The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046252	Sphingobium sp. CAP-1 chromosome MIN1, complete sequence	2998318	417509	423136	2998318		uncultured_Mediterranean_phage(66.67%)	8	NA	NA
WP_155184445.1|417509_418283_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	35.1	8.1e-32
WP_155178776.1|418279_418873_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	44.4	2.0e-38
WP_155178778.1|418901_419153_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	64.3	9.3e-06
WP_155178780.1|419182_419602_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_155178782.1|419598_420378_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	42.2	2.9e-45
WP_155178783.1|420488_420617_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_155178785.1|420980_421943_-	cell wall hydrolase	NA	A0A0S1WEP8	Vibrio_phage	30.2	5.0e-07
WP_155178787.1|422140_423136_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	40.6	1.7e-50
>prophage 2
NZ_CP046252	Sphingobium sp. CAP-1 chromosome MIN1, complete sequence	2998318	2935900	2951486	2998318		Pseudomonas_phage(28.57%)	12	NA	NA
WP_155184175.1|2935900_2942524_-	acetyltransferase	NA	K4NZ44	Pseudomonas_phage	30.2	2.1e-144
WP_155185199.1|2942520_2943804_-	transglycosylase SLT domain-containing protein	NA	Q775D3	Bordetella_phage	33.4	5.6e-30
WP_155184178.1|2944658_2945276_-	hypothetical protein	NA	K7ZMJ9	Xanthomonas_citri_phage	33.0	1.8e-05
WP_155184180.1|2945205_2945640_-	hypothetical protein	NA	B1GS38	Salmonella_phage	48.7	1.4e-12
WP_155184183.1|2945626_2946031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155184186.1|2946077_2947871_-	hypothetical protein	NA	Q775D1	Bordetella_phage	34.1	6.8e-90
WP_155184188.1|2947870_2948506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155184191.1|2948505_2949159_-	hypothetical protein	NA	T1SAQ2	Salmonella_phage	26.3	4.0e-08
WP_155184195.1|2949286_2949532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155184199.1|2949535_2950006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155184202.1|2950019_2950442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155184204.1|2950454_2951486_-	hypothetical protein	NA	W6MW28	Pseudomonas_phage	49.4	4.5e-78
>prophage 1
NZ_CP046254	Sphingobium sp. CAP-1 plasmid p1, complete sequence	168214	23613	155558	168214	transposase,integrase	Escherichia_phage(10.71%)	111	152246:152264	164096:164114
WP_022684655.1|23613_24765_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_140043502.1|25299_26064_+	AAA family ATPase	NA	B0ZSI1	Halomonas_phage	27.8	1.2e-06
WP_140043501.1|26063_26987_+	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	32.9	5.0e-12
WP_140043500.1|27246_27783_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_140043499.1|27775_28882_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_140043498.1|29021_29654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007684587.1|29633_30311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007684590.1|30499_30703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155187950.1|30842_36656_-	DUF3320 domain-containing protein	NA	NA	NA	NA	NA
WP_155187953.1|36783_39570_-	type III restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_155178660.1|40528_42043_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	26.3	1.8e-14
WP_155178662.1|42029_42758_+	ATPase	NA	A0A059NT77	Lactococcus_phage	38.0	4.5e-32
WP_155187956.1|43211_43361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011950768.1|43478_44972_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_007686288.1|44968_45736_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	39.2	2.9e-42
WP_155187958.1|45819_47652_-	hypothetical protein	NA	Q1MVP0	Enterobacteria_phage	29.1	2.8e-14
WP_021316584.1|47850_50481_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_155187960.1|50477_51587_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_021316582.1|51590_54890_-	TM0106 family RecB-like putative nuclease	NA	A0A1L3KIW1	Beihai_Nido-like_virus	27.6	1.2e-07
WP_021316581.1|54994_55978_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_021316580.1|56014_56848_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_031294252.1|56851_57544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021316578.1|57589_58453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140043495.1|58442_60404_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_140043494.1|60387_61392_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_155187963.1|61395_62619_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_155187966.1|62622_63480_-	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
WP_155187968.1|63476_64175_-	virB8 family protein	NA	NA	NA	NA	NA
WP_155187971.1|64509_65454_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_076605730.1|65471_65675_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_155187974.1|65674_66391_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_155187977.1|66394_68806_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_155187980.1|68798_69149_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_021245259.1|69145_69484_-	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_155187983.1|69480_70149_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_155187986.1|70145_70487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155187989.1|70537_71482_-	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_155187992.1|71492_72104_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155187995.1|72176_72923_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155187998.1|72936_73698_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_024020823.1|74250_77148_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.8	1.5e-168
WP_004213007.1|77243_77873_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	36.8	6.2e-14
WP_004213004.1|77869_78427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010339849.1|80235_80820_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	52.0	7.2e-41
WP_010339850.1|80953_81430_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_155188001.1|81696_82642_+|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	24.3	1.4e-09
WP_155188078.1|82639_83131_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_125986459.1|83227_84343_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_155188081.1|84740_85757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155188004.1|85816_86227_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_155188007.1|86219_86456_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155188009.1|86618_87683_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_155188012.1|87697_88528_+	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_155188015.1|88978_89386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155188018.1|89737_90619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155188021.1|90622_91042_+	VOC family protein	NA	NA	NA	NA	NA
WP_155188024.1|91120_92185_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	46.6	9.0e-74
WP_155188027.1|92215_93049_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155188030.1|93130_94570_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_155188033.1|94566_97761_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.3	7.7e-44
WP_155188036.1|97765_98932_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155188039.1|99174_99894_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A0K0KVL6	Prochlorococcus_phage	32.3	7.3e-11
WP_006953933.1|99900_100767_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	40.6	6.7e-27
WP_048938210.1|100909_103819_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_020820542.1|104355_104796_-	DUF934 domain-containing protein	NA	NA	NA	NA	NA
WP_020820541.1|104788_106423_-	nitrite/sulfite reductase	NA	NA	NA	NA	NA
WP_029986492.1|106650_107094_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_020820538.1|107123_107609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020820537.1|107605_108454_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_125445753.1|108518_108992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020820536.1|109045_109225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008828739.1|109322_109964_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_020820535.1|109960_110638_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_021318857.1|111029_111230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020820533.1|111202_111898_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	37.1	9.8e-29
WP_020820532.1|111915_112161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004206960.1|112203_113415_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_155188042.1|113454_113727_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_155178662.1|113831_114560_-	ATPase	NA	A0A059NT77	Lactococcus_phage	38.0	4.5e-32
WP_155178660.1|114546_116061_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	26.3	1.8e-14
WP_004212890.1|118856_119606_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_004212886.1|119602_122104_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	41.0	7.7e-124
WP_004212885.1|122100_122709_-	cation transporter	NA	NA	NA	NA	NA
WP_004212882.1|122705_123392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004212881.1|123395_123809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009824022.1|123856_124234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013849881.1|124230_124719_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_004212878.1|124772_128018_-	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_004212877.1|128021_129200_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_013039111.1|129199_130477_-	TolC family protein	NA	NA	NA	NA	NA
WP_007406840.1|130537_130834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004212871.1|130907_132875_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_004212870.1|132874_133501_-	cation transporter	NA	NA	NA	NA	NA
WP_007406847.1|133576_133996_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013039112.1|133989_135192_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_009824027.1|135481_136054_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	48.1	9.5e-38
WP_150426904.1|136668_139638_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	40.3	3.7e-202
WP_011607925.1|139778_140348_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	45.0	1.2e-32
WP_009824028.1|141398_142277_+	AAA family ATPase	NA	B5TA81	Burkholderia_phage	25.4	1.0e-06
WP_013039113.1|142591_143830_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_155188045.1|143976_145179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015449223.1|145238_145637_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_155188048.1|145636_146320_+	RES domain-containing protein	NA	NA	NA	NA	NA
WP_037465816.1|146364_146736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017183651.1|147839_149042_-	AAA family ATPase	NA	A0A1I9KF58	Aeromonas_phage	31.3	6.6e-41
WP_041865596.1|149236_150325_-	replication initiation protein	NA	NA	NA	NA	NA
WP_155188051.1|150711_151008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155188054.1|150991_151318_+	single-stranded DNA-binding protein	NA	K7ZMK1	Xanthomonas_citri_phage	31.1	1.1e-06
WP_155188057.1|151380_152247_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	28.7	1.1e-08
152246:152264	attL	GAGAGGGGAGGGGGCCTTC	NA	NA	NA	NA
WP_155188060.1|152313_154509_+	methylase	NA	A0A076FMQ0	Aureococcus_anophage	29.7	5.5e-25
WP_009823939.1|154553_155558_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	26.9	6.2e-08
164096:164114	attR	GAGAGGGGAGGGGGCCTTC	NA	NA	NA	NA
>prophage 1
NZ_CP046256	Sphingobium sp. CAP-1 plasmid p3, complete sequence	223979	8651	61865	223979	transposase,integrase	Escherichia_phage(30.77%)	44	58291:58350	61930:62015
WP_099234654.1|8651_10298_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_155188113.1|10310_10739_-	DUF4158 domain-containing protein	NA	Q1MVP5	Enterobacteria_phage	46.1	8.4e-15
WP_011950653.1|10795_11356_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	45.4	3.5e-29
WP_155188115.1|11372_11528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037555777.1|11555_13013_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_082734528.1|13261_13849_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_030540911.1|13887_14847_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_125723807.1|15003_15273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080993748.1|15263_15716_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_139797613.1|16145_16403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137903339.1|16368_17202_+	transporter	NA	NA	NA	NA	NA
WP_107917704.1|17226_19395_+	PQQ-dependent dehydrogenase, methanol/ethanol family	NA	NA	NA	NA	NA
WP_011950407.1|19567_20971_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_049771327.1|21018_22599_+	AMP-binding protein	NA	Q75ZG1	Hepacivirus	28.1	1.1e-43
WP_051768193.1|22724_24767_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011950404.1|25044_27093_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011950403.1|27162_27891_-	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	37.2	4.5e-32
WP_041378971.1|27877_29392_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	26.0	2.3e-14
WP_004213209.1|29945_30731_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_123154235.1|30868_31054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062345270.1|31157_32150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062345272.1|32164_33292_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_084280701.1|33558_34416_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_084280703.1|34471_35800_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_062345284.1|35938_36418_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011608118.1|36516_36783_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_095687536.1|39317_40844_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	1.1e-85
WP_155188117.1|41045_41714_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095687534.1|41990_42908_-	recombinase family protein	NA	Q71TD8	Escherichia_phage	55.6	3.6e-31
WP_017183329.1|43375_44584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137903204.1|45069_45543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017183331.1|46501_47620_-	replication initiator protein A	NA	NA	NA	NA	NA
WP_017183332.1|47703_48771_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_017183333.1|48767_49964_-	AAA family ATPase	NA	A0A240F4U1	Ochrobactrum_phage	31.8	2.2e-44
WP_026002420.1|50506_51352_+	virulence-associated protein E	NA	NA	NA	NA	NA
WP_017183335.1|51392_51659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155188120.1|51986_54182_+	methyltransferase	NA	A0A076FMQ0	Aureococcus_anophage	24.4	5.9e-19
WP_007015824.1|54272_55505_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	22.2	1.6e-05
WP_009823940.1|55501_56857_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_009823939.1|56853_57858_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	26.9	6.2e-08
WP_095687533.1|57960_58269_+	methylase	NA	NA	NA	NA	NA
58291:58350	attL	TATTCTTTGCAGTCGCAGTTTATGTCGAGCGTGGCGGCAGGAGGCGCAGGTTTCCTTCGG	NA	NA	NA	NA
WP_155188124.1|58408_59413_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	35.0	3.2e-12
WP_095687466.1|59409_60324_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_095687465.1|60317_61865_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	23.6	4.6e-10
61930:62015	attR	CCGAAGGAAACCTGCGCCTCCTGCCGCCACGCTCGACATAAACTGCGACTGCAAAGAATACATAATCGACTACCTCGAACGCGCCT	NA	NA	NA	NA
