The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046309	Mycobacterium tuberculosis strain FDAARGOS_750 chromosome, complete genome	4434666	1030319	1068592	4434666	terminase,head,integrase,protease,capsid,tRNA	Mycobacterium_phage(30.0%)	48	1059121:1059148	1068745:1068772
WP_003413486.1|1030319_1032398_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|1032506_1032734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031665860.1|1032730_1034125_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|1034469_1034970_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|1034986_1035427_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|1035573_1036251_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|1036235_1036589_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|1036601_1037027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015630477.1|1037023_1037698_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_016719614.1|1037775_1038597_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|1038732_1039626_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|1039628_1040447_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|1040461_1041643_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|1041701_1042133_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|1042646_1043888_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|1044197_1044560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|1044906_1046031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|1046032_1046572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|1046711_1048010_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|1048048_1048330_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|1048466_1048952_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|1048978_1049236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016719686.1|1049236_1051573_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|1051601_1051844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|1051844_1052522_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|1052717_1053374_+	DedA family protein	NA	NA	NA	NA	NA
WP_016720919.1|1053536_1053983_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|1054157_1054490_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|1054609_1054969_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|1055070_1055529_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|1055664_1056045_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|1056041_1057538_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|1057727_1057964_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|1058036_1058210_+	hypothetical protein	NA	NA	NA	NA	NA
1059121:1059148	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|1059254_1059686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|1059682_1060681_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|1060694_1061159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003908028.1|1061146_1061398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901443.1|1061568_1063008_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|1063015_1063549_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_078398318.1|1063701_1064328_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	2.0e-17
WP_003899414.1|1064359_1064683_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|1064762_1065008_-	antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|1065004_1066432_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|1066433_1066826_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|1066822_1067083_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|1067099_1067462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|1067464_1068592_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
1068745:1068772	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
