The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046291	Salmonella enterica strain FDAARGOS_712 chromosome, complete genome	4668186	53240	60501	4668186		Escherichia_phage(42.86%)	9	NA	NA
WP_000497451.1|53240_53480_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_058331232.1|53697_53862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156010125.1|54359_55178_+	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	48.5	4.3e-60
WP_001277616.1|55250_55628_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158843.1|55776_56319_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_156010126.1|56510_57239_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	6.4e-63
WP_058331234.1|57255_57669_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	39.5	8.4e-20
WP_058331235.1|58101_58494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000444508.1|59250_60501_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 2
NZ_CP046291	Salmonella enterica strain FDAARGOS_712 chromosome, complete genome	4668186	310508	317522	4668186	protease,transposase	Saccharomonospora_phage(16.67%)	6	NA	NA
WP_000502119.1|310508_310967_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934064.1|311158_313435_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|313465_313786_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|314109_314331_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|314460_316407_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|316403_317522_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 3
NZ_CP046291	Salmonella enterica strain FDAARGOS_712 chromosome, complete genome	4668186	3736215	3745386	4668186	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|3736215_3737163_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_156010570.1|3737146_3737878_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_001261696.1|3737858_3737966_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|3738025_3738757_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|3738979_3740665_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|3740661_3741381_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|3741427_3741895_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_069721497.1|3741951_3742482_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|3742653_3743112_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195343.1|3743352_3745386_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 4
NZ_CP046291	Salmonella enterica strain FDAARGOS_712 chromosome, complete genome	4668186	3812978	3823485	4668186		Enterobacteria_phage(37.5%)	10	NA	NA
WP_080160206.1|3812978_3814382_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.3	3.1e-21
WP_000981469.1|3814559_3815453_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_156010579.1|3815829_3816915_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	2.1e-102
WP_001023659.1|3816914_3817814_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|3817861_3818740_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_076726835.1|3818740_3819292_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	1.3e-52
WP_076726833.1|3819297_3820272_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|3820287_3821061_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_076726832.1|3821065_3822145_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.9	1.7e-16
WP_076726830.1|3822171_3823485_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	4.1e-52
>prophage 5
NZ_CP046291	Salmonella enterica strain FDAARGOS_712 chromosome, complete genome	4668186	3920911	3928180	4668186		Morganella_phage(33.33%)	8	NA	NA
WP_023200548.1|3920911_3921331_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_064013310.1|3921333_3922602_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.4	1.9e-227
WP_000208509.1|3923057_3923270_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|3923280_3923469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080675.1|3923728_3924940_-	porin	NA	Q1MVN1	Enterobacteria_phage	56.0	1.3e-108
WP_000107437.1|3925589_3925901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025840256.1|3925980_3926676_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.2	2.8e-07
WP_080210661.1|3926749_3928180_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
>prophage 6
NZ_CP046291	Salmonella enterica strain FDAARGOS_712 chromosome, complete genome	4668186	4033233	4075737	4668186	integrase,lysis,head,protease,tail	Salmonella_phage(17.02%)	60	4033069:4033128	4078789:4078856
4033069:4033128	attL	ACAGGAATCGTATTCGGTCTCTTTTTATTTTCCTTACAAATCAAACAATTAAAAACGCTT	NA	NA	NA	NA
WP_080160492.1|4033233_4034313_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	2.5e-100
WP_038390080.1|4034293_4034566_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	39.7	4.0e-10
WP_001518052.1|4034638_4034863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053445486.1|4035051_4037145_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	51.6	5.7e-197
WP_053445485.1|4037141_4037399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000276802.1|4037492_4037672_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	62.1	4.3e-13
WP_080160491.1|4037659_4038502_-	DNA adenine methylase	NA	A0A0K1LM14	Caulobacter_phage	49.8	2.4e-69
WP_000070063.1|4038498_4038732_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	47.7	3.3e-13
WP_001534364.1|4038766_4039597_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_156010603.1|4039589_4042280_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.3	2.8e-116
WP_000799627.1|4042420_4042756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000682660.1|4042831_4043038_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_000103933.1|4043041_4043317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080160500.1|4043578_4043893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574209.1|4044334_4044733_-	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
WP_001033911.1|4044831_4045086_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
WP_001518750.1|4045072_4045567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079839505.1|4045613_4046621_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.8	1.1e-124
WP_000140163.1|4046613_4047075_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.8e-67
WP_079981260.1|4047420_4047693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001597144.1|4047896_4048052_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	1.2e-14
WP_125855785.1|4048244_4048550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742730.1|4048613_4049213_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.9	5.0e-98
WP_021000145.1|4049209_4049404_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
WP_000861020.1|4049400_4049682_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	1.7e-35
WP_079898422.1|4049678_4050233_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	64.6	2.8e-63
WP_023220365.1|4050478_4050655_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	60.3	1.2e-12
WP_001270289.1|4050705_4051113_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	63.0	1.4e-38
WP_080160499.1|4051262_4051565_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001534313.1|4051542_4052082_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	71.8	3.4e-77
WP_080160488.1|4052182_4052647_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	81.0	2.4e-55
WP_080160487.1|4052872_4053055_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000969110.1|4053162_4053369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001122852.1|4053769_4054567_+|protease	serine protease	protease	A0A2H4JE36	uncultured_Caudovirales_phage	31.9	2.2e-32
WP_052938916.1|4054654_4055281_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	1.8e-106
WP_076741610.1|4055283_4056903_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	81.2	2.5e-261
WP_080160612.1|4056902_4058423_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.9	8.2e-105
WP_000552017.1|4058463_4059153_+|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
WP_080160613.1|4059149_4060496_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	38.0	1.2e-67
WP_046722443.1|4060497_4060980_+	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	2.4e-26
WP_001031915.1|4060979_4062008_+	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
WP_080160614.1|4062011_4062359_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	6.6e-10
WP_000537614.1|4062365_4062812_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.6	2.3e-15
WP_058215124.1|4062805_4063390_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	5.5e-17
WP_058215125.1|4063386_4063752_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	1.8e-21
WP_000094504.1|4063736_4064282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080160615.1|4064262_4065747_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	40.8	6.8e-96
WP_000016414.1|4065747_4066194_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_023234167.1|4066193_4066598_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	8.2e-20
WP_000228831.1|4066639_4066822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058215126.1|4066805_4068977_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_000010346.1|4068973_4069684_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	8.5e-28
WP_000890115.1|4069683_4069986_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_000122818.1|4069982_4070852_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_023257603.1|4070832_4071510_+	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	36.4	5.4e-32
WP_023257604.1|4071522_4071879_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	9.5e-20
WP_023257605.1|4071875_4073117_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.9	1.2e-101
WP_076166114.1|4073118_4073721_+	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.2	7.7e-30
WP_022742712.1|4073710_4075162_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	71.2	2.9e-43
WP_076735573.1|4075161_4075737_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	2.2e-95
4078789:4078856	attR	ACAGGAATCGTATTCGGTCTCTTTTTATTTTCCTTACAAATCAAACAATTAAAAACGCTTGTCCGAAA	NA	NA	NA	NA
