The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046283	Salmonella enterica strain FDAARGOS_687 chromosome, complete genome	4884738	434596	475331	4884738	lysis,holin,portal,plate,tail,tRNA,head,terminase,capsid,integrase	Salmonella_phage(51.06%)	51	437983:438000	439684:439701
WP_000478472.1|434596_436162_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
WP_000983441.1|436158_436806_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000213760.1|437037_437805_+	siderophore-interacting protein	NA	NA	NA	NA	NA
437983:438000	attL	GTTTGCCAATGTTTGCCA	NA	NA	NA	NA
WP_000290960.1|438021_439044_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	87.9	3.5e-176
WP_000345246.1|439043_439616_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	93.1	1.1e-99
WP_000135596.1|439747_440011_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	90.8	8.5e-42
439684:439701	attR	TGGCAAACATTGGCAAAC	NA	NA	NA	NA
WP_000459332.1|440041_440551_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	98.8	6.2e-89
WP_000920169.1|440558_440759_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	100.0	1.2e-32
WP_000963463.1|440722_441061_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	94.6	7.3e-54
WP_000092339.1|441125_441359_+	DUF2732 domain-containing protein	NA	Q6K1F6	Salmonella_virus	88.3	4.3e-29
WP_000752599.1|441358_441586_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	91.7	2.0e-31
WP_000849968.1|441582_442167_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	67.7	4.0e-68
WP_000058620.1|442163_442436_+	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	78.9	2.1e-35
WP_001232572.1|442432_442714_+	DUF3850 domain-containing protein	NA	A0A0P0I3U9	Klebsiella_phage	52.6	2.0e-12
WP_001266445.1|442704_444948_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	95.3	0.0e+00
WP_000373436.1|445064_445505_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	92.0	1.8e-65
WP_000381893.1|445584_446316_+	hypothetical protein	NA	Q37850	Escherichia_phage	94.7	1.8e-129
WP_024132455.1|446495_446705_+	hypothetical protein	NA	Q6K1F0	Salmonella_virus	94.2	8.2e-32
WP_001161212.1|446778_447717_-	hypothetical protein	NA	Q2P9W7	Enterobacteria_phage	77.6	9.8e-141
WP_000517963.1|448149_449196_-|portal	phage portal protein	portal	S4TNX7	Salmonella_phage	98.6	4.8e-189
WP_000156060.1|449195_450965_-|terminase	terminase ATPase subunit family protein	terminase	S4TT96	Salmonella_phage	99.0	0.0e+00
WP_001085931.1|451130_451985_+|capsid	capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	98.6	1.2e-156
WP_001247240.1|452061_453129_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.2	1.3e-197
WP_000203471.1|453132_453882_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	97.2	6.4e-127
WP_000214256.1|453975_454482_+|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	99.4	3.8e-91
WP_000868400.1|454481_454685_+|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	100.0	3.6e-32
WP_000134659.1|454688_454985_+|holin	holin	holin	S4TP56	Salmonella_phage	100.0	4.4e-47
WP_001144118.1|454971_455469_+	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	98.8	5.8e-92
WP_000866104.1|455465_455879_+|lysis	LysB family phage lysis regulatory protein	lysis	S4TRW3	Salmonella_phage	99.3	2.9e-44
WP_077941258.1|455850_456024_+|lysis	phage lysis protein	lysis	S4TNY4	Salmonella_phage	96.5	3.1e-24
WP_001169074.1|455986_456454_+|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	100.0	1.1e-84
WP_001293104.1|456446_456896_+	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	98.7	5.5e-73
WP_001094750.1|456964_457606_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	100.0	4.8e-115
WP_000127147.1|457602_457950_+|plate	baseplate assembly protein	plate	S4TRW8	Salmonella_phage	99.1	1.6e-56
WP_000246677.1|457956_458865_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	100.0	2.6e-162
WP_001000068.1|458857_459388_+|tail	phage tail protein I	tail	S4TTA8	Salmonella_phage	100.0	9.2e-104
WP_000104698.1|459398_461492_+|tail	tail protein	tail	A0A1B0VFW4	Salmonella_phage	94.5	5.8e-218
WP_086935187.1|461461_462082_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	86.7	6.8e-98
WP_001279029.1|462250_463438_+|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	99.5	2.9e-222
WP_001207675.1|463453_463972_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_001029726.1|464034_464370_+|tail	phage tail assembly protein	tail	S4TTB2	Salmonella_phage	100.0	1.4e-52
WP_085984508.1|464366_464522_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_000069526.1|464514_466956_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	91.6	0.0e+00
WP_000978859.1|466970_467456_+|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	99.4	3.9e-85
WP_000627822.1|467452_468622_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	97.7	6.6e-211
WP_000468307.1|468688_468907_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	98.6	9.5e-39
WP_000237776.1|469266_469773_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|469896_471744_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918865.1|471893_473639_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|473874_474090_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264394.1|474317_475331_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
>prophage 2
NZ_CP046283	Salmonella enterica strain FDAARGOS_687 chromosome, complete genome	4884738	930163	952795	4884738	transposase,integrase	Escherichia_phage(60.0%)	22	932847:932906	952800:953622
WP_001067855.1|930163_930868_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001387387.1|930914_931316_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|931465_932326_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
932847:932906	attL	CGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|932910_933615_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|934370_935222_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|935529_936345_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|936405_937209_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|937208_938045_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000845049.1|938016_939135_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.7	1.5e-71
WP_000777555.1|939291_939765_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	33.8	3.7e-19
WP_001206317.1|939857_940649_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|940812_941160_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|941153_941993_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|942120_942621_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001163403.1|942796_943579_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_001324342.1|943568_945092_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000059618.1|945193_945922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001611016.1|946003_946282_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_000928197.1|946289_946541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000412211.1|948065_948725_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|948925_949303_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|952090_952795_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
952800:953622	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGATAATTATCCAGAAATGCCGCCCGCAAAGGCTCGCTAAAGCGAGCCTTTGCGGGTGTAGATTTTAATTGTTCTGATGGTTCAAACCACGCTATCTCAGCCGTACCTAAAATACTTAAACGAACAGAATTGGGTATGCAGAATGATCTAACGCACCATGCGGAATGTTACTCTGATGCCGGACGCAGCTCCTCTGGATCCAGAAACGAAAAAATATGCCAGTTCTCCCAGGCAAGAAGAAAATCAGGAAGAGCTAAACAAAACGAATTGACAGCCACAATGGCGCACTTATCTCCCTTACCCTTAAAGGCCTTTAAAGGCCCTTTAGCGAGCTTTTGCGGGCGTAGCATTATTCGAGCCAAAGTTGGCTGAAATCCGGCCATCCCAGCGTATTTAAATCCCGCCAGGTAAATGACTTCTCAGTCGCAAATTCCATCCAGTGATGCAGCAAAGGAATGACATATCGCTGGTGGGTCATCTCATGGAAAAAGGCGGCAATGGTAGCGAACGCCTGTTCATCGTCGCTGTTTAGAATCGTCGGTAACAGCGCGTTCAGGTTTTGTCGCTGGGATTCAGGCAGTCGTGTAAACAGCGCGGTGGAAGCTAGCCATTCCAGAAATGCCGGAACCGAAAGGGTATCGAGCATAAAGTTGCTGAGCCAGATATCCGCGGGAGGGCGCAGCTGGTTGTTAAAGTGGTCAAATGCGTCGATCCGTATTTCGGCGCGAATATGCCAGCGTTCAAGCAGGCGGCGAATTGCTCCGG	NA	NA	NA	NA
>prophage 3
NZ_CP046283	Salmonella enterica strain FDAARGOS_687 chromosome, complete genome	4884738	1030387	1107128	4884738	lysis,holin,portal,transposase,tail,tRNA,head,terminase,capsid,integrase,protease	Salmonella_phage(36.84%)	90	1022468:1022484	1112975:1112991
1022468:1022484	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997368.1|1030387_1031425_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1031540_1032230_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1032548_1032932_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1032993_1033581_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1033683_1034583_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1034600_1035935_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1036065_1036803_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|1036787_1038410_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1038673_1038838_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1038834_1039410_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1039441_1040092_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1040091_1041048_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1041044_1041524_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1042021_1043251_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|1043228_1043513_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1043553_1043793_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|1043835_1044993_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017123.1|1044955_1047883_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_001539619.1|1048009_1048360_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1048381_1048540_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_000950426.1|1048996_1049659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356948.1|1049658_1050045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111772.1|1050037_1050877_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000660736.1|1050935_1051331_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_000643689.1|1051430_1051673_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_010835408.1|1051632_1052007_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000024044.1|1052098_1052983_+	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_000801766.1|1052979_1053675_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000664368.1|1053688_1054387_+	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000877757.1|1054494_1055127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1055369_1055603_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1055719_1055968_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929794.1|1056002_1056605_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.4e-108
WP_001096550.1|1056813_1057425_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1057421_1057562_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1057558_1058236_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|1058508_1059072_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1059578_1059767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1059981_1060668_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1060943_1061273_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|1061256_1061709_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001533543.1|1061726_1062179_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1062414_1062816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1063102_1063648_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1063619_1065551_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1065534_1065738_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1065734_1067315_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1067304_1068801_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1068813_1069161_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1069215_1070244_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1070301_1070661_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|1070671_1071055_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1071082_1071661_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1071709_1072840_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1072948_1073350_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|1073357_1074104_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1074154_1074550_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1074546_1074885_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372065.1|1074856_1077952_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_000447369.1|1077954_1078284_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1078293_1078992_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1078998_1079736_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1079633_1080281_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514920.1|1080342_1083705_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.6	0.0e+00
WP_000178849.1|1083743_1083986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144680.1|1084039_1086412_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	4.8e-91
WP_000593433.1|1086408_1087233_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1087222_1087801_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1087897_1088125_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1088231_1088444_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_015701342.1|1088506_1088572_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_015589559.1|1089151_1089316_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1090028_1090166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1090650_1092144_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1092548_1094348_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1094364_1095339_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1095612_1096293_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1096289_1097195_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1097206_1097935_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1097946_1098678_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1098677_1099058_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1099169_1099430_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1099467_1100394_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276370.1|1100509_1101706_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684022.1|1101727_1102645_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1102683_1103532_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1103647_1104541_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361664.1|1104551_1105913_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000253558.1|1105916_1106552_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1106576_1107128_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1112975:1112991	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 4
NZ_CP046283	Salmonella enterica strain FDAARGOS_687 chromosome, complete genome	4884738	1461280	1490883	4884738	tail,holin,protease	Salmonella_phage(41.67%)	31	NA	NA
WP_000781589.1|1461280_1461775_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1462188_1462680_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1462669_1462933_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1462929_1465416_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1465422_1466118_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013530.1|1466104_1466974_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1467089_1467539_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1467548_1468151_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1468171_1468789_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	2.2e-11
WP_000990028.1|1468785_1469445_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1469496_1470234_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1470230_1470443_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1470439_1470919_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1470915_1472847_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1472843_1473401_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001238333.1|1473397_1474441_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1474484_1475132_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1475861_1476425_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1476616_1476820_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1477122_1477914_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1478210_1478414_+|tail	tail protein	tail	NA	NA	NA	NA
WP_014343868.1|1478582_1480949_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.0	3.2e-71
WP_001202279.1|1481277_1482267_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1482281_1482650_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001120499.1|1484307_1484637_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1485229_1486471_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1486473_1487001_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1487378_1487822_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1487875_1489705_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1490061_1490352_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1490379_1490883_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 5
NZ_CP046283	Salmonella enterica strain FDAARGOS_687 chromosome, complete genome	4884738	1562934	1572105	4884738	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1562934_1563882_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|1563865_1564597_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1564577_1564685_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1564744_1565476_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1565698_1567384_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1567380_1568100_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1568146_1568614_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1568670_1569201_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703138.1|1569372_1569831_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	71.9	3.2e-52
WP_000195332.1|1570071_1572105_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 6
NZ_CP046283	Salmonella enterica strain FDAARGOS_687 chromosome, complete genome	4884738	1640413	1650919	4884738		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1640413_1641817_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1641994_1642888_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1643264_1644350_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1644349_1645249_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1645296_1646175_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1646175_1646727_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1646732_1647725_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1647721_1648495_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1648499_1649579_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1649605_1650919_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 7
NZ_CP046283	Salmonella enterica strain FDAARGOS_687 chromosome, complete genome	4884738	1736913	1787673	4884738	lysis,holin,portal,plate,tail,head,terminase,capsid,integrase,protease	Salmonella_phage(89.06%)	69	1731491:1731505	1747967:1747981
1731491:1731505	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|1736913_1737387_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001738920.1|1738034_1738325_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_000598920.1|1738696_1739494_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|1739785_1740775_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000414876.1|1740776_1741019_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_001061334.1|1741043_1741613_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000208068.1|1741616_1742450_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_000065095.1|1742446_1743064_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000071070.1|1743060_1743576_-	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000764235.1|1743572_1743803_-	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000008351.1|1743873_1744413_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080415.1|1744549_1745377_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000997190.1|1745434_1745806_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_001020636.1|1746620_1747316_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001191666.1|1747413_1747638_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|1747666_1748221_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
1747967:1747981	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087402.1|1748217_1749375_+	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000620702.1|1749371_1749596_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000061500.1|1749592_1750411_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_001684745.1|1750412_1750895_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000066908.1|1750894_1751788_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001241579.1|1751784_1752174_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_001061457.1|1752190_1753051_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001202277.1|1753058_1754048_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	4.9e-191
WP_000188927.1|1754058_1754682_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_001527054.1|1754814_1755072_+	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_014343859.1|1755001_1755436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001527046.1|1755597_1755942_+|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_001005901.1|1755944_1756559_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001050825.1|1756555_1757041_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_000877027.1|1757253_1757673_+	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001292890.1|1757892_1758195_+	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_001135225.1|1758255_1758606_+	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_000929191.1|1758731_1759226_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_000088182.1|1759222_1760956_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000605609.1|1760967_1761150_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466254.1|1761149_1762391_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_001193639.1|1762368_1763019_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000257528.1|1763033_1764239_+|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_000601353.1|1764289_1764490_+	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000927378.1|1764492_1764816_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000702408.1|1764812_1765217_+|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_001135697.1|1765188_1765701_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000779218.1|1765697_1766258_+	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_000497739.1|1766261_1766426_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_001007991.1|1766415_1767912_+|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000515952.1|1767911_1768268_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588852.1|1768264_1768591_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785385.1|1768675_1770604_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000863818.1|1770637_1771978_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_001066636.1|1771974_1773033_+	hypothetical protein	NA	Q8HAC0	Salmonella_phage	100.0	1.3e-202
WP_001273649.1|1773032_1773566_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605050.1|1773570_1773984_+	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_014343856.1|1773955_1774501_+	phage protein	NA	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_014343855.1|1774535_1775057_+|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	100.0	2.9e-94
WP_001207832.1|1775059_1775647_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554737.1|1775633_1777196_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	100.0	2.6e-287
WP_000760554.1|1777195_1777765_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
WP_000492926.1|1778049_1779057_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_001526483.1|1779269_1779491_+	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000500831.1|1780121_1780283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|1780409_1780829_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|1780831_1782100_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|1782554_1782767_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1782777_1782966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080679.1|1783226_1784432_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	54.9	2.8e-108
WP_000107430.1|1785082_1785382_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|1785473_1786169_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|1786242_1787673_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 8
NZ_CP046283	Salmonella enterica strain FDAARGOS_687 chromosome, complete genome	4884738	2671810	2757312	4884738	lysis,holin,portal,transposase,tRNA,tail,terminase,integrase,protease	Salmonella_phage(41.82%)	92	2695904:2695923	2768458:2768477
WP_000938191.1|2671810_2672491_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2673111_2673771_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2673857_2674187_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2674183_2674465_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2674513_2675293_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|2675318_2675867_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2676081_2677293_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2677350_2677668_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|2677712_2678129_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2678299_2678962_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2679056_2679515_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2679550_2681605_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2681728_2682175_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2682193_2684347_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2684333_2684939_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2685155_2685665_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2686021_2687074_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2687145_2687598_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156453.1|2687783_2689544_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2689612_2690131_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2690230_2690398_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2690653_2691217_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2691213_2692854_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2692858_2694112_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2694126_2696034_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2695904:2695923	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086486.1|2696046_2698155_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2698253_2699363_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2699359_2699902_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2700067_2701078_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2701285_2703898_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2704324_2704516_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2704786_2705473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|2705457_2705757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2705825_2706452_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_103100870.1|2707099_2707279_-	hypothetical protein	NA	Q9MBL9	Phage_Gifsy-2	100.0	9.6e-13
WP_001067855.1|2707269_2707974_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_156004609.1|2707864_2708896_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	1.5e-174
WP_000143167.1|2709371_2709953_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001144679.1|2709952_2712391_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000178849.1|2712444_2712687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000033416.1|2712725_2716076_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.5	0.0e+00
WP_000246065.1|2716147_2716852_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|2716749_2717487_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2717496_2718192_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2718281_2718815_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2718931_2719429_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|2719527_2719860_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_010989010.1|2719856_2722844_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|2722923_2723253_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478860.1|2723249_2723648_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.1	6.6e-30
WP_000132756.1|2723693_2724443_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196701.1|2724454_2724856_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.2	2.6e-42
WP_000453194.1|2724852_2725419_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|2725399_2725699_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2725691_2726015_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|2726105_2728187_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_077679777.1|2728110_2729628_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_000196190.1|2729654_2729861_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|2729857_2731996_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371785.1|2731952_2732486_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.3e-33
WP_001541990.1|2732693_2733173_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_014343824.1|2733190_2733643_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	96.6	5.1e-79
WP_001574216.1|2733626_2733956_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|2734231_2734918_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2735278_2735728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2735863_2735989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|2736545_2737343_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|2737332_2737479_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|2737475_2738087_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_000929805.1|2738295_2738898_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|2738980_2739202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2739313_2739547_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|2739838_2740129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|2740206_2740518_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|2740514_2740862_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|2740872_2741622_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_001574095.1|2742631_2743006_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|2742971_2743211_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|2743330_2743741_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_014343821.1|2743790_2744051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|2744043_2744202_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001668146.1|2744223_2744523_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000017118.1|2744649_2747535_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.2	0.0e+00
WP_001539618.1|2747497_2748655_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2748697_2748937_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2748977_2749226_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|2749270_2750563_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191399.1|2750757_2751960_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|2752037_2753474_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|2753718_2754933_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|2755249_2755711_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2755911_2757312_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
2768458:2768477	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
>prophage 9
NZ_CP046283	Salmonella enterica strain FDAARGOS_687 chromosome, complete genome	4884738	2821478	2830208	4884738	transposase,protease	Enterobacteria_phage(16.67%)	6	NA	NA
WP_085983316.1|2821478_2822733_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|2823196_2823655_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|2823846_2826123_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2826153_2826474_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2826797_2827019_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_001201749.1|2829089_2830208_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 10
NZ_CP046283	Salmonella enterica strain FDAARGOS_687 chromosome, complete genome	4884738	3436365	3479778	4884738	lysis,portal,coat,terminase,integrase,protease	Salmonella_virus(67.21%)	61	3427090:3427106	3488993:3489009
3427090:3427106	attL	ACGCGAATTTCAATATC	NA	NA	NA	NA
WP_014343801.1|3436365_3438288_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	100.0	0.0e+00
WP_001280422.1|3438327_3440313_-	endorhamnosidase	NA	A0A1R3Y5S2	Salmonella_virus	100.0	0.0e+00
WP_000868978.1|3440468_3442436_-	hypothetical protein	NA	A0A1R3Y5Q1	Salmonella_virus	100.0	0.0e+00
WP_050772884.1|3442435_3443773_-	DNA transfer protein	NA	A0A1R3Y5Q4	Salmonella_virus	100.0	1.0e-244
WP_000964892.1|3443815_3444505_-	hypothetical protein	NA	A0A1R3Y5P8	Salmonella_virus	100.0	4.0e-91
WP_000627700.1|3444507_3444963_-	DUF2824 family protein	NA	A0A1R3Y5P3	Salmonella_virus	100.0	1.8e-87
WP_000774926.1|3444962_3445664_-	hypothetical protein	NA	A0A1R3Y5X6	Salmonella_virus	100.0	1.2e-74
WP_001122423.1|3445667_3447086_-	Packaged DNA stabilization protein gp10	NA	E7C9U1	Salmonella_phage	99.4	4.6e-275
WP_001166103.1|3447045_3447546_-	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_000538676.1|3447529_3448090_-	hypothetical protein	NA	A0A1R3Y5P2	Salmonella_virus	100.0	1.1e-102
WP_001196932.1|3448130_3449423_-|coat	coat protein	coat	A0A1R3Y5Q0	Salmonella_virus	100.0	1.1e-243
WP_000433856.1|3449422_3450334_-	scaffold protein	NA	A0A1R3Y5R6	Salmonella_virus	100.0	4.9e-161
WP_000774719.1|3450347_3452525_-|portal	portal protein	portal	A0A1R3Y5N6	Salmonella_virus	100.0	0.0e+00
WP_000417855.1|3452524_3454024_-|terminase	terminase	terminase	A0A1R3Y5N2	Salmonella_virus	100.0	2.8e-307
WP_000729927.1|3454001_3454490_-	hypothetical protein	NA	A3EYX3	Salmonella_phage	100.0	2.9e-88
WP_000252708.1|3454513_3454693_-	hypothetical protein	NA	A0A2H4A350	Salmonella_phage	100.0	1.1e-24
WP_000807793.1|3454694_3454937_-	DUF2560 family protein	NA	A0A1R3Y5V5	Salmonella_virus	100.0	1.7e-36
WP_001279869.1|3455244_3455505_+	hypothetical protein	NA	A0A089FW14	Salmonella_phage	100.0	6.6e-39
WP_000881329.1|3455766_3456372_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	100.0	1.4e-111
WP_024132441.1|3456521_3456959_-|lysis	lysis protein	lysis	A0A1R3Y6Z8	Salmonella_virus	100.0	1.8e-73
WP_024132440.1|3457047_3457545_-	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	100.0	1.7e-91
WP_000286100.1|3457522_3457726_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_000027547.1|3458190_3458709_-	DUF1133 family protein	NA	A0A1R3Y5U9	Salmonella_virus	100.0	2.0e-95
WP_000219141.1|3458705_3458885_-	hypothetical protein	NA	E7C9S6	Salmonella_phage	94.9	1.3e-22
WP_000188966.1|3458865_3459069_-	protein ninH	NA	A0A1R3Y5V4	Salmonella_virus	100.0	1.6e-32
WP_000034927.1|3459065_3459290_-	hypothetical protein	NA	A0A1R3Y5U5	Salmonella_virus	100.0	1.3e-38
WP_001108030.1|3459286_3459898_-	recombination protein NinG	NA	A3EYW8	Salmonella_phage	100.0	9.3e-100
WP_000566860.1|3459890_3460061_-	protein ninF	NA	A0A1R3Y5V0	Salmonella_virus	100.0	2.5e-26
WP_000113766.1|3460057_3460240_-	NinE family protein	NA	C6ZR57	Salmonella_phage	100.0	5.7e-29
WP_000815503.1|3460376_3460823_-	recombination protein NinB	NA	A0A1R3Y605	Salmonella_virus	100.0	7.1e-81
WP_001277267.1|3460779_3460968_-	hypothetical protein	NA	A0A1R3Y6Z7	Salmonella_virus	100.0	4.2e-27
WP_024132439.1|3460970_3461264_-	hypothetical protein	NA	A0A1R3Y5V7	Salmonella_virus	100.0	1.2e-47
WP_000654039.1|3461494_3461767_-	DUF4752 family protein	NA	A0A1R3Y5T8	Salmonella_virus	100.0	7.2e-44
WP_001036040.1|3461838_3462108_-	hypothetical protein	NA	A0A1R3Y5U7	Salmonella_virus	100.0	6.4e-45
WP_001248408.1|3462104_3463481_-	AAA family ATPase	NA	A0A1R3Y5T0	Salmonella_virus	100.0	1.5e-254
WP_000067074.1|3463477_3464311_-	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	100.0	3.8e-152
WP_001125981.1|3464303_3464450_-	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_001103492.1|3464484_3464766_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000182204.1|3464876_3465092_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|3465202_3465892_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_000248006.1|3465980_3466904_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	100.0	1.5e-181
WP_000786969.1|3466939_3467149_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	91.3	5.5e-28
WP_000216172.1|3467512_3467845_+	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	100.0	2.2e-55
WP_000246164.1|3467923_3468124_+	Restriction inhibitor protein ral	NA	A0A1R3Y5S4	Salmonella_virus	100.0	1.0e-31
WP_014343793.1|3468163_3468463_+	hypothetical protein	NA	A0A1R3Y5U4	Salmonella_virus	100.0	2.3e-51
WP_001200113.1|3468786_3468939_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A1R3Y5R2	Salmonella_virus	100.0	2.7e-24
WP_000156730.1|3468919_3469108_+	hypothetical protein	NA	A0A1R3Y5S5	Salmonella_virus	100.0	1.6e-31
WP_001046981.1|3469237_3469945_+	recombinase	NA	A0A1R3Y600	Salmonella_virus	100.0	4.1e-139
WP_001253476.1|3469944_3470229_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111312.1|3470275_3470569_+	DUF2856 family protein	NA	A0A1R3Y5T7	Salmonella_virus	100.0	3.2e-50
WP_001214771.1|3470579_3470750_+	DUF2737 family protein	NA	A0A220NQV6	Salmonella_phage	100.0	6.1e-25
WP_000665854.1|3470746_3471157_+	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	100.0	5.9e-74
WP_001017880.1|3471153_3471798_+	ead/Ea22-like family protein	NA	A0A1R3Y5T1	Salmonella_virus	100.0	2.3e-117
WP_000582225.1|3471797_3472553_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	100.0	2.9e-151
WP_000208072.1|3472563_3473529_+	DUF550 domain-containing protein	NA	A0A1R3Y5Q8	Salmonella_virus	100.0	2.9e-172
WP_000002128.1|3473521_3473806_+	ASCH domain-containing protein	NA	A0A1R3Y5R3	Salmonella_virus	100.0	4.1e-50
WP_128190834.1|3473874_3474471_+	hypothetical protein	NA	A0A1R3Y5P7	Salmonella_virus	100.0	3.2e-113
WP_000051899.1|3474708_3475872_+|integrase	site-specific integrase	integrase	A0A192Y6Q1	Salmonella_phage	99.7	4.1e-229
WP_000893231.1|3476077_3477328_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001285275.1|3477339_3478443_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|3478725_3479778_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
3488993:3489009	attR	ACGCGAATTTCAATATC	NA	NA	NA	NA
>prophage 11
NZ_CP046283	Salmonella enterica strain FDAARGOS_687 chromosome, complete genome	4884738	4236460	4280978	4884738	tail,plate,tRNA	Burkholderia_phage(42.86%)	46	NA	NA
WP_001182237.1|4236460_4237459_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4237546_4238857_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4239103_4239619_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4239717_4239927_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4239948_4240062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4240058_4241384_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4241562_4242171_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4242279_4242648_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017359.1|4242818_4245239_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4245337_4246210_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4246223_4246721_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4246901_4247819_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4247982_4249341_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4249429_4250539_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4250900_4252091_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4252222_4253767_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4253781_4254672_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4254837_4255248_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4255390_4257487_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4257486_4258224_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_014343934.1|4258220_4258889_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4258922_4259165_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4259608_4261258_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4261602_4262952_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4263084_4263432_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4264007_4264295_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4264297_4264903_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4264915_4265230_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4265389_4265845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4265841_4266039_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4266028_4267456_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4267455_4267980_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4268031_4268349_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4268308_4268437_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262500.1|4268533_4270888_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_000271423.1|4270887_4271841_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4271840_4272050_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4272037_4273081_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4273090_4273813_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4274140_4274503_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4274499_4275429_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4275428_4276976_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4277139_4277499_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4277489_4278605_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4278597_4279230_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4279232_4280978_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
>prophage 1
NZ_CP046282	Salmonella enterica strain FDAARGOS_687 plasmid unnamed1, complete sequence	94642	59969	69265	94642	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_000088645.1|59969_60650_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
WP_000369839.1|61031_61388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490265.1|61380_61851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000925627.1|62361_62784_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000457541.1|62783_64058_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_001541561.1|64139_65117_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
WP_000427676.1|65113_66319_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728917.1|66733_67675_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_001541562.1|67706_68273_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|68329_68665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|68848_69265_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
>prophage 1
NZ_CP046284	Salmonella enterica strain FDAARGOS_687 plasmid unnamed2, complete sequence	87018	0	3994	87018		Morganella_phage(33.33%)	4	NA	NA
WP_000109071.1|924_1362_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_019842136.1|1358_1607_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	5.4e-14
WP_156004650.1|2000_2927_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086148.1|3310_3994_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.1e-29
>prophage 2
NZ_CP046284	Salmonella enterica strain FDAARGOS_687 plasmid unnamed2, complete sequence	87018	7748	15835	87018	transposase	Xanthomonas_phage(16.67%)	10	NA	NA
WP_001276121.1|7748_8276_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	1.6e-47
WP_001042948.1|8332_8566_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	51.1	1.5e-05
WP_156004654.1|8627_10586_+	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	27.3	5.4e-24
WP_156004677.1|10640_11075_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276261.1|11071_11791_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000978012.1|11787_12384_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	61.9	3.1e-15
WP_156004655.1|12846_13347_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.3	7.1e-05
WP_000218863.1|14075_14510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156004656.1|14601_14868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156004657.1|14932_15835_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	9.0e-67
>prophage 3
NZ_CP046284	Salmonella enterica strain FDAARGOS_687 plasmid unnamed2, complete sequence	87018	43931	48339	87018		Pseudomonas_phage(50.0%)	2	NA	NA
WP_156004667.1|43931_47699_-	DNA primase	NA	A0A1B0VML8	Pseudomonas_phage	29.4	1.0e-18
WP_000014584.1|47787_48339_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	1.5e-19
>prophage 4
NZ_CP046284	Salmonella enterica strain FDAARGOS_687 plasmid unnamed2, complete sequence	87018	51453	58411	87018	integrase	Escherichia_phage(33.33%)	8	43081:43095	66497:66511
43081:43095	attL	CCAGAACGCCAGCAC	NA	NA	NA	NA
WP_000977525.1|51453_52038_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	39.8	7.7e-11
WP_000976351.1|52097_53300_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_022630873.1|53385_54210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063082698.1|54360_55515_-|integrase	integrase	integrase	B5WZU7	Pseudomonas_phage	43.0	1.0e-46
WP_156004681.1|55672_55921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096978853.1|55917_57210_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_001401940.1|57209_57866_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_000014005.1|57850_58411_-	lytic transglycosylase domain-containing protein	NA	A0A0A8J856	Ralstonia_phage	33.7	6.1e-05
66497:66511	attR	CCAGAACGCCAGCAC	NA	NA	NA	NA
>prophage 5
NZ_CP046284	Salmonella enterica strain FDAARGOS_687 plasmid unnamed2, complete sequence	87018	70133	70397	87018		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001324596.1|70133_70397_-	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	54.0	6.1e-08
>prophage 6
NZ_CP046284	Salmonella enterica strain FDAARGOS_687 plasmid unnamed2, complete sequence	87018	73600	73888	87018		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000222775.1|73600_73888_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.5	1.7e-19
>prophage 7
NZ_CP046284	Salmonella enterica strain FDAARGOS_687 plasmid unnamed2, complete sequence	87018	82856	86258	87018	integrase	Macacine_betaherpesvirus(50.0%)	4	74713:74724	85996:86007
74713:74724	attL	TTTATAATGCTG	NA	NA	NA	NA
WP_000016497.1|82856_83645_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	4.1e-55
WP_001144036.1|83824_84469_+	ParA family protein	NA	NA	NA	NA	NA
WP_000030199.1|84555_84864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688514.1|85277_86258_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
85996:86007	attR	TTTATAATGCTG	NA	NA	NA	NA
