The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023165	Escherichia coli O22:H8 strain RM10809-3 chromosome, complete genome	5128479	337190	352558	5128479	integrase	Enterobacteria_phage(81.82%)	15	326780:326793	343410:343423
326780:326793	attL	AGTGCGGGTTGCAG	NA	NA	NA	NA
WP_021546001.1|337190_338360_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.4	9.7e-146
WP_050864046.1|338361_340065_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_155704906.1|340061_341684_+	AAA family ATPase	NA	S5MMD7	Bacillus_phage	23.5	1.2e-08
WP_050864044.1|341886_342459_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	98.4	1.5e-96
WP_000984201.1|342473_342719_-	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	100.0	1.8e-41
WP_001283022.1|342715_343450_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	97.5	3.3e-128
343410:343423	attR	AGTGCGGGTTGCAG	NA	NA	NA	NA
WP_001149156.1|344002_344269_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	6.3e-45
WP_024191950.1|344265_344865_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	1.7e-50
WP_001244665.1|344857_345145_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459294.1|345137_345593_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|345728_346049_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_052918893.1|346063_348397_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_001111349.1|349004_349415_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000121356.1|349393_350350_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001583225.1|350359_352558_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	3.3e-38
>prophage 2
NZ_CP023165	Escherichia coli O22:H8 strain RM10809-3 chromosome, complete genome	5128479	623979	688647	5128479	integrase,tRNA,capsid,head,portal,protease,terminase,lysis,transposase,tail	Enterobacteria_phage(42.59%)	70	634140:634186	680121:680167
WP_000912345.1|623979_625365_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|625400_625922_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|626029_626242_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|626243_627110_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001315309.1|627590_628133_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988379.1|628352_629045_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_050864259.1|631696_632704_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250424.1|632714_633230_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805422.1|633232_633865_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
634140:634186	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001624790.1|634199_635363_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	5.2e-200
WP_077613721.1|635218_635674_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	81.9	3.1e-60
WP_000206812.1|635589_635895_-	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	9.2e-48
WP_001242707.1|635894_636257_-	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000008165.1|636247_636784_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_000081287.1|636911_637736_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135680.1|637801_638164_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000559922.1|638634_639150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001020634.1|639469_640162_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|640259_640520_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515847.1|640512_641064_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.4	2.9e-100
WP_001250269.1|641239_641419_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104986.1|641408_642350_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.0	1.9e-152
WP_072097486.1|642346_642841_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.3	4.0e-85
WP_000210176.1|642840_643167_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_001061408.1|643572_644370_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
WP_001358249.1|644377_645367_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.0	2.4e-190
WP_001204780.1|645384_645768_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737283.1|645957_647055_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_050864258.1|647643_647859_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	97.2	1.7e-32
WP_001135281.1|647858_648356_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|648572_648755_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|648845_649139_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|649429_649840_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|650125_650332_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|650496_650691_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453587.1|651079_651625_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027283.1|651599_653525_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|653521_653728_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_021823630.1|653724_655326_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	7.2e-309
WP_000123273.1|655306_656626_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	2.6e-232
WP_001513196.1|656635_656968_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_001357871.1|657023_658049_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	3.1e-188
WP_050864272.1|658090_658486_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	2.8e-57
WP_000753019.1|658497_658851_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000975051.1|658862_659441_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	3.5e-80
WP_000683105.1|659437_659833_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001345558.1|659840_660581_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.0e-128
WP_000479154.1|660596_661019_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	9.7e-72
WP_000459458.1|661000_661435_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000840258.1|661427_663989_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.6	0.0e+00
WP_000847379.1|663985_664315_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001499538.1|664314_665013_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	3.3e-133
WP_000194780.1|665018_665762_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|665698_666331_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_155704915.1|666391_669763_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_001233071.1|669874_670474_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_074404595.1|670538_673499_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
WP_000885616.1|673498_674074_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086514.1|674171_674762_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000836768.1|675078_675312_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|675380_675494_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000239874.1|675859_676528_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|676584_676890_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226378.1|677073_678558_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|678744_679698_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177452.1|680210_680972_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
680121:680167	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|681154_682045_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662366.1|682045_685018_-	phage receptor	NA	NA	NA	NA	NA
WP_000383951.1|685004_687242_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420795.1|687510_688647_-|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP023165	Escherichia coli O22:H8 strain RM10809-3 chromosome, complete genome	5128479	959239	1064706	5128479	integrase,tRNA,capsid,portal,head,protease,plate,terminase,lysis,transposase,tail	Salmonella_phage(64.15%)	108	961967:961982	1034945:1034960
WP_000399648.1|959239_960220_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000168797.1|960480_961746_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114244.1|961897_962713_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
961967:961982	attL	ATCATCGGTAGCGTAA	NA	NA	NA	NA
WP_155704929.1|962858_965291_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001442269.1|965296_966196_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000424893.1|966326_966989_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.6	5.7e-26
WP_000829258.1|967064_967814_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_000397381.1|967813_969049_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000513775.1|969252_970218_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_000090164.1|972094_973633_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_000936043.1|973650_974571_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_089550691.1|974573_975485_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_001471275.1|975662_978011_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000086916.1|978018_979347_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_155704932.1|979393_980719_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_000497137.1|980931_981315_+	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_000555031.1|981425_982541_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_001295292.1|982537_983164_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_000195961.1|983410_984613_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
WP_000450121.1|984659_985418_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
WP_000892317.1|985475_986072_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001180076.1|986356_987589_+	multidrug efflux MFS transporter MdfA	NA	NA	NA	NA	NA
WP_000480892.1|987629_987914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297001.1|987999_988815_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase	NA	NA	NA	NA	NA
WP_000217848.1|988814_990023_-	MFS transporter	NA	NA	NA	NA	NA
WP_001297003.1|990106_990643_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050864069.1|990747_991800_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_072097433.1|991988_992180_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
WP_001047320.1|992195_992765_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.9	2.9e-39
WP_001247707.1|992890_993112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460891.1|993144_993654_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000956182.1|993661_993862_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_001352070.1|993825_994167_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	96.5	4.3e-54
WP_001244216.1|994234_994468_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	9.2e-32
WP_000752613.1|994467_994695_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104157.1|994691_995549_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	98.2	4.1e-162
WP_155704934.1|995545_997981_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.3	0.0e+00
WP_001154431.1|998134_998323_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217575.1|998333_998567_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_016239482.1|999034_999616_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_016239483.1|999620_1000592_+	macro domain-containing protein	NA	B0FIJ9	Escherichia_phage	40.9	4.0e-20
WP_050864067.1|1001321_1002428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001324710.1|1002440_1002875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016239485.1|1002874_1003540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155704936.1|1003698_1004643_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.8	1.0e-153
WP_001098431.1|1004642_1006409_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_000216257.1|1006551_1007385_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.3	2.2e-123
WP_000742500.1|1007401_1008460_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	6.4e-181
WP_050864065.1|1008463_1009114_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	94.9	1.2e-110
WP_000673520.1|1009209_1009674_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_050864064.1|1009673_1009877_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	91.0	4.0e-31
WP_000171568.1|1009880_1010096_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001396370.1|1010115_1010589_+	lysozyme	NA	E5G6N1	Salmonella_phage	89.7	5.4e-79
WP_000727853.1|1010590_1010968_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001080935.1|1010964_1011393_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	73.8	1.6e-45
WP_049592603.1|1011488_1011920_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	91.6	7.1e-70
WP_000829141.1|1011912_1012359_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.5e-62
WP_000993775.1|1012427_1013006_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000177590.1|1013002_1013362_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_155704939.1|1013348_1014257_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	2.5e-141
WP_001086824.1|1014249_1014855_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	1.8e-111
WP_000905030.1|1017341_1017908_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	3.2e-86
WP_000046120.1|1018050_1019223_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_001207660.1|1019232_1019748_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|1019802_1020105_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|1020119_1020239_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_050864224.1|1020231_1023309_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.8	0.0e+00
WP_000980414.1|1023305_1023791_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	1.8e-66
WP_001011764.1|1023787_1024888_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.2	4.6e-174
WP_000972391.1|1024978_1025197_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|1025432_1027118_-	transporter	NA	NA	NA	NA	NA
WP_000681108.1|1027387_1027765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195231.1|1027794_1028052_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201576.1|1028211_1028499_+	YbjC family protein	NA	NA	NA	NA	NA
WP_000189159.1|1028482_1029205_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|1029265_1030168_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|1030255_1030732_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126097.1|1031082_1032195_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996024.1|1032289_1033423_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
WP_000105438.1|1033432_1034386_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061657.1|1034382_1035228_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
1034945:1034960	attR	TTACGCTACCGATGAT	NA	NA	NA	NA
WP_000389260.1|1035287_1035776_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149732.1|1035816_1036944_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_001295905.1|1037118_1037850_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|1038141_1038810_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_155704941.1|1038809_1039526_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|1039532_1040264_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027195.1|1040281_1041010_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-28
WP_001270735.1|1041227_1041743_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|1041868_1042192_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255144.1|1042188_1043019_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001307082.1|1043015_1044029_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136554.1|1044127_1045558_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566372.1|1045568_1046570_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815350.1|1046606_1048325_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
WP_000178677.1|1048457_1049426_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458809.1|1049437_1051090_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|1051233_1052133_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|1052626_1053322_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599806.1|1053747_1055406_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001355621.1|1055402_1056359_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746460.1|1056509_1057625_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188193.1|1057621_1059568_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000410785.1|1059640_1059865_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|1060187_1060508_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1060538_1062815_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|1063498_1063717_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241680.1|1064001_1064706_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP023165	Escherichia coli O22:H8 strain RM10809-3 chromosome, complete genome	5128479	1331524	1449310	5128479	holin,integrase,tRNA,capsid,portal,head,protease,terminase,lysis,tail	Escherichia_phage(44.55%)	141	1408383:1408402	1431197:1431216
WP_022581818.1|1331524_1332643_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.3	2.1e-81
WP_000003742.1|1332611_1332881_-	excisionase	NA	NA	NA	NA	NA
WP_022581375.1|1332942_1335345_-	exonuclease	NA	V5UQJ3	Shigella_phage	57.9	8.3e-176
WP_022581374.1|1335437_1335626_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|1335622_1335811_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_028985920.1|1336595_1336964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380321.1|1336975_1337128_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	1.9e-06
WP_001444087.1|1337399_1337687_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001090455.1|1337690_1337879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444086.1|1337908_1338316_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155704953.1|1338423_1338702_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	41.3	5.9e-09
WP_000705386.1|1338685_1339207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054520.1|1339187_1340153_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
WP_000790459.1|1340159_1340900_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.1	6.2e-114
WP_064506729.1|1340929_1341691_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.1	5.3e-76
WP_000017341.1|1341687_1342005_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.0	1.4e-35
WP_053294093.1|1342001_1342307_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	92.1	1.7e-49
WP_001224672.1|1342454_1342637_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_001289995.1|1342802_1343318_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	77.6	9.5e-37
WP_001398985.1|1343551_1343764_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	67.1	6.4e-16
WP_001341173.1|1343930_1344203_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	1.9e-12
WP_155704955.1|1344204_1345254_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.7	1.4e-116
WP_001204809.1|1345272_1345653_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	99.2	1.4e-66
WP_000917756.1|1345868_1346066_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
WP_155704957.1|1346216_1347275_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.9	6.8e-207
WP_001365055.1|1347657_1348617_+	Shiga toxin Stx2d subunit A	NA	Q6DWN9	Enterobacteria_phage	100.0	1.6e-175
WP_000738080.1|1348628_1348898_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_155704958.1|1349409_1351356_+	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	99.1	0.0e+00
WP_000143458.1|1351491_1351671_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1351711_1351957_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284490.1|1352034_1352250_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_001041949.1|1352253_1353045_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_001092872.1|1353556_1354090_+	lysozyme	NA	Q08J98	Stx2-converting_phage	96.0	6.2e-100
WP_072032668.1|1354608_1354794_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000348556.1|1355308_1355785_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	96.8	1.3e-80
WP_001077608.1|1355781_1357905_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|1357901_1358114_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|1358113_1359616_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001097058.1|1361671_1361998_+	DUF2190 family protein	NA	S5MQJ5	Escherichia_phage	100.0	6.1e-50
WP_022581878.1|1361990_1362272_+	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	97.8	7.9e-46
WP_022581879.1|1362274_1362898_+|tail	tail protein	tail	S5MBY4	Escherichia_phage	99.0	2.5e-100
WP_001561860.1|1362910_1363309_+	hypothetical protein	NA	S5MW30	Escherichia_phage	96.2	1.6e-68
WP_022581880.1|1363316_1364066_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	98.8	3.4e-136
WP_000479054.1|1364081_1364504_+|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	100.0	5.1e-73
WP_000532076.1|1364530_1364839_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	98.0	5.1e-54
WP_137525256.1|1364882_1367531_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.5	0.0e+00
WP_000847298.1|1367527_1367857_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_096844746.1|1367856_1368555_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.8	2.0e-130
WP_096097145.1|1368565_1369309_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	96.8	3.3e-147
WP_122995511.1|1369254_1369887_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.0	1.4e-98
WP_155704960.1|1370310_1374006_+	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	80.1	0.0e+00
WP_001270059.1|1374074_1374698_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	9.0e-66
WP_155704962.1|1374849_1376754_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	97.8	1.2e-172
WP_022581964.1|1377021_1377351_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000074988.1|1377692_1378811_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.6	1.9e-82
WP_000003742.1|1378779_1379049_-	excisionase	NA	NA	NA	NA	NA
WP_047081627.1|1379110_1381582_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000199480.1|1381677_1381866_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|1381862_1382051_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_122993314.1|1382872_1383130_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	81.6	4.1e-09
WP_000444611.1|1383602_1384247_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	25.9	6.1e-09
WP_001261756.1|1384345_1384573_+	cell division protein	NA	NA	NA	NA	NA
WP_000693921.1|1384569_1384995_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262404.1|1385063_1386095_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	70.0	5.8e-86
WP_001376360.1|1386126_1386549_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	7.4e-72
WP_000450642.1|1386582_1387308_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.4	2.0e-77
WP_001151140.1|1387323_1387758_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	60.9	2.0e-35
WP_024200898.1|1387762_1388044_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	66.7	5.7e-28
WP_029374881.1|1388040_1388340_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.9	4.8e-49
WP_001373171.1|1388368_1388524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991478.1|1388520_1388832_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	79.6	6.5e-49
WP_000829416.1|1388961_1389180_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	70.3	1.2e-06
WP_000651124.1|1389169_1389565_+	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	61.2	2.5e-37
WP_000220600.1|1389769_1390069_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	99.0	3.9e-51
WP_001260977.1|1390074_1390332_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_047090793.1|1390467_1390740_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.2e-12
WP_024200897.1|1390741_1391791_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	2.5e-108
WP_001258479.1|1391803_1392178_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.4	4.7e-38
WP_000762906.1|1392174_1392996_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	57.2	1.2e-86
WP_001365055.1|1393481_1394441_+	Shiga toxin Stx2d subunit A	NA	Q6DWN9	Enterobacteria_phage	100.0	1.6e-175
WP_000738080.1|1394452_1394722_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_096098178.1|1395233_1397180_+	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	98.3	0.0e+00
WP_000143462.1|1397315_1397495_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290207.1|1397535_1397808_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	95.6	1.3e-21
WP_000284490.1|1397888_1398104_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_096098192.1|1398107_1398899_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	86.7	4.0e-34
WP_001092874.1|1399410_1399944_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	1.4e-99
WP_062896309.1|1400100_1400283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024210595.1|1400431_1400899_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	87.7	3.6e-67
WP_000881332.1|1401010_1401625_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	68.6	1.1e-63
WP_000348556.1|1402075_1402552_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	96.8	1.3e-80
WP_047090813.1|1402548_1404672_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
WP_000102416.1|1404668_1404881_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	8.6e-29
WP_000974567.1|1404880_1406383_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	1.2e-289
1408383:1408402	attL	GCTTTTTTTATGCCTGAAAA	NA	NA	NA	NA
WP_001097065.1|1408437_1408764_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281346.1|1408756_1409038_+	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	97.8	7.9e-46
WP_047082262.1|1409040_1409664_+|tail	tail protein	tail	Q8VNN3	Enterobacteria_phage	99.0	7.5e-105
WP_000682716.1|1409676_1410075_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_155704963.1|1410082_1410196_+	hypothetical protein	NA	Q687F6	Enterobacteria_phage	89.2	1.6e-13
WP_155704965.1|1410205_1410832_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	96.6	7.3e-108
WP_000479069.1|1410851_1411283_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	65.7	6.9e-41
WP_047090811.1|1411309_1411714_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	77.5	4.5e-42
WP_155704967.1|1411703_1414316_+|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	83.9	0.0e+00
WP_000847280.1|1414312_1414642_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_137547722.1|1414641_1415340_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	99.6	3.3e-133
WP_155704969.1|1415350_1416094_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	96.8	4.3e-147
WP_123130847.1|1416039_1416672_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.5	3.3e-100
WP_155705104.1|1417641_1420596_+	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	84.0	0.0e+00
WP_000078855.1|1420794_1420935_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	93.5	8.5e-17
WP_155704971.1|1421079_1422792_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	51.7	2.6e-70
WP_047083776.1|1422801_1423014_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_001373129.1|1423025_1423700_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	3.3e-114
WP_022581964.1|1423863_1424193_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000799399.1|1424356_1425220_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|1425203_1426340_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359457.1|1426589_1427816_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|1427864_1428986_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000085265.1|1429234_1430464_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	1.5e-133
WP_000953271.1|1430838_1431027_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_000201463.1|1432305_1432485_-	hypothetical protein	NA	NA	NA	NA	NA
1431197:1431216	attR	TTTTCAGGCATAAAAAAAGC	NA	NA	NA	NA
WP_001398590.1|1432677_1433241_+	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	40.0	8.0e-13
WP_032279725.1|1433227_1433428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155704974.1|1433433_1433733_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833612.1|1433729_1435127_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.2	1.5e-113
WP_077790694.1|1435329_1435581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032270474.1|1435577_1435988_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233314.1|1435998_1436247_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_096936647.1|1436550_1437708_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	3.6e-137
WP_000504056.1|1437747_1438320_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
WP_001366055.1|1438357_1439533_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	3.7e-185
WP_001020659.1|1439529_1439868_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
WP_000134113.1|1439864_1440161_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145905.1|1440160_1440601_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000113645.1|1440890_1441247_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_096936649.1|1441230_1442892_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.2	2.2e-276
WP_052909548.1|1442905_1443187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735406.1|1443853_1445314_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1445313_1445985_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1446152_1447523_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|1447526_1448168_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001378857.1|1448203_1449310_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP023165	Escherichia coli O22:H8 strain RM10809-3 chromosome, complete genome	5128479	1555696	1623188	5128479	holin,integrase,capsid,head,protease,terminase,tail	Escherichia_phage(30.0%)	74	1548368:1548382	1566422:1566436
1548368:1548382	attL	CATATCAAGGTTAAC	NA	NA	NA	NA
WP_050864119.1|1555696_1556827_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	8.8e-104
WP_000113186.1|1556804_1557053_-	excisionase	NA	NA	NA	NA	NA
WP_136755434.1|1557117_1559589_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	4.0e-56
WP_000092839.1|1559684_1559873_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|1559869_1560058_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001365839.1|1560842_1561211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380317.1|1561222_1561375_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001003380.1|1561564_1561972_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	5.5e-24
WP_000476991.1|1562049_1562277_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705131.1|1562260_1562782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054520.1|1562762_1563728_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
WP_050864241.1|1563734_1564475_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	82.7	1.8e-113
WP_000450858.1|1564504_1565266_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	64.0	8.4e-74
WP_000215513.1|1565325_1565520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211993.1|1565861_1566413_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000882661.1|1566627_1566840_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	5.6e-28
1566422:1566436	attR	GTTAACCTTGATATG	NA	NA	NA	NA
WP_000042395.1|1566942_1567260_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001452497.1|1567848_1568076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024199763.1|1568129_1568399_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	1.2e-11
WP_000904136.1|1569462_1569825_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	2.4e-34
WP_021293385.1|1569817_1570483_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.6	4.6e-60
WP_000342737.1|1570736_1571450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917733.1|1571623_1571821_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_032308170.1|1571972_1573031_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	4.0e-207
WP_000271631.1|1573510_1573939_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000382067.1|1574635_1575361_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_062892286.1|1577225_1579190_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	78.9	6.5e-296
WP_000142780.1|1579324_1579504_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	93.2	5.4e-24
WP_001290207.1|1579544_1579817_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	95.6	1.3e-21
WP_000284506.1|1579892_1580108_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_024213848.1|1580111_1580450_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	86.4	3.0e-47
WP_001092904.1|1580486_1581020_+	lysozyme	NA	G9L6J6	Escherichia_phage	96.0	3.6e-100
WP_051694738.1|1581176_1581359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072032668.1|1581727_1581913_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000828070.1|1582313_1582640_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|1582771_1582972_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829192.1|1583013_1583379_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958387.1|1583667_1584231_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001373204.1|1584227_1585889_+|terminase	terminase large subunit	terminase	Q6H9U9	Enterobacteria_phage	99.5	0.0e+00
WP_000172990.1|1585952_1587890_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_001063099.1|1587934_1588156_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000126028.1|1590681_1591008_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	97.2	3.9e-52
WP_001007902.1|1591018_1591369_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	99.1	2.0e-59
WP_000573397.1|1591365_1591812_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	2.0e-75
WP_000133383.1|1591808_1592153_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_001275414.1|1592219_1592936_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	98.7	1.5e-125
WP_000710936.1|1592950_1593325_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	3.9e-64
WP_122993267.1|1593420_1593630_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_000212873.1|1593678_1596921_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.5	0.0e+00
WP_000343408.1|1596913_1597255_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	81.2	7.6e-51
WP_000738904.1|1597453_1598617_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.9	1.6e-140
WP_001365876.1|1598827_1599526_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.3	1.4e-131
WP_087651262.1|1599536_1600280_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	94.7	1.8e-142
WP_137573430.1|1600225_1600858_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.4	3.0e-101
WP_039264430.1|1601767_1605454_+	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	87.9	0.0e+00
WP_000078853.1|1605652_1605793_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_000290874.1|1605937_1607206_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	99.1	6.5e-55
WP_001049904.1|1607274_1607946_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	83.4	9.6e-106
WP_000211405.1|1608353_1608914_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	5.4e-54
WP_001079504.1|1609560_1610067_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|1610112_1610613_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1610698_1610878_-	general stress protein	NA	NA	NA	NA	NA
WP_000443056.1|1611258_1612065_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|1612064_1613258_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001344826.1|1613269_1614628_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763511.1|1614631_1616227_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194590.1|1616226_1617789_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1617880_1617925_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285673.1|1618062_1618944_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1618940_1619561_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|1619661_1620534_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|1620573_1621164_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559281.1|1621160_1621919_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_000422045.1|1622138_1623188_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
NZ_CP023165	Escherichia coli O22:H8 strain RM10809-3 chromosome, complete genome	5128479	1911567	1970317	5128479	integrase,capsid,head,portal,terminase,lysis,transposase,tail	Enterobacteria_phage(37.25%)	74	1942585:1942600	1975013:1975028
WP_000527797.1|1911567_1913028_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
WP_000347483.1|1913116_1914400_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1915004_1915118_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1915186_1915420_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|1915736_1916327_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1916424_1917000_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_073547402.1|1916999_1920398_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	2.4e-11
WP_050864269.1|1920462_1921062_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	2.1e-104
WP_000515751.1|1921129_1924609_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.8	0.0e+00
WP_000140764.1|1925207_1925951_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	4.5e-149
WP_001152580.1|1925956_1926655_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
WP_000847345.1|1926654_1926984_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_050864201.1|1926980_1929560_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	98.1	0.0e+00
WP_000459480.1|1929552_1929987_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
WP_155704989.1|1929968_1930391_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	1.2e-69
WP_001439072.1|1930406_1931147_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	4.0e-129
WP_000683143.1|1931154_1931550_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_000985116.1|1931546_1932125_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
WP_000752994.1|1932136_1932490_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_089634850.1|1932501_1932897_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	9.7e-58
WP_000063224.1|1932938_1933964_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_001549228.1|1934019_1934352_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_001324962.1|1935661_1937263_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.9e-309
WP_000198149.1|1937259_1937466_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_032292250.1|1937462_1939388_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453603.1|1939362_1939908_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	8.1e-95
WP_001368374.1|1940296_1940530_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1940587_1940998_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1941149_1941323_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1941494_1941650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1941729_1941795_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1941797_1941986_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1941996_1942209_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1942571_1943069_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
1942585:1942600	attL	TTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_115202626.1|1943073_1943598_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.3	5.4e-96
WP_000189916.1|1943594_1943906_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1943910_1944126_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1944879_1945095_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1945395_1945608_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1945662_1945752_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1946029_1946782_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1946795_1947845_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1947846_1948125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1948191_1948443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1948659_1948815_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1948886_1949174_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1949173_1949413_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1949437_1949743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317460.1|1949945_1950278_+	protein flxA	NA	NA	NA	NA	NA
WP_000589005.1|1950714_1952028_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000955178.1|1952205_1952388_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_001310834.1|1953694_1954051_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_001151262.1|1954047_1954470_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_000054512.1|1954510_1955476_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_000705358.1|1955456_1955978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1955961_1956192_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1956275_1956683_+	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1956849_1957005_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|1957164_1957383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329848.1|1957386_1957551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1957950_1958139_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|1958135_1958327_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_040089035.1|1958419_1960891_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	7.2e-58
WP_001296941.1|1960978_1961215_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000877001.1|1961249_1962530_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001360138.1|1962549_1962660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836079.1|1962717_1963737_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|1963748_1964963_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1965168_1965495_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|1965629_1965971_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|1966005_1966566_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1966568_1967279_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|1967386_1967692_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041535.1|1967890_1970317_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.9e-213
1975013:1975028	attR	TTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 7
NZ_CP023165	Escherichia coli O22:H8 strain RM10809-3 chromosome, complete genome	5128479	1981781	1999192	5128479	integrase,capsid,head,portal,protease,terminase	uncultured_Caudovirales_phage(100.0%)	29	1987455:1987470	2010372:2010387
WP_001260840.1|1981781_1982603_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000046661.1|1982641_1982971_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000276149.1|1982957_1983323_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001303517.1|1983429_1983600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000133415.1|1984685_1984967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127881.1|1984980_1986642_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	2.0e-277
WP_000113645.1|1986625_1986982_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001145905.1|1987271_1987712_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
1987455:1987470	attL	ATTAATCGGGATAATG	NA	NA	NA	NA
WP_000134109.1|1987711_1988008_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	64.3	6.9e-32
WP_001020659.1|1988004_1988343_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
WP_001366055.1|1988339_1989515_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	3.7e-185
WP_000504056.1|1989552_1990125_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
WP_032308183.1|1990164_1991322_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.6	1.1e-136
WP_000929753.1|1991609_1991882_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126668.1|1991892_1992303_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001294166.1|1992312_1992618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024174166.1|1992614_1992866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033817306.1|1994473_1994773_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_033817307.1|1994778_1995012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033812069.1|1995004_1995238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033817308.1|1995210_1995471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609225.1|1995460_1995673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226782.1|1995665_1995863_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000201456.1|1996032_1996212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012601535.1|1996269_1996497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000103621.1|1996715_1996895_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.5e-10
WP_000182306.1|1996952_1997156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000953271.1|1997399_1997588_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_001364183.1|1997962_1999192_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	54.9	1.9e-131
2010372:2010387	attR	ATTAATCGGGATAATG	NA	NA	NA	NA
>prophage 8
NZ_CP023165	Escherichia coli O22:H8 strain RM10809-3 chromosome, complete genome	5128479	2492408	2593008	5128479	holin,tRNA,integrase,capsid,head,portal,terminase,lysis,tail	Escherichia_phage(30.56%)	103	2540648:2540668	2590514:2590534
WP_000476011.1|2492408_2493770_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_000716757.1|2494099_2494417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|2494831_2495731_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178552.1|2495812_2496592_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844200.1|2496691_2497732_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490679.1|2497779_2499135_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_033805236.1|2499138_2499423_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182914.1|2499453_2499906_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000289788.1|2501205_2502060_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|2502369_2503422_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858484.1|2503678_2504956_+	nucleoside permease	NA	NA	NA	NA	NA
WP_000846219.1|2504952_2505957_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	1.3e-13
WP_000011973.1|2505953_2506919_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|2506892_2507639_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001427526.1|2507690_2508509_-	glycosyl hydrolase 25 family protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000822274.1|2508573_2509374_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195589.1|2509370_2510159_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|2510381_2510654_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_155705003.1|2510773_2511598_+	nickel/cobalt efflux transporter RcnA	NA	NA	NA	NA	NA
WP_000153067.1|2511816_2512155_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000945409.1|2513285_2515766_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677398.1|2515781_2516456_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|2516536_2517079_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001447395.1|2517371_2517653_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|2517915_2519025_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001295427.1|2519156_2521190_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_050864015.1|2521330_2525125_+	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_050864016.1|2525134_2528767_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636926.1|2528827_2529148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074859.1|2530330_2531419_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001292774.1|2533700_2534837_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_050864018.1|2534833_2536834_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001295429.1|2536958_2537420_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001365803.1|2537460_2537931_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	3.0e-82
WP_000598641.1|2537977_2538697_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2538693_2540379_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
2540648:2540668	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001217534.1|2540893_2541142_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	87.8	8.0e-34
WP_001373129.1|2541411_2542086_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	3.3e-114
WP_000438829.1|2542097_2542310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064506794.1|2542319_2544023_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	51.7	2.2e-69
WP_000078853.1|2544166_2544307_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_155705005.1|2544505_2548192_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	87.9	0.0e+00
WP_136755463.1|2549107_2549740_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.5	2.1e-99
WP_136755462.1|2549685_2550429_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	94.3	3.2e-142
WP_001499019.1|2550439_2551138_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.7	2.1e-132
WP_000847280.1|2551137_2551467_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_064549246.1|2551463_2554037_-|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	85.3	0.0e+00
WP_000533402.1|2554017_2554431_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479116.1|2554457_2554889_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_050864249.1|2554902_2555655_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	5.1e-132
WP_000683079.1|2555662_2556058_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974981.1|2556054_2556630_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.3	1.4e-49
WP_001204554.1|2556645_2556999_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_050864250.1|2556991_2557375_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522591.1|2557426_2558455_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000256823.1|2558512_2558860_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253979.1|2558896_2560402_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_001441764.1|2560391_2561984_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.8e-185
WP_000259002.1|2561980_2562187_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_050864251.1|2564069_2564618_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	83.5	1.6e-58
WP_001109015.1|2565287_2565830_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	100.0	1.1e-99
WP_032295775.1|2566032_2566470_-|lysis	lysis protein	lysis	A0A0P0ZFH2	Escherichia_phage	97.2	1.8e-68
WP_000443009.1|2566472_2566622_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.6	6.7e-12
WP_001056888.1|2566621_2567194_-	hypothetical protein	NA	A0A088CD55	Shigella_phage	88.4	9.0e-97
WP_000992036.1|2567468_2568002_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	97.2	7.4e-101
WP_001063217.1|2568127_2568448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136757211.1|2568427_2568772_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	78.2	1.5e-38
WP_155705007.1|2568758_2569097_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	85.3	7.1e-09
WP_000284510.1|2569100_2569316_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290208.1|2569393_2569639_-	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	100.0	8.5e-20
WP_000143459.1|2569679_2569859_-	DUF1378 family protein	NA	A0A088CBQ0	Shigella_phage	100.0	2.2e-25
WP_052918853.1|2569995_2571933_-	SASA family carbohydrate esterase	NA	S5MDQ7	Escherichia_phage	94.2	0.0e+00
WP_000752026.1|2572436_2572706_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_050864162.1|2572715_2573663_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	99.4	1.0e-169
WP_024213837.1|2574168_2574603_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	98.6	5.3e-81
WP_050864163.1|2574621_2575611_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	99.4	9.5e-195
WP_001223334.1|2575620_2576136_-	hypothetical protein	NA	V5URU3	Shigella_phage	28.7	4.6e-15
WP_050864164.1|2576151_2576949_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.9	8.3e-149
WP_000767113.1|2576968_2577358_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_050864165.1|2577354_2577681_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	4.5e-53
WP_001355692.1|2577677_2578331_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	100.0	1.1e-127
WP_001358752.1|2578330_2578825_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	100.0	8.6e-88
WP_032327019.1|2578821_2579640_-	helix-turn-helix domain-containing protein	NA	A0A0P0ZCQ6	Stx2-converting_phage	99.6	2.3e-122
WP_050864166.1|2579636_2579861_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	1.1e-37
WP_050864167.1|2579857_2580703_-	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	81.5	1.0e-125
WP_050864168.1|2580699_2581857_-	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	88.3	3.8e-187
WP_000515856.1|2581853_2582405_-	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	100.0	3.4e-101
WP_001191670.1|2582397_2582658_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZCZ7	Stx2-converting_phage	100.0	1.6e-40
WP_155705009.1|2582755_2583448_+	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	95.2	7.0e-120
WP_000135680.1|2584169_2584532_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_050864169.1|2584597_2585422_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.6e-149
WP_000008178.1|2585549_2586086_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_032179520.1|2586076_2586427_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	98.3	4.6e-59
WP_077793337.1|2586390_2586960_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	67.2	2.9e-63
WP_001452608.1|2587144_2587477_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	97.3	3.2e-62
WP_000628767.1|2587473_2588418_+	hypothetical protein	NA	A0A0H4IU61	Shigella_phage	58.6	2.6e-80
WP_000457723.1|2588502_2588745_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_001193437.1|2588901_2589156_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_050864170.1|2589189_2590491_+|integrase	site-specific integrase	integrase	A0A0N7KZF5	Stx2-converting_phage	99.5	1.1e-251
WP_042101647.1|2590511_2591198_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.8e-102
2590514:2590534	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216961.1|2591257_2591365_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2591345_2592077_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569361.1|2592081_2593008_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 9
NZ_CP023165	Escherichia coli O22:H8 strain RM10809-3 chromosome, complete genome	5128479	3229425	3236565	5128479		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|3229425_3231987_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141330.1|3232092_3232749_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001297141.1|3232799_3233567_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3233762_3234671_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590388.1|3234667_3235930_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	5.7e-136
WP_001278994.1|3235926_3236565_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 1
NZ_CP023164	Escherichia coli O22:H8 strain RM10809-3 plasmid pRM10809-3, complete sequence	122641	102193	107608	122641	integrase	Cronobacter_phage(28.57%)	9	103973:103985	109570:109582
WP_000618108.1|102193_102442_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	46.7	4.1e-14
WP_000109074.1|102438_102876_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	3.7e-26
WP_001365565.1|102875_103868_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	59.5	8.0e-101
WP_001365560.1|103897_104146_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	59.0	1.5e-19
103973:103985	attL	CCCCGTAAAAACA	NA	NA	NA	NA
WP_000340836.1|104150_104543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103695.1|104547_105519_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	1.3e-66
WP_000633912.1|105747_106392_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	1.9e-39
WP_000239527.1|106385_106661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016958.1|106798_107608_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
109570:109582	attR	CCCCGTAAAAACA	NA	NA	NA	NA
