1|1172447_1172789_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_016210399.1|1172803_1174795_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210388.1|1174820_1175495_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210397.1|1175491_1177666_-	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_016210772.1|1178874_1180428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|1180511_1181321_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_033923762.1|1181448_1181682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210769.1|1181982_1183485_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_016210773.1|1183788_1186482_+	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210771.1|1186478_1189880_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_054300162.1|1189971_1191054_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300297.1|1191116_1192184_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212246.1|1193119_1193776_+	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300162.1|1193879_1194962_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300271.1|1195301_1196276_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212247.1|1196903_1197659_-	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_036779544.1|1198025_1199033_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1199032_1199290_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047187.1|1199653_1200628_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_075273524.1|1200668_1201634_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212058.1|1201789_1203340_+	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_054300299.1|1205541_1206624_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049810.1|1206710_1206890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1207888_1208752_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155047186.1|1208781_1210011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047185.1|1210014_1210901_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	1251573	1550295	3142986	transposase,tRNA,integrase	Staphylococcus_phage(13.95%)	268	1283827:1283886	1359916:1360279
WP_054300304.1|1251573_1251852_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047180.1|1251904_1252108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776195.1|1252750_1253998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923708.1|1254409_1255285_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211947.1|1255399_1256545_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_129556540.1|1256537_1256933_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211946.1|1257151_1257907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212551.1|1259262_1259757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556643.1|1260214_1261579_-	histidine kinase	NA	NA	NA	NA	NA
WP_016211983.1|1261674_1262334_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_155047179.1|1262581_1262926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047178.1|1262994_1263723_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.5e-43
WP_155047177.1|1263769_1263916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300189.1|1263972_1264338_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036779232.1|1264632_1266192_-	APC family permease	NA	NA	NA	NA	NA
WP_016211215.1|1266552_1268523_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211211.1|1268714_1269794_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_052104715.1|1269842_1270049_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211210.1|1270055_1271537_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016211214.1|1271639_1272203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|1273964_1275224_+	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211940.1|1275344_1275677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1275790_1276765_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_155047176.1|1276909_1277062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300312.1|1277279_1278302_+	YHYH protein	NA	NA	NA	NA	NA
WP_036778055.1|1278309_1279992_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.7e-32
WP_016211344.1|1280152_1280971_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211347.1|1281184_1282168_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211340.1|1282160_1282382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211346.1|1282409_1283051_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_033923708.1|1283294_1284170_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
1283827:1283886	attL	TACCTGAAATTGCTCAAGGTCTGACAGGTAAGATTATTGGTGATAAAGGTTACATTTCAC	NA	NA	NA	NA
WP_129556490.1|1286632_1287518_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1287522_1287810_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_036774554.1|1287862_1288141_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126998.1|1288239_1288587_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_032126997.1|1288908_1289148_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075273532.1|1289365_1289953_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300314.1|1289913_1290249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211315.1|1290436_1291081_-	porin family protein	NA	NA	NA	NA	NA
WP_016211316.1|1291415_1292066_-	porin family protein	NA	NA	NA	NA	NA
WP_016211319.1|1292598_1293651_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032126786.1|1293668_1296749_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_054300384.1|1297047_1297863_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047175.1|1298271_1299594_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_155047174.1|1300502_1301147_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.4	1.1e-39
WP_155047173.1|1301202_1301412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209615.1|1302764_1303271_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_016209623.1|1303287_1304787_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016209624.1|1304808_1305420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209622.1|1305425_1306589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777073.1|1306620_1309158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209626.1|1309189_1311082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273639.1|1311449_1312166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777070.1|1312168_1315042_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_016209636.1|1315042_1315447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209614.1|1315461_1317183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209633.1|1317182_1320131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209625.1|1320133_1321531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209630.1|1321544_1322285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209632.1|1322265_1322700_+	lipoprotein	NA	NA	NA	NA	NA
WP_016209618.1|1322744_1323374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209616.1|1323444_1324359_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_033923701.1|1324389_1327692_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_016209627.1|1327688_1329512_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_016209617.1|1329551_1329950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209621.1|1330070_1331075_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209619.1|1331507_1332956_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_036777066.1|1333042_1336099_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_081007073.1|1336081_1336252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046976.1|1336317_1336455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212485.1|1336751_1337285_-	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_032126753.1|1338081_1338546_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_016211466.1|1338615_1340136_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126752.1|1340223_1340826_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211464.1|1340822_1341170_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_016211465.1|1341320_1342304_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_122942160.1|1342931_1343912_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_052047087.1|1344072_1344291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047172.1|1344462_1345488_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300320.1|1346633_1347233_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300321.1|1347450_1347822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212346.1|1348616_1348763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1348996_1349860_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211748.1|1351341_1352946_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211752.1|1352961_1354107_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_075273313.1|1354183_1354522_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1354481_1354937_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212445.1|1355182_1355449_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155047171.1|1355523_1356087_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	39.9	3.2e-30
WP_155047170.1|1356291_1356573_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047169.1|1356607_1357216_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016212534.1|1357628_1357895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1359022_1359388_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1359333_1359909_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047168.1|1360418_1361339_+	hypothetical protein	NA	NA	NA	NA	NA
1359916:1360279	attR	TACCTGAAATTGCTCAAGGTCTGACAGGTAAGATTATTGGTGATAAAGGTTACATTTCACAAGATTTATTTAACAGGCTTTATGAAAAAGGACTGCAATTAATCAATAAAATTCGCAAGAATATGAAAAATAGGCTCATGCCTATCATCGATAAAATTTTACTCAGAAAACGTGGAATTATTGAAAGTGTATTTGATCAACTTAAAAACATCTCACAAATCGAGCACTCTAGGCATCGTAGTGTCAACAACTTTATGGTCAATATTCTTGCTGGATTAGCAGCCTACTGTCTTCAGGAGAAGAAGCCATCGCTTAATATCCAGCGTAATCTATTGACCAGCTGAGTTATATCGAACTCACGTTA	NA	NA	NA	NA
WP_054300322.1|1361377_1363312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211726.1|1363699_1364293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273534.1|1365924_1366806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300325.1|1366999_1367272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300326.1|1367373_1367838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046975.1|1368251_1368701_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_016212459.1|1368820_1369201_+	glycine-zipper containing OmpA-like membrane domain protein	NA	NA	NA	NA	NA
WP_054300328.1|1369338_1370115_-	class I SAM-dependent methyltransferase	NA	R4ZD91	Adoxophyes_honmai_entomopoxvirus	25.5	8.1e-16
WP_155047167.1|1370225_1371743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047166.1|1371792_1372854_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211456.1|1373475_1374054_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_122942091.1|1374081_1374477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211455.1|1374582_1376040_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_016211452.1|1376101_1377589_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211454.1|1378339_1378810_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|1380684_1380957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1381109_1381475_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1381420_1381996_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556641.1|1384078_1385341_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_016210751.1|1385428_1387234_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_016210752.1|1387717_1388515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210749.1|1388684_1389146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1389444_1391400_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1392081_1392267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212185.1|1392600_1393590_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016211834.1|1396963_1397278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307365.1|1397535_1397796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211836.1|1397815_1398304_+	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_155046972.1|1399827_1400418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047040.1|1401006_1401945_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155047165.1|1401970_1403536_-	amino acid permease	NA	NA	NA	NA	NA
WP_036778182.1|1403742_1404570_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_075273540.1|1404936_1405548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556527.1|1405732_1405993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047164.1|1406985_1407408_+	response regulator	NA	NA	NA	NA	NA
WP_036777256.1|1407830_1408031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104738.1|1408405_1409212_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210795.1|1409317_1410289_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210801.1|1410270_1411242_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155047264.1|1411564_1411924_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_054300271.1|1411963_1412938_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007028.1|1413353_1413809_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1413768_1414107_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211352.1|1414280_1414721_-	universal stress protein	NA	NA	NA	NA	NA
WP_032126362.1|1415187_1415553_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1415498_1416074_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211350.1|1416358_1417297_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211349.1|1417360_1419355_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_032127067.1|1419351_1419954_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_036779888.1|1419950_1420289_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_129556640.1|1420364_1421591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1422830_1423406_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1423351_1423717_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211856.1|1424294_1424480_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_016211855.1|1424606_1425074_+	bacterioferritin	NA	NA	NA	NA	NA
WP_016211857.1|1425070_1425949_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_032126602.1|1426199_1427507_+	MFS transporter	NA	NA	NA	NA	NA
WP_081007028.1|1427659_1428115_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1428074_1428413_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211741.1|1430472_1431249_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126783.1|1431394_1432636_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_155049812.1|1432746_1433292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046970.1|1433369_1433618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211177.1|1435042_1436263_-	amino acid permease	NA	NA	NA	NA	NA
WP_036776658.1|1436648_1438643_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_081007029.1|1438755_1439364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126449.1|1439430_1440354_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016211180.1|1440374_1440839_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_016211178.1|1440901_1441930_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_032126448.1|1442020_1442401_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_036776661.1|1442432_1442762_+	DUF4404 family protein	NA	NA	NA	NA	NA
WP_075273543.1|1443746_1443989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1444028_1445003_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047162.1|1445022_1445460_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|1445474_1445840_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210855.1|1445993_1446971_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016210849.1|1447088_1448537_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210847.1|1448565_1449570_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210851.1|1449592_1450264_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210850.1|1450248_1451502_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1451750_1452305_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210848.1|1452888_1454073_+	MFS transporter	NA	NA	NA	NA	NA
WP_051307341.1|1454239_1455838_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_155047161.1|1456531_1457503_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300343.1|1457538_1457766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|1457769_1458656_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007031.1|1458743_1459016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209794.1|1459750_1460374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776664.1|1460419_1462363_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1U9WQS3	Geobacillus_phage	23.9	1.1e-05
WP_016209788.1|1462484_1463237_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016209790.1|1463288_1463747_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_129556639.1|1464042_1464453_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209775.1|1464469_1464925_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_016209797.1|1464921_1465413_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_080664822.1|1465409_1466159_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_016209776.1|1466188_1466458_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_036776670.1|1466473_1467259_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_016209786.1|1467272_1468406_+	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_016209770.1|1468440_1470534_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_016209767.1|1470564_1472025_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_129556524.1|1472005_1472893_+	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_016209784.1|1472889_1473612_+	RNA polymerase sigma factor FliA	NA	A0A1B1P7V3	Bacillus_phage	24.1	2.7e-05
WP_017377132.1|1473698_1474082_+	response regulator	NA	NA	NA	NA	NA
WP_036776675.1|1474123_1474867_+	chemotaxis protein CheZ	NA	NA	NA	NA	NA
WP_036776682.1|1474879_1476904_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_051307317.1|1476965_1477259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209791.1|1477395_1478118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209771.1|1478282_1479005_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126436.1|1479711_1480167_+	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_016209793.1|1480182_1481631_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_016209795.1|1481671_1482427_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	1.3e-10
WP_080664823.1|1482407_1483808_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_016209796.1|1483831_1485049_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.0	2.9e-92
WP_016209778.1|1485079_1485454_+	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_016209772.1|1485472_1486024_+	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_054300271.1|1487305_1488280_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1488377_1489439_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1489993_1490968_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212424.1|1491311_1491590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|1491582_1491855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1491972_1493055_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300346.1|1493201_1494077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126678.1|1494087_1495098_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_016211554.1|1495424_1496051_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_016211557.1|1496096_1497326_+	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_032126677.1|1497520_1498084_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211555.1|1498158_1499517_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_016211664.1|1500053_1500782_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211666.1|1501154_1503974_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211669.1|1504128_1504479_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1505303_1506278_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556522.1|1507588_1508821_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211405.1|1509027_1510800_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_016211403.1|1510935_1511979_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_036777261.1|1511992_1512736_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_155047160.1|1512870_1513170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|1513774_1514473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047159.1|1514894_1516286_+	protein kinase	NA	NA	NA	NA	NA
WP_016211733.1|1516341_1517166_-	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_054300173.1|1517780_1518842_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046730.1|1519060_1519201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1519468_1520116_-	LysE family translocator	NA	NA	NA	NA	NA
WP_016212267.1|1520396_1520756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|1520922_1521378_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1521337_1521676_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047158.1|1521811_1524085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126823.1|1524073_1524796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104609.1|1524906_1525539_+	MarC family protein	NA	NA	NA	NA	NA
WP_098082850.1|1525574_1525751_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_016211481.1|1525825_1526968_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_155049129.1|1527046_1527184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126825.1|1527200_1528514_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.5e-51
WP_054300349.1|1529065_1530790_+	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	25.6	1.7e-05
WP_155046942.1|1531850_1532736_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046942.1|1532900_1533786_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556521.1|1534320_1534509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1534459_1535613_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047157.1|1535677_1536082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047156.1|1536253_1536877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211631.1|1537135_1537942_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_054300351.1|1538197_1539019_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211632.1|1539054_1539909_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_081007023.1|1540604_1541261_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1541344_1541710_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300181.1|1541766_1542048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|1542051_1542231_+	DDE endonuclease	NA	NA	NA	NA	NA
WP_016210103.1|1542583_1543942_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_016210117.1|1544223_1544583_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210111.1|1545003_1546638_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_017377579.1|1546644_1547481_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210099.1|1547502_1548780_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_016210105.1|1548863_1549184_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210106.1|1549203_1550295_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
>prophage 14
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	1568693	1612647	3142986	transposase,protease,integrase	Staphylococcus_phage(45.45%)	48	1568598:1568657	1595410:1595498
1568598:1568657	attL	GGTAACCCTCCCTTAAAATAGTACAAGTGATAAGTGGAATCTTCTGTTAAATTAACTTAG	NA	NA	NA	NA
WP_054300353.1|1568693_1568921_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300354.1|1569067_1569586_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	42.9	1.3e-30
WP_155047155.1|1569531_1569681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1569724_1570699_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047154.1|1570771_1571152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1571112_1571478_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1571423_1571999_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300355.1|1571988_1572174_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211563.1|1572384_1572546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211564.1|1572578_1573454_-	ParA family protein	NA	NA	NA	NA	NA
WP_052104693.1|1573619_1577486_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_080728343.1|1577567_1577708_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_081007034.1|1577689_1577974_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_155047153.1|1578238_1579657_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_016211991.1|1580565_1581471_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126537.1|1581711_1581897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211994.1|1581933_1582470_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_155047152.1|1582672_1583395_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1583434_1584409_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047151.1|1584405_1584945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047150.1|1584994_1586221_+	DUF4131 domain-containing protein	NA	NA	NA	NA	NA
WP_155047149.1|1586215_1586431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|1586454_1587429_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016212012.1|1587472_1588150_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016212013.1|1588165_1588549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212011.1|1588770_1589892_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_054300357.1|1590125_1591001_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211974.1|1591283_1592405_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075273551.1|1592504_1592807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556638.1|1592806_1593487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377865.1|1594831_1595116_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664876.1|1595474_1597337_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
1595410:1595498	attR	CTAAGTTAATTTAACAGAAGATTCCACTTATCACTTGTACTATTTTAAGGGAGGGTTACCGATGGTTATTTCACTAGATGAATTTTATT	NA	NA	NA	NA
WP_054300359.1|1597561_1598134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047148.1|1598492_1599530_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047147.1|1600059_1601034_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_054300361.1|1601187_1601484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377353.1|1601461_1602127_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1602166_1603141_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211144.1|1603697_1604327_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_036779218.1|1604310_1604733_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211145.1|1604739_1606479_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211153.1|1606479_1607544_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1607547_1607901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1608013_1608970_+	ferrochelatase	NA	NA	NA	NA	NA
WP_016211151.1|1608979_1609291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1609306_1609876_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211148.1|1610139_1611468_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|1611672_1612647_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 15
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	1621535	1668939	3142986	transposase,integrase,tRNA	Staphylococcus_phage(25.0%)	42	1611582:1611641	1654407:1655508
1611582:1611641	attL	GCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTC	NA	NA	NA	NA
WP_129556637.1|1621535_1622315_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016212589.1|1622789_1623227_-	MFS transporter	NA	NA	NA	NA	NA
WP_155047262.1|1623615_1623732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300363.1|1624123_1624471_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047145.1|1624416_1624992_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273553.1|1624981_1625908_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300364.1|1626081_1626960_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126267.1|1627379_1627622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211330.1|1627969_1629070_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_098082827.1|1629244_1630546_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.9	4.1e-28
WP_052104656.1|1630622_1631126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126265.1|1631449_1632367_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016211336.1|1632432_1633047_-	chorismate mutase	NA	NA	NA	NA	NA
WP_016211334.1|1633095_1633284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210322.1|1633901_1634798_+	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016210320.1|1634934_1636008_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_054300366.1|1636157_1636571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300568.1|1636591_1637302_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.3	4.1e-38
WP_129556511.1|1637484_1638921_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210321.1|1639117_1640086_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_016210325.1|1642756_1644133_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210326.1|1644286_1645585_-	ankyrin repeats family protein	NA	NA	NA	NA	NA
WP_036778577.1|1645924_1647208_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_016210333.1|1647281_1647911_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_016210330.1|1648114_1648498_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210332.1|1648595_1649339_+	ribonuclease T2 family protein	NA	NA	NA	NA	NA
WP_075273555.1|1649469_1650003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212498.1|1650280_1650964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|1651717_1652692_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_155047144.1|1652727_1654053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1654497_1655472_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211804.1|1655854_1657240_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
1654407:1655508	attR	GCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTCTCTAGTTCGCCTTTTGACTTAGAGGGTAGAGATGGTTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGGTTATCAGAGGGAGACTCGCTCAGATCAATTGCTAGAGCACTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
WP_081007037.1|1657246_1658785_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211806.1|1658827_1659553_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_032126804.1|1659717_1660593_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032126790.1|1660752_1661658_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_032126803.1|1661891_1663124_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_016211764.1|1663324_1664146_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211767.1|1664984_1665794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211289.1|1667410_1667683_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211286.1|1667794_1668142_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_036777656.1|1668159_1668939_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 16
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	1695000	1739058	3142986	tRNA,transposase,protease	Staphylococcus_phage(22.22%)	39	NA	NA
WP_054300173.1|1695000_1696062_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046721.1|1696242_1696410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1696581_1697556_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300373.1|1697552_1698410_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209842.1|1699137_1699527_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209834.1|1699703_1700462_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209829.1|1700458_1702858_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209839.1|1704237_1705536_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209838.1|1705733_1706627_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209836.1|1706626_1707841_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_032126639.1|1707860_1709147_-	GTPase HflX	NA	NA	NA	NA	NA
WP_016209846.1|1709162_1709417_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_036777393.1|1709652_1711020_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209826.1|1711350_1712373_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_016209845.1|1712895_1714371_+	APC family permease	NA	NA	NA	NA	NA
WP_054300271.1|1714610_1715585_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556633.1|1715693_1716590_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209827.1|1716908_1718468_+	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_075273569.1|1718543_1718750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209831.1|1718957_1719656_+	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209832.1|1719934_1720198_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_036777412.1|1720504_1723099_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209835.1|1723095_1723578_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209844.1|1723555_1724596_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209840.1|1724768_1725254_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_032126641.1|1725361_1727932_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_032126642.1|1727967_1728429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047141.1|1728498_1728705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211648.1|1729908_1730448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211650.1|1731395_1732880_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211651.1|1733004_1734540_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032126362.1|1734773_1735139_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047140.1|1735084_1735669_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047139.1|1735692_1736097_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047138.1|1736072_1736555_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728346.1|1736572_1736905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046723.1|1737812_1737968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210928.1|1738126_1738432_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_075273327.1|1738482_1739058_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	1760478	1816004	3142986	transposase,tRNA	Staphylococcus_phage(15.38%)	55	NA	NA
WP_075273298.1|1760478_1761054_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046962.1|1761057_1761504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|1762155_1762656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|1763071_1763425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211831.1|1763725_1765453_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_081007040.1|1765590_1766247_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016210510.1|1766277_1767006_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_016210506.1|1766998_1768237_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210512.1|1768372_1769410_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210515.1|1769463_1770366_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210514.1|1770474_1771728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|1771785_1775283_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_075273576.1|1775342_1776071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778516.1|1776198_1776747_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016210508.1|1777067_1778765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1778773_1779927_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_036781272.1|1780522_1780741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047136.1|1780833_1781265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|1781432_1781798_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047135.1|1781743_1782319_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211467.1|1782393_1782960_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_032126344.1|1782962_1784051_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032126343.1|1784171_1784984_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_054300379.1|1785114_1787100_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211470.1|1787159_1787813_-	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_155047134.1|1788579_1789602_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047133.1|1789873_1790848_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	2.6e-27
WP_016212421.1|1791598_1791781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377879.1|1792132_1792357_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155047132.1|1792501_1793164_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.6	5.3e-32
WP_032126637.1|1793280_1793574_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556508.1|1793635_1794079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047131.1|1794349_1795006_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047130.1|1795193_1795952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1796014_1797076_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211841.1|1797935_1798388_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211839.1|1798505_1799978_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211840.1|1800136_1800601_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211838.1|1801071_1801245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1801954_1802320_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1802265_1802841_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300250.1|1802830_1803490_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_032126143.1|1803589_1804861_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_016211422.1|1804949_1805420_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_051307357.1|1805442_1806036_-	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211417.1|1806172_1807222_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_016211415.1|1807245_1808169_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1808185_1808647_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211414.1|1808754_1809573_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_129556449.1|1809788_1810295_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1810309_1810675_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047129.1|1810878_1811535_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300382.1|1811805_1812228_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300383.1|1812498_1814979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126139.1|1815074_1816004_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 18
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	1822769	1881686	3142986	transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(33.33%)	57	NA	NA
WP_054300162.1|1822769_1823852_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212040.1|1824057_1825407_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_016212039.1|1825583_1826141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133287.1|1826329_1826728_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047128.1|1826783_1828151_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.6e-12
WP_155047127.1|1828559_1829375_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212251.1|1829536_1830073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046960.1|1830234_1830888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047126.1|1831007_1831499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126789.1|1831770_1831953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1832302_1833580_-	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_080664858.1|1833576_1833714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211223.1|1834225_1835827_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211221.1|1835843_1836986_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211218.1|1837238_1837976_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211224.1|1838000_1839272_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_032126790.1|1839500_1840406_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_054300387.1|1840664_1843064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300388.1|1843111_1844794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209976.1|1845663_1845897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007074.1|1846130_1846718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209969.1|1846684_1847650_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_016209951.1|1847640_1848051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209957.1|1848057_1848393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556634.1|1848393_1848936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209950.1|1849240_1850032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209973.1|1850068_1853173_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_016209965.1|1853202_1854000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209956.1|1854004_1856995_-	ATPase AAA	NA	NA	NA	NA	NA
WP_036776383.1|1857000_1857432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209972.1|1857482_1858049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036776381.1|1858048_1859092_-	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_016209954.1|1859097_1859622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209953.1|1859643_1861950_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_016209962.1|1861996_1862236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209958.1|1862237_1863365_-	type II/IV secretion system family protein	NA	NA	NA	NA	NA
WP_016209964.1|1863364_1864117_-	dotC-like type IV secretion system protein	NA	NA	NA	NA	NA
WP_051307320.1|1864109_1864616_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_016209959.1|1864640_1865048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556635.1|1865075_1866083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209971.1|1866141_1867047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209955.1|1867053_1868247_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_155047125.1|1868243_1869170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211310.1|1870144_1870858_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SEW9	Cyanophage	39.1	2.2e-39
WP_016211308.1|1870933_1871212_-	lipoprotein	NA	NA	NA	NA	NA
WP_032126213.1|1871256_1872147_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_016211307.1|1872231_1872705_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_016211313.1|1872840_1873362_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_016211309.1|1873402_1874197_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_016211305.1|1874199_1874481_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155047124.1|1874477_1875455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211312.1|1876160_1876907_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|1877028_1878090_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780082.1|1878633_1879539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212000.1|1879669_1880398_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016212002.1|1880517_1880796_+	DNA-J related family protein	NA	NA	NA	NA	NA
WP_129556478.1|1880799_1881686_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	1892477	1947910	3142986	transposase,tRNA	uncultured_Mediterranean_phage(30.77%)	47	NA	NA
WP_081007041.1|1892477_1893005_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107517381.1|1893670_1893865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1894078_1894432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211827.1|1894763_1895384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211823.1|1895424_1895613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047122.1|1895647_1899739_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211770.1|1899938_1901072_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_016211771.1|1901085_1901274_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_054300276.1|1901566_1902541_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_075273594.1|1902580_1903951_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	4.2e-39
WP_054300404.1|1904023_1904917_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209948.1|1905025_1905943_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_036777569.1|1905994_1906750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209939.1|1906817_1908092_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_036777566.1|1908226_1908904_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_016209944.1|1909104_1910532_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209938.1|1910506_1911145_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209925.1|1911354_1911633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209935.1|1911866_1912811_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_036777561.1|1912832_1914701_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209930.1|1914721_1915075_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_036777579.1|1915113_1916229_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.9	4.8e-94
WP_016209932.1|1916411_1917452_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209945.1|1917454_1918489_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209926.1|1918485_1919547_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209931.1|1919658_1921131_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_052104625.1|1921283_1921727_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209940.1|1921802_1924574_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_036777555.1|1924730_1925960_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1925986_1926649_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_054300405.1|1927170_1927671_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047121.1|1927772_1928876_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	9.5e-10
WP_075274669.1|1929080_1929383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300286.1|1929767_1930232_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105962623.1|1930395_1931548_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047120.1|1931557_1931902_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047119.1|1932186_1933509_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_081007042.1|1933917_1934733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300406.1|1937286_1940022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1940322_1941384_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126856.1|1941444_1941786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1942090_1943244_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_155049815.1|1943426_1943579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1943878_1944244_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1944189_1944765_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212005.1|1945103_1946864_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_016210592.1|1947253_1947910_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
>prophage 20
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	1952458	2066179	3142986	transposase,tRNA	Staphylococcus_phage(17.65%)	107	NA	NA
WP_032126176.1|1952458_1953241_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210588.1|1953331_1954657_-	fimV domain protein	NA	NA	NA	NA	NA
WP_016210595.1|1955024_1956203_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210594.1|1956379_1957033_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_036778626.1|1957168_1959109_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_129556498.1|1959105_1959714_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054300271.1|1959893_1960868_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080728317.1|1961058_1964424_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211391.1|1964490_1965066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779996.1|1965077_1966634_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_036779999.1|1966653_1967085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780001.1|1967071_1967335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372269.1|1967691_1968063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212466.1|1968267_1968993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212252.1|1969307_1969466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047118.1|1969503_1970946_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_075273327.1|1970935_1971511_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1971456_1971822_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274672.1|1971859_1972453_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211114.1|1972818_1975749_-	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_016211115.1|1975881_1977834_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211112.1|1978026_1978674_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211113.1|1978729_1980055_+	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_032126179.1|1980084_1980336_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_080664854.1|1980293_1980875_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_054300408.1|1981211_1981868_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_032126362.1|1981918_1982284_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1982229_1982805_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209823.1|1984026_1984470_-	response regulator	NA	NA	NA	NA	NA
WP_016209809.1|1984894_1985383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209817.1|1985489_1986458_+	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_155047117.1|1987159_1990459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209810.1|1992048_1993962_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	6.9e-117
WP_016209822.1|1994018_1994666_-	methyltransferase domain protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_036777933.1|1994801_1995926_-	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_016209800.1|1995922_1996519_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_016209821.1|1996549_1996882_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016209812.1|1996971_1998795_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	9.7e-44
WP_036777937.1|1999241_2000954_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	4.3e-25
WP_016209815.1|2001271_2001811_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_016209799.1|2002197_2002614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209818.1|2002709_2003525_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_016209805.1|2003657_2005151_+	neurotransmitter symporter family protein	NA	NA	NA	NA	NA
WP_032126324.1|2005329_2005752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209801.1|2005751_2007806_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016209813.1|2008090_2008906_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_036778458.1|2009006_2009825_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_016209808.1|2009821_2010190_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_016209806.1|2010532_2010682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212343.1|2011494_2012301_+	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_129556499.1|2012539_2013693_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211588.1|2013860_2014562_-	cyclase family protein	NA	NA	NA	NA	NA
WP_032126329.1|2014637_2015267_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_129556496.1|2015452_2016691_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_036778365.1|2016965_2017628_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_016211589.1|2017617_2018850_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_129556495.1|2018972_2019230_+	VOC family protein	NA	NA	NA	NA	NA
WP_032126637.1|2020210_2020504_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_032126540.1|2020734_2021598_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046995.1|2021731_2022617_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126332.1|2023264_2024464_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_016211366.1|2024716_2025004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779263.1|2025059_2027069_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_032126330.1|2027411_2028371_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_016211367.1|2028518_2029301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273303.1|2029456_2030173_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_016210281.1|2030186_2031578_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_016210270.1|2031619_2034607_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210277.1|2034676_2035510_-	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210279.1|2035563_2036730_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210272.1|2036717_2037428_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210283.1|2037467_2038253_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_129556492.1|2038280_2039024_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|2039121_2041317_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_016210271.1|2041393_2042077_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_032126334.1|2042087_2042519_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_036778186.1|2042558_2042957_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_016210273.1|2043329_2044037_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210275.1|2044101_2044404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210276.1|2044459_2044936_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210284.1|2044990_2045512_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210280.1|2045593_2046688_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_075273327.1|2047099_2047675_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2047620_2047986_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047116.1|2047946_2048198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300415.1|2048787_2049489_+	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	33.0	1.6e-07
WP_032126500.1|2049622_2050339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211118.1|2050475_2051723_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126499.1|2052101_2052713_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211122.1|2052809_2053676_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|2053679_2054441_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_036779309.1|2054604_2055510_+	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211125.1|2055732_2056563_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211126.1|2056732_2057122_+	lipoprotein	NA	NA	NA	NA	NA
WP_032126498.1|2057254_2057815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|2057876_2058242_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2058256_2058763_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047115.1|2058759_2059164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212585.1|2059458_2059779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2059890_2060865_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273327.1|2061234_2061810_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2061755_2062121_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274673.1|2062081_2063080_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780900.1|2063250_2063904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047081.1|2063954_2064392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212519.1|2064662_2065043_-	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_054300173.1|2065117_2066179_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	2083932	2126567	3142986	transposase	Staphylococcus_phage(25.0%)	44	NA	NA
WP_129556490.1|2083932_2084818_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047111.1|2084822_2086151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047110.1|2086267_2087329_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126869.1|2087306_2087546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2088066_2088642_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2088587_2088953_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047109.1|2089014_2089428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556488.1|2090608_2091459_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275079.1|2091607_2092669_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126801.1|2092716_2093226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274679.1|2093894_2094956_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212218.1|2096407_2096758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285943.1|2096902_2097739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778728.1|2097792_2099085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104686.1|2099320_2102077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046955.1|2103232_2103412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|2103653_2104355_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|2104615_2104822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941967.1|2105051_2105357_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126840.1|2105535_2107533_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2107516_2108563_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016212098.1|2109283_2110135_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016212100.1|2110135_2111056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212654.1|2111466_2111751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|2111742_2112198_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2112157_2112496_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212093.1|2112708_2113638_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_129556559.1|2113794_2114223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047107.1|2114303_2114756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2114781_2115687_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|2115883_2116492_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155047106.1|2116532_2117419_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556499.1|2117615_2118768_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211971.1|2118974_2119586_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032126649.1|2119606_2120803_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_017377024.1|2120899_2121040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211968.1|2121052_2121457_-	SufE family protein	NA	NA	NA	NA	NA
WP_075273313.1|2121582_2121921_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300431.1|2121880_2122183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|2122327_2122513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|2123082_2123664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300573.1|2123691_2124825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211960.1|2125088_2125616_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_081007045.1|2125937_2126567_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	2148272	2201278	3142986	transposase,protease,tRNA	Leptospira_phage(16.67%)	56	NA	NA
WP_016209884.1|2148272_2148896_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036777115.1|2148972_2149173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209891.1|2149314_2150013_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016209896.1|2150159_2150729_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_122940402.1|2151043_2151667_-	porin family protein	NA	NA	NA	NA	NA
WP_032126745.1|2151875_2152478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2152549_2153435_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|2153658_2154545_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273603.1|2154624_2154801_+	phosphatase	NA	NA	NA	NA	NA
WP_129556565.1|2154924_2155320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047105.1|2155628_2156510_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.1	3.4e-50
WP_016212445.1|2156752_2157019_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126686.1|2157077_2157662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274681.1|2158212_2159088_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063519.1|2159136_2159553_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210465.1|2159839_2160682_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_016210463.1|2160732_2161080_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210471.1|2161270_2162158_+	ROK family protein	NA	NA	NA	NA	NA
WP_016210467.1|2162272_2162875_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210468.1|2162871_2163591_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_052104601.1|2163659_2165372_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_036777098.1|2165519_2167457_+	AsmA family protein	NA	NA	NA	NA	NA
WP_032126596.1|2167565_2168618_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_016210461.1|2168617_2168893_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016210458.1|2168973_2169522_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_051307322.1|2169795_2169975_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_155047104.1|2169978_2170260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2170316_2170682_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047103.1|2170797_2171919_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_155049817.1|2172713_2173600_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036780722.1|2173661_2174636_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_016210459.1|2174800_2175319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047101.1|2175523_2176642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211720.1|2176889_2177813_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211716.1|2177826_2178750_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036778439.1|2178697_2179354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211719.1|2179656_2180484_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_155047100.1|2180924_2181284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047099.1|2181428_2181584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126590.1|2181776_2183309_+	nuclease	NA	NA	NA	NA	NA
WP_032126591.1|2183371_2184709_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_016210313.1|2184851_2186318_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210314.1|2186314_2187364_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_036778435.1|2187487_2189602_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210305.1|2189766_2190171_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|2190231_2190957_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210307.1|2191042_2191933_+	YicC family protein	NA	NA	NA	NA	NA
WP_032126592.1|2191973_2192594_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.3	2.5e-20
WP_016210310.1|2192654_2192861_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_016210316.1|2192882_2195036_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.1e-12
WP_054300439.1|2195042_2197025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780594.1|2197296_2197779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2197782_2198358_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2198303_2198669_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036780787.1|2198867_2199827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2200195_2201278_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
>prophage 23
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	2205201	2250252	3142986	transposase	Staphylococcus_phage(50.0%)	51	NA	NA
WP_054300443.1|2205201_2205480_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|2205532_2205781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300444.1|2205738_2206800_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212179.1|2207220_2207373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212177.1|2207795_2207969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212174.1|2208045_2208303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781320.1|2210521_2210749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|2210735_2211062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|2211063_2211495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2212023_2213085_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300445.1|2213179_2213731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|2214000_2215020_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|2215006_2215429_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|2215430_2215904_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_052133275.1|2216019_2216643_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210836.1|2216672_2217347_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|2217352_2218501_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|2218497_2218959_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210830.1|2219034_2220285_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_016210824.1|2220411_2222091_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|2222200_2223067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2223969_2224944_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_036781250.1|2225039_2225825_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307345.1|2225968_2226655_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211002.1|2226688_2227087_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|2227250_2227556_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_016210998.1|2227633_2227888_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|2228041_2229703_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|2229762_2230446_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|2230445_2231534_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016211004.1|2231582_2234219_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300173.1|2234631_2235693_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300448.1|2235882_2238252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2238295_2239270_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300449.1|2239289_2240069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|2240198_2240537_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2240496_2240952_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211507.1|2241277_2242597_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|2242600_2243317_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211506.1|2243313_2243955_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_081007048.1|2243947_2244046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2244386_2244752_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2244697_2245273_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047096.1|2245304_2245577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047095.1|2245633_2245774_+	phosphatase	NA	NA	NA	NA	NA
WP_155047094.1|2245918_2246386_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211503.1|2246536_2246992_-	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_016211508.1|2247046_2247391_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211502.1|2247420_2248464_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_129556569.1|2249166_2249376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2249365_2250252_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	2320440	2382783	3142986	transposase,tRNA	Planktothrix_phage(18.18%)	57	NA	NA
WP_129556571.1|2320440_2321151_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2321179_2321584_+	RidA family protein	NA	NA	NA	NA	NA
WP_036777168.1|2321608_2322568_-	response regulator	NA	NA	NA	NA	NA
WP_016209567.1|2322699_2323317_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126712.1|2323751_2324210_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209553.1|2324954_2325965_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	42.2	2.9e-58
WP_016209566.1|2326449_2327361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209545.1|2327686_2331181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209551.1|2331218_2332058_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.0	1.8e-45
WP_036777155.1|2332244_2332460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209547.1|2332508_2333084_-	ribonuclease HI	NA	V9M0C8	Vibrio_phage	46.6	1.3e-29
WP_016209540.1|2333080_2333419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209568.1|2333587_2334577_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.7	1.7e-18
WP_016209572.1|2334577_2335540_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-16
WP_054300271.1|2336495_2337470_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212612.1|2337607_2337841_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300455.1|2337934_2338300_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2338314_2338821_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212572.1|2338878_2339271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2339400_2339766_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300461.1|2339822_2340131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2340222_2340798_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2340743_2341109_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|2341261_2341534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126774.1|2342142_2342478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307356.1|2342637_2344170_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_016211407.1|2344202_2345042_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211411.1|2345038_2345536_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_036779082.1|2345539_2346532_-	AAA family ATPase	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_155047091.1|2346646_2347993_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_054300173.1|2348216_2349278_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212287.1|2349356_2350502_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_016211372.1|2356309_2357167_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016211371.1|2357153_2358077_-	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_036778204.1|2358273_2359665_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211369.1|2359711_2360755_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211370.1|2360797_2361241_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211374.1|2361373_2362564_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211373.1|2362618_2362765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|2363315_2364233_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_036794860.1|2364500_2364794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|2364870_2365065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300462.1|2366083_2367001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210876.1|2367466_2368309_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016210873.1|2368376_2369027_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210874.1|2369041_2370082_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210882.1|2370204_2371290_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210872.1|2371316_2372426_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210871.1|2372442_2372760_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210879.1|2372756_2373116_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_054300463.1|2373218_2375948_-	kinase	NA	NA	NA	NA	NA
WP_080664847.1|2376448_2377402_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_054300173.1|2377474_2378536_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212048.1|2379299_2379857_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_032126664.1|2380050_2380734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126663.1|2381452_2381695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|2381721_2382783_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	2472676	2555387	3142986	transposase,tRNA	Escherichia_phage(37.93%)	82	NA	NA
WP_054300202.1|2472676_2473405_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019244.1|2473494_2474106_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_036779399.1|2474462_2474717_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|2474815_2476600_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_036779389.1|2476688_2477408_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210951.1|2477590_2477797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779393.1|2477796_2478033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|2478045_2478423_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|2478929_2479748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779396.1|2479841_2480039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210946.1|2480133_2481519_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210945.1|2481645_2482236_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_155047083.1|2484427_2485156_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	4.3e-43
WP_016211816.1|2486224_2486578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|2486619_2488233_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_075274932.1|2488454_2488676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2488984_2489713_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211951.1|2490329_2491427_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|2491460_2492711_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_054300202.1|2492850_2493579_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212193.1|2493701_2494040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|2494107_2494494_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|2494490_2494736_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300475.1|2495144_2495873_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016211625.1|2496356_2497226_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_036779883.1|2497222_2498572_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.2	2.1e-75
WP_016211623.1|2498684_2500325_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_054300202.1|2501139_2501868_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300478.1|2502147_2503884_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_155047082.1|2504045_2504225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300477.1|2504387_2505116_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016212214.1|2505274_2505775_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016212213.1|2505749_2506259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2507012_2507741_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300479.1|2507891_2508932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211653.1|2509129_2510155_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_016211652.1|2510262_2511468_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211655.1|2511727_2512141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|2512269_2512839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|2512842_2513175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300480.1|2513167_2514007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047081.1|2514094_2515642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|2516091_2516595_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|2516557_2517265_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|2517333_2518194_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_036777969.1|2518174_2518948_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|2518978_2520232_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|2520231_2521194_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|2521237_2521990_+	ComF family protein	NA	NA	NA	NA	NA
WP_036777977.1|2522043_2523924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210615.1|2524071_2524542_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|2524587_2524827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777984.1|2524845_2525295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|2525515_2526940_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_016210618.1|2527004_2528054_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|2528320_2529100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556587.1|2529151_2530054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047080.1|2530112_2530859_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	4.4e-19
WP_016210616.1|2531107_2533918_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_081007053.1|2534152_2535013_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_155047079.1|2535855_2536098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|2536252_2537405_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047078.1|2537591_2537927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2538019_2538319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2538308_2538473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047077.1|2538704_2539857_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	4.4e-58
WP_155047076.1|2539866_2540142_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212641.1|2540337_2540784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049820.1|2540748_2541204_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273369.1|2541312_2542128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047075.1|2542201_2543122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|2543133_2543862_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_080664881.1|2543951_2544158_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081007054.1|2544320_2545553_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	1.1e-27
WP_054300482.1|2546068_2547358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049821.1|2548516_2548705_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047219.1|2548751_2549480_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032127022.1|2550156_2552343_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_087910645.1|2552404_2553558_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274943.1|2553843_2554368_+	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_129556588.1|2554558_2554726_-	phosphatase	NA	NA	NA	NA	NA
WP_075274944.1|2554670_2555387_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
>prophage 26
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	2570728	2598915	3142986	tRNA,transposase,protease,integrase	Acinetobacter_phage(12.5%)	26	2568117:2568176	2585957:2586245
2568117:2568176	attL	ACGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTT	NA	NA	NA	NA
WP_155047267.1|2570728_2570938_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007057.1|2572265_2572682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|2572739_2573892_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_016212230.1|2573948_2575397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|2576930_2577119_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046946.1|2578520_2578796_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|2578798_2579401_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_155046749.1|2579464_2579752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|2580296_2581376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780431.1|2581694_2583413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2583456_2584362_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155049822.1|2584832_2584988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047221.1|2585379_2585859_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	42.0	1.7e-11
WP_155047222.1|2585967_2586642_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.8	2.2e-09
2585957:2586245	attR	AAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTT	NA	NA	NA	NA
WP_155047223.1|2586685_2586931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210068.1|2587561_2588137_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_036778086.1|2588212_2589088_-	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_052104629.1|2589488_2590514_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047224.1|2590657_2591134_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778088.1|2591118_2592201_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.0e-20
WP_036777829.1|2592441_2592846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210073.1|2593558_2594290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210076.1|2594546_2595848_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210066.1|2595989_2596658_+|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_032126425.1|2597101_2597698_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210052.1|2597718_2598915_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
>prophage 27
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	2628131	2680591	3142986	transposase,tRNA	Microbacterium_phage(12.5%)	56	NA	NA
WP_054300282.1|2628131_2628596_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047228.1|2628652_2629135_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556590.1|2629989_2630385_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_032126312.1|2630381_2631176_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_036778479.1|2631354_2632080_-	D-Ala-D-Ala dipeptidase	NA	NA	NA	NA	NA
WP_016211759.1|2632325_2633513_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_016210935.1|2634089_2634632_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|2634628_2635315_-	acireductone synthase	NA	NA	NA	NA	NA
WP_036778484.1|2635318_2635930_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|2635976_2636996_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|2637097_2637892_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|2637929_2638736_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|2638814_2639864_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|2640061_2641321_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|2641367_2642045_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2642130_2642412_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016210940.1|2642503_2643691_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	6.4e-20
WP_016210820.1|2643927_2644869_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|2645372_2645597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|2645888_2646593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210823.1|2647063_2647702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|2648036_2648567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779158.1|2648563_2650096_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2650092_2651043_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2651463_2652096_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2652338_2652536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2652910_2653276_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2653332_2653497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2653486_2653786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2653833_2654262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300194.1|2654339_2655038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2655015_2656077_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126306.1|2656301_2656598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556591.1|2656702_2657359_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2657582_2658080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047229.1|2659289_2659751_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2659710_2660049_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036778253.1|2660106_2661645_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_098082804.1|2661756_2662855_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_016210987.1|2663092_2664292_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_016210981.1|2664321_2664960_+	ribonuclease T	NA	NA	NA	NA	NA
WP_016210983.1|2664975_2667159_-	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	1.1e-06
WP_032126304.1|2667396_2667741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300193.1|2668786_2668993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104666.1|2669157_2669616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212032.1|2670203_2671331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|2671454_2672117_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|2672208_2672454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211963.1|2673527_2674187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|2674288_2674939_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_054300271.1|2675430_2676405_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126299.1|2676655_2676877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047230.1|2677165_2677588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047231.1|2677588_2678122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300190.1|2678616_2679579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046995.1|2679705_2680591_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	2695363	2746382	3142986	transposase,tRNA	Staphylococcus_phage(20.0%)	53	NA	NA
WP_054300271.1|2695363_2696338_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210168.1|2696430_2697114_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210164.1|2697189_2697969_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_032126297.1|2697955_2698816_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_016210177.1|2698940_2699306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210175.1|2699691_2700021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300188.1|2700334_2701894_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	50.4	9.9e-37
WP_155047232.1|2702139_2703201_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211784.1|2703754_2704477_+	aquaporin family protein	NA	M1HH19	Acanthocystis_turfacea_Chlorella_virus	35.8	1.6e-26
WP_016211783.1|2704468_2704834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126294.1|2705114_2706392_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211782.1|2706991_2707174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2707235_2707601_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2707546_2708122_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047233.1|2708118_2708760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210766.1|2708848_2709292_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_032126291.1|2709295_2709805_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_016210756.1|2709797_2712611_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A167RAL2	Powai_lake_megavirus	26.5	1.3e-76
WP_051307336.1|2712749_2713676_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	9.4e-11
WP_036778399.1|2713833_2715372_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2715545_2715806_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_016210763.1|2716114_2717359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210755.1|2717462_2718191_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_016210761.1|2718294_2719032_+	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_054300187.1|2719386_2720169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307321.1|2720231_2720780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209980.1|2720866_2722033_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.7e-25
WP_032126286.1|2722338_2725137_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	4.9e-180
WP_016209981.1|2725195_2726416_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	8.5e-36
WP_016209998.1|2726445_2726847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209994.1|2727513_2727801_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_016209985.1|2727957_2728296_+	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_016209995.1|2728330_2729968_-	response regulator	NA	NA	NA	NA	NA
WP_016209992.1|2730069_2731119_+	WD domain, G-beta repeat family protein	NA	NA	NA	NA	NA
WP_016209988.1|2731191_2731836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556662.1|2731832_2733080_-	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_016209986.1|2733085_2734375_-	ubiquinone biosynthesis hydroxylase UbiH/UbiF/VisC/COQ6 family protein	NA	NA	NA	NA	NA
WP_016209989.1|2734399_2734990_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_016209996.1|2735134_2735359_+	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_016209991.1|2735339_2735669_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_033923658.1|2735894_2736458_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209997.1|2736492_2736954_+	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_016209977.1|2737030_2738716_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_032126288.1|2738765_2739566_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_016210000.1|2739592_2740141_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_016209993.1|2740270_2740663_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016209990.1|2740719_2741124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556594.1|2741156_2741924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047234.1|2742389_2742533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2742576_2743551_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047235.1|2743570_2744557_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2744647_2745394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275004.1|2745518_2746382_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	2765005	2800609	3142986	protease,transposase,tRNA	Staphylococcus_phage(33.33%)	34	NA	NA
WP_016210376.1|2765005_2767486_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2767548_2767914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|2768252_2768591_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2768550_2769006_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2769020_2769311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777784.1|2769376_2770975_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2771105_2771441_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_036777781.1|2771468_2773133_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	5.4e-33
WP_016210581.1|2773129_2773774_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|2773773_2774517_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2774575_2774815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2774965_2776333_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|2776343_2776895_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126278.1|2776975_2777959_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|2778080_2779838_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126277.1|2780060_2780651_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_155049840.1|2780739_2781159_-	DksA protein	NA	NA	NA	NA	NA
WP_075273416.1|2781299_2781914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212327.1|2781974_2782760_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075273313.1|2783013_2783352_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007003.1|2783311_2783773_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2784145_2785120_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212084.1|2785401_2786418_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126534.1|2786417_2786933_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212085.1|2786974_2787448_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_155047236.1|2787503_2788046_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212310.1|2788069_2788525_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_155046996.1|2790298_2792812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046997.1|2793746_2796269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2796843_2797905_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2797931_2798507_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2798452_2798818_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046755.1|2798889_2799066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|2799456_2800609_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 30
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	2925477	2989609	3142986	transposase	Staphylococcus_phage(16.67%)	53	NA	NA
WP_054300271.1|2925477_2926452_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211161.1|2927034_2928144_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|2928155_2928800_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|2928818_2929805_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|2929884_2930961_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|2931163_2931988_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|2932304_2933309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|2933517_2934483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047242.1|2934621_2935497_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2935793_2936846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211698.1|2937113_2937542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2937755_2938247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2938302_2939553_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2939655_2939874_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_036777591.1|2940331_2941186_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_016210728.1|2941240_2941711_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2942098_2943478_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2943505_2943964_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2943941_2945159_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2945350_2945587_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2945600_2945756_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2945836_2946799_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2946958_2948275_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2948284_2948953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2949315_2951130_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_054300166.1|2951247_2952036_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211543.1|2952616_2954368_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016211544.1|2954378_2955179_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.6	5.8e-33
WP_016211545.1|2955281_2955770_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.7	2.4e-29
WP_032126435.1|2955943_2956258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375799.1|2957278_2957623_+	DMT family protein	NA	NA	NA	NA	NA
WP_016210038.1|2963316_2964279_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.0	8.8e-20
WP_016210039.1|2964465_2965725_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|2965948_2966275_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_052104566.1|2966469_2967420_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_032126434.1|2967477_2969544_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_016210049.1|2969549_2970545_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_016210042.1|2971130_2972711_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|2972867_2974277_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_016210047.1|2974336_2975470_-	cation transporter	NA	NA	NA	NA	NA
WP_016210033.1|2975609_2976434_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_016210034.1|2976661_2977291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|2977627_2977999_-	isochorismatase	NA	NA	NA	NA	NA
WP_016210046.1|2978302_2978590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126431.1|2978741_2979590_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_016210037.1|2979717_2980758_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_155047244.1|2980830_2982768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300165.1|2983051_2983711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2983865_2984840_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|2984915_2985935_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556602.1|2986333_2986543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273820.1|2987417_2988500_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.8	1.2e-142
WP_054300161.1|2988547_2989609_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP039209	Piscirickettsia salmonis strain Psal-103 chromosome, complete genome	3142986	2997494	3111414	3142986	transposase,tRNA	Staphylococcus_phage(33.33%)	113	NA	NA
WP_155047053.1|2997494_2998380_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212222.1|2998856_2999330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|2999326_2999722_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|3000651_3001227_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|3001172_3001538_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036778680.1|3001802_3004133_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_129556603.1|3004253_3006269_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300160.1|3006452_3009845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|3009909_3010215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|3010405_3010585_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_155047245.1|3010588_3010777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047246.1|3010800_3011775_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	1.8e-28
WP_032126362.1|3012032_3012398_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047247.1|3012461_3012830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|3012833_3013720_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047248.1|3013783_3014470_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047249.1|3014722_3015823_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556605.1|3016217_3017327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|3018369_3018735_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047002.1|3018749_3019355_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036776867.1|3019725_3021123_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.8e-77
WP_051307313.1|3021242_3022190_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|3022186_3022702_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|3022688_3023888_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|3023884_3024208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|3024209_3025439_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|3025438_3026482_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|3026481_3027165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3027161_3029651_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3029667_3029922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3029922_3030279_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|3031058_3032222_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|3032241_3035349_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|3035350_3036856_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3036883_3037165_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3037313_3037655_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3037774_3039655_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_059372650.1|3039739_3041338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3041355_3042471_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|3042598_3043597_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_052104582.1|3043600_3044359_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3044360_3045560_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3045543_3046215_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3046236_3047013_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3047016_3048015_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3048016_3048595_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3048591_3050061_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3050104_3050392_-	trp operon repressor	NA	NA	NA	NA	NA
WP_155047250.1|3050592_3051189_+	EamA family transporter	NA	NA	NA	NA	NA
WP_054300152.1|3051215_3051581_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|3051637_3051793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273401.1|3051937_3052390_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047251.1|3052427_3052652_+	EamA family transporter	NA	NA	NA	NA	NA
WP_155047003.1|3054247_3055133_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3055319_3055541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047252.1|3055656_3056235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047253.1|3056379_3056574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3056632_3057607_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|3057660_3058722_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776841.1|3059449_3059989_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|3060073_3060610_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|3061261_3061564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|3062013_3062322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274973.1|3062912_3063380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|3063662_3064373_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|3064599_3064998_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_036778156.1|3065865_3066816_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3066815_3068894_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3069041_3069557_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3069565_3070129_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3070109_3070856_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3070995_3071448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|3071871_3072708_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3072704_3073601_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3073633_3074701_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3074719_3075088_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3075113_3076562_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3076571_3077951_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3077991_3079323_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|3079294_3080254_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3080346_3080850_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3080984_3082136_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3082132_3082612_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3082758_3085080_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3085024_3085651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3085655_3086555_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3086627_3087206_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3087506_3087764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556718.1|3087772_3088959_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_155046758.1|3089773_3089905_+	phosphatase	NA	NA	NA	NA	NA
WP_155046759.1|3090049_3090205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777721.1|3090532_3091306_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155047254.1|3092242_3092380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3092423_3093398_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3094492_3094831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007065.1|3094847_3095687_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_081007013.1|3095899_3096199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|3096188_3096353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|3096409_3096775_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3098079_3098775_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3098771_3100199_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3100224_3100488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3100560_3101535_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047005.1|3101593_3102444_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|3102481_3102826_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3102822_3103659_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3103659_3104001_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3104002_3104608_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3104604_3106599_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3106618_3107560_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_052104719.1|3107787_3109212_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|3109724_3110699_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3110757_3111414_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039210	Piscirickettsia salmonis strain Psal-103 plasmid unnamed1, complete sequence	171449	2012	167666	171449	head,protease,integrase,tail,capsid,transposase	Streptococcus_phage(18.18%)	177	115268:115327	153748:154992
WP_105962625.1|2012_2898_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.7	4.5e-10
WP_016212151.1|3500_4463_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|4486_4801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|4864_5839_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_033923686.1|5963_7013_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|7121_8162_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|8175_8805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|8895_9195_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_081377909.1|9191_9656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104769.1|10617_11541_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_105962623.1|12685_13838_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075274741.1|13907_14165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273822.1|14266_14767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|15211_16294_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212255.1|16480_16651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126838.1|16647_16851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212257.1|17187_17412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212260.1|17431_17704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|17861_18836_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_129556717.1|19490_20717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|21042_21879_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_016212398.1|22141_22603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047268.1|22769_23150_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|24238_24604_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|24549_25125_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_105962623.1|26108_27262_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273810.1|27282_27990_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	34.2	1.4e-11
WP_081007042.1|30149_30965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728342.1|31279_31783_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_105962174.1|31926_32091_+	phosphatase	NA	NA	NA	NA	NA
WP_155047269.1|32239_32635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273806.1|32896_33460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|33565_34021_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_075273804.1|33980_34319_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377694.1|34403_35132_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_155053579.1|35161_35884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126138.1|36438_36702_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_016211871.1|37267_37603_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_129556699.1|37596_37797_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_054300590.1|38104_38329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|38945_39971_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273790.1|40515_40818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372613.1|40807_41434_-	hypothetical protein	NA	A0A222ZGQ4	Arthrobacter_phage	33.7	1.8e-21
WP_016212412.1|41734_41899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|41891_42341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|42588_42762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212499.1|42966_43341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|44339_45492_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_075273786.1|45501_45900_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211913.1|46332_47454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|47779_48052_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_032126795.1|48055_48316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211912.1|48588_49179_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
WP_129556698.1|49268_49970_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_054300249.1|50083_50449_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|50463_50970_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	25.5	1.0e-06
WP_155047271.1|50973_52091_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	3.6e-57
WP_051307374.1|52205_52682_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_016212298.1|52922_53249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|53915_54941_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047272.1|55150_55879_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_054300594.1|56241_57267_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047273.1|57397_57535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046942.1|57673_58560_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.8	2.6e-10
WP_155047274.1|58644_58851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377350.1|59190_60006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211897.1|60399_60804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|60804_61551_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211895.1|62059_63118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126360.1|63240_63975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211773.1|64561_65236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211775.1|65337_65706_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_016211776.1|65873_67211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556697.1|67693_68086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|68470_69376_-|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
WP_016210664.1|69673_70096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210651.1|70095_70446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210658.1|70442_70838_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210667.1|70830_71154_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210663.1|71150_71462_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	4.3e-08
WP_016210655.1|71780_72377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556716.1|72390_72681_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
WP_052047108.1|72814_73213_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047275.1|73268_73766_-	DNA polymerase	NA	NA	NA	NA	NA
WP_155047276.1|73762_74542_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	31.7	1.8e-18
WP_129556718.1|74570_75756_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_081377350.1|76289_77105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047277.1|77169_77778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211936.1|78512_79535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047278.1|80024_80426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|80543_81569_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046767.1|82143_82305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047048.1|82304_82805_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273747.1|83066_83657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|83719_84013_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_155049832.1|84095_84971_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	3.7e-57
WP_052104629.1|85088_86114_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047281.1|86340_86670_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.8	5.5e-06
WP_155047018.1|86737_87541_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.9e-55
WP_075274752.1|87576_87876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|87872_88448_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|88393_88759_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212061.1|89663_91706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|92475_92676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047246.1|92816_93791_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.0	1.9e-25
WP_016212579.1|95287_95485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|96084_97059_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016212456.1|97102_97390_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_036779532.1|97386_97788_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_075273881.1|97797_99984_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.2	9.2e-73
WP_016212404.1|100104_100338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273857.1|101114_101849_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	8.4e-39
WP_129556710.1|102002_102473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556709.1|102553_102643_-	DUF1891 domain-containing protein	NA	NA	NA	NA	NA
WP_052047129.1|102854_104438_-	protein kinase	NA	NA	NA	NA	NA
WP_075274745.1|104720_105449_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	1.2e-37
WP_016212365.1|106161_106404_+	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_036781349.1|106405_106732_+	potassium ABC transporter ATPase	NA	A9D9Y1	Lactobacillus_prophage	36.6	1.1e-11
WP_054300202.1|106847_107576_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212152.1|108045_108429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|108735_109113_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_155047283.1|109277_109610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|109562_109715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377351.1|109798_110578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047298.1|111107_111293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212019.1|111679_112375_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_105962690.1|112843_113119_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|113115_113361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047016.1|113390_113618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212014.1|114021_114435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|114532_115261_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
115268:115327	attL	TGATCAGGCTACCCTATTCCGGACAAATAAATTACAATAATCCGAGCCGGAGGAATCACA	NA	NA	NA	NA
WP_105962623.1|115327_116480_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047284.1|117109_118138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|118417_119571_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273826.1|119530_120658_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	30.3	1.9e-18
WP_155047013.1|120878_121025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377350.1|121354_122170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780064.1|122415_123006_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	38.3	2.0e-22
WP_016211879.1|123960_124980_+	ParA family protein	NA	NA	NA	NA	NA
WP_075274742.1|124992_125874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|125903_126632_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|126835_129412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|129528_130506_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155047285.1|130524_130782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774631.1|131915_132380_+	hypothetical protein	NA	H6WFS7	Cyanophage	38.2	2.9e-21
WP_080963647.1|132718_132889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|134559_135288_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155047299.1|135471_136830_-	DEAD/DEAH box helicase	NA	D2J050	Enterococcus_phage	50.5	2.6e-126
WP_155047286.1|136919_137486_-	helix-turn-helix domain-containing protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	35.0	1.4e-20
WP_017377658.1|137489_138176_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|138423_139152_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027242575.1|139939_140425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242576.1|140458_142321_-	AAA family ATPase	NA	A0A088C4M0	Shewanella_sp._phage	30.9	1.0e-56
WP_036771347.1|142513_143491_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155047288.1|143505_143631_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047289.1|143563_143740_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275025.1|143989_146005_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155047291.1|147666_149697_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|149831_150809_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155047292.1|150886_151804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|152593_153747_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273751.1|154096_155827_-	PLD-like domain protein	NA	NA	NA	NA	NA
153748:154992	attR	TGTGATTCCTCCGGCTCGGATTATTGTAATTTATTTGTCCGGAATAGGGTAGCCTGATCACTATTTCTTTGAGATCACGGTAAGATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATGATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTCTACCCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCCAACTAGAGAGTTTATCTGTATGGATATGAACTCTCTACTCGGTGTTGCACTTCATGTGACGGAGGGCGAAGACTATATGCCTCAGAAGTTATTAATTTTGTTTGCACAGATCAGGTATATATTCTGTTCTAGATGAATATTTCCAAAGAGGGCGCCAGAAACTATTTCTAATAATGTTAGATGCTTTCTTGCTATTAATGATATGACCATAGTTTTGTAATCCTGATGGGTAAAAGTTTTGTGATCCTACATAAAACATCCCTTTGTCTACCATCATAAATTTATAATGGCCTGTTATTTTTTCATTATCAGTCCATAAGTCATCATATTCATTGAACCTAATTGTAGAAATATGCAATTTATTGCATAGTTTTAAATTAATAGTATCTTCTTTTAATGCTGGATACATTGCCATCGCTTCACTTTTTATTTTACTCCATACTTCTTCATCGGTGGCTAAAGATAAATAACCTGATTCCATCATAGTTGCATCACTGTAAGGAGATTGGACAATATATACATGGCCTGCTTCCATGAGAAGTTTAGCTAGGGCACTAATAAGGTTAGTGTGTTGTTCCTTTGTAGTATCATAAGGCCAAGTATTAAAGTGTGCTTTAAGGCTCTGTTGTGCTATATAAATCCTTTTTTTTGCTGAAGTTAATAACCGATACAAAGCATAGTCTGAATTATTATTATTTTTAGCTGAATCATCCTTATATAAACCATAACCAGTGCGACCGATTGCAAGAACTTCTGCATTTCCAGAAGTAGTATGAGGTGCAGCATATAAATCATGTCCTAGCAAATCATTACTCACAATAGCATAATTGTTATTTTTTGTTGCGGAATACTCAATAACATTAAAAGGATAGTAAAGATAAAGTTTAATATTATTCCTTACAAACCTCCACAGCAAATTTGTAAATCTAATTGCTTGAGTTGCTGCTGGGCCTTCTAACTCAATCATGAGATCAAAAACTGGGTGTT	NA	NA	NA	NA
WP_155047019.1|155839_155992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047293.1|156481_157207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|157359_158088_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126843.1|158464_158644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126844.1|158862_159159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212118.1|159253_159715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780014.1|160068_161511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780017.1|161671_162046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047014.1|162116_162458_-	hypothetical protein	NA	A0A1B1IQX9	uncultured_Mediterranean_phage	60.3	1.7e-21
WP_054300202.1|162676_163405_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155047294.1|163611_164274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047295.1|164519_165581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|165610_166693_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_032126362.1|166779_167145_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|167090_167666_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
>prophage 1
NZ_CP039211	Piscirickettsia salmonis strain Psal-103 plasmid unnamed2, complete sequence	58537	1924	46091	58537	capsid,protease,tail,integrase,transposase,head,portal	Streptococcus_phage(18.18%)	55	NA	NA
WP_054300271.1|1924_2899_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_080664851.1|3101_3911_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211068.1|3907_4720_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211075.1|4723_5965_-	MFS transporter	NA	NA	NA	NA	NA
WP_155047030.1|6179_6323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211069.1|6347_6779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780005.1|6762_7410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|7557_8583_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016211077.1|9015_9801_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211067.1|9933_10677_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211079.1|10886_11192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780299.1|11346_11649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211080.1|11687_12674_+	helix-turn-helix domain-containing protein	NA	A0A0S2MVA0	Bacillus_phage	45.4	4.3e-14
WP_036780304.1|12714_13251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047314.1|13219_13582_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.9e-24
WP_155047315.1|13574_13922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210963.1|13918_14158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923627.1|14253_14541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047311.1|14537_14840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126916.1|14827_15298_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	48.8	1.5e-33
WP_052047121.1|15442_15844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126915.1|16022_16406_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	4.7e-25
WP_155047310.1|16492_16975_+	hypothetical protein	NA	Q9B019	Phage_GMSE-1	33.3	1.1e-13
WP_155047309.1|17203_18133_+	hypothetical protein	NA	A0A1W6JP18	Morganella_phage	52.0	1.5e-85
WP_155047308.1|18152_19127_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	8.3e-26
WP_155047307.1|19170_19767_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.3	2.0e-38
WP_054300593.1|19763_21005_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	43.6	2.7e-85
WP_081007077.1|20952_21624_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	45.8	5.5e-45
WP_155047306.1|21679_22846_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	38.7	1.2e-66
WP_036778347.1|22881_23463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274765.1|23782_24094_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	31.7	2.5e-08
WP_075274764.1|24090_24414_+|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	41.7	5.4e-14
WP_075274763.1|24406_24802_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	39.1	6.0e-07
WP_075274762.1|24798_25149_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_155047305.1|25148_25571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274761.1|25572_25896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|25952_26219_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_155047313.1|27807_28161_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155047304.1|28887_29019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|29289_30315_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032126138.1|30621_30885_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_036780292.1|31190_31940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211377.1|31963_32986_-	AAA family ATPase	NA	A0A1V0DZZ0	Clostridioides_phage	27.5	3.2e-12
WP_032126388.1|33746_34772_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212288.1|34866_36117_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|36293_37268_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_027242955.1|37516_37777_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_036780061.1|37769_38123_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	35.8	1.1e-12
WP_017375910.1|38399_39128_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420837.1|39514_40447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|40588_41317_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036779013.1|41346_43419_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_155047303.1|43748_44750_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.3e-29
WP_081007075.1|45095_45437_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_032126152.1|45500_46091_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.8	1.4e-20
>prophage 1
NZ_CP039212	Piscirickettsia salmonis strain Psal-103 plasmid unnamed3, complete sequence	38376	19432	32633	38376	tail,terminase,head,transposase,protease,capsid,portal	Erysipelothrix_phage(25.0%)	15	NA	NA
WP_054300271.1|19432_20407_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047322.1|20741_21134_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	4.4e-26
WP_016212234.1|21210_21690_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_155047321.1|21692_23375_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	45.7	6.9e-137
WP_155047320.1|23371_24094_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	40.8	2.6e-40
WP_052104629.1|24224_25250_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047319.1|25452_26073_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	50.9	5.5e-39
WP_080664855.1|26020_26692_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.8	3.0e-43
WP_016211140.1|26749_27943_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_155047318.1|28063_29398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211137.1|29588_29900_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_016211132.1|29896_30220_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211139.1|30212_30608_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_155047317.1|30687_31524_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_054300271.1|31658_32633_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
>prophage 1
NZ_CP039213	Piscirickettsia salmonis strain Psal-103 plasmid unnamed4, complete sequence	33277	10318	26972	33277	transposase,tail	Indivirus(18.18%)	20	NA	NA
WP_036781073.1|10318_10579_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	A0A1S5NR91	Burkholderia_phage	48.8	2.1e-13
WP_081007079.1|10649_10922_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_129556478.1|11133_12020_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.4	5.8e-10
WP_016212315.1|13558_13993_+	DUF29 domain-containing protein	NA	A0JC30	Ralstonia_phage	39.7	9.1e-25
WP_032126346.1|14092_14335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047334.1|14401_14842_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	37.6	1.1e-06
WP_054300249.1|14802_15168_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047335.1|15182_15626_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	25.5	5.1e-07
WP_054300271.1|16635_17610_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047336.1|17606_17891_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047337.1|17909_18272_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211141.1|18271_18694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275196.1|18695_19019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|19075_19342_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075275195.1|19345_21424_+	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	33.4	2.5e-56
WP_036776958.1|21416_21758_+|tail	phage minor tail family protein	tail	NA	NA	NA	NA
WP_016210666.1|21754_22426_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|22394_23141_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_054300696.1|23130_23688_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_075275194.1|23684_26972_+	host specificity protein J	NA	A0A0R6PIC0	Moraxella_phage	33.2	5.2e-112
