The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	0	5943	6571392		Paramecium_bursaria_Chlorella_virus(100.0%)	2	NA	NA
WP_004305823.1|3330_4776_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_004302290.1|4788_5943_+	PKD domain-containing protein	NA	M1ICP4	Paramecium_bursaria_Chlorella_virus	26.9	2.6e-10
>prophage 2
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	11894	18645	6571392		Cellulophaga_phage(25.0%)	7	NA	NA
WP_085929299.1|11894_13964_-	virulence protein E	NA	M1NXJ3	Cellulophaga_phage	33.1	1.5e-45
WP_004305834.1|14099_14330_-	DUF4248 domain-containing protein	NA	NA	NA	NA	NA
WP_004305836.1|14523_15027_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004302306.1|15023_15215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004305837.1|15201_15645_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	40.5	6.5e-26
WP_004305838.1|15672_16401_-	pyruvate formate lyase-activating protein	NA	A0A1B1IXI7	Citrobacter_phage	29.0	1.9e-06
WP_004305839.1|16416_18645_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	43.2	1.6e-165
>prophage 3
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	38469	42546	6571392		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_004305862.1|38469_42546_+	hybrid sensor histidine kinase/response regulator transcription factor	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.0	4.6e-25
>prophage 4
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	60735	61587	6571392		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004305881.1|60735_61587_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	7.7e-44
>prophage 5
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	80366	81824	6571392		Erwinia_phage(100.0%)	1	NA	NA
WP_004305894.1|80366_81824_+	DUF4979 domain-containing protein	NA	G0YPJ0	Erwinia_phage	42.3	7.1e-05
>prophage 6
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	107111	112742	6571392		Norovirus(100.0%)	1	NA	NA
WP_004305946.1|107111_112742_-	hypothetical protein	NA	Q2PGD6	Norovirus	26.5	3.1e-08
>prophage 7
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	120655	128354	6571392		Staphylococcus_phage(25.0%)	6	NA	NA
WP_004296935.1|120655_121108_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.6	1.1e-28
WP_004305956.1|121197_123945_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	48.4	5.6e-11
WP_004296933.1|123956_124556_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_004296930.1|124749_126297_+	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_004305959.1|126333_127725_-	transporter substrate-binding domain-containing protein	NA	I1VXB7	Halocynthia_phage	34.6	2.3e-08
WP_008648370.1|127742_128354_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.9	1.2e-35
>prophage 8
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	167702	169772	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004306001.1|167702_169772_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	27.4	1.4e-06
>prophage 9
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	173591	173891	6571392		Indivirus(100.0%)	1	NA	NA
WP_004306008.1|173591_173891_-	thioredoxin	NA	A0A1V0SD63	Indivirus	40.5	8.0e-12
>prophage 10
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	186604	189472	6571392		Cyanophage(100.0%)	1	NA	NA
WP_004306018.1|186604_189472_+	AAA family ATPase	NA	M4SKJ6	Cyanophage	23.5	1.3e-05
>prophage 11
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	192947	193691	6571392		Sulfolobus_monocaudavirus(100.0%)	1	NA	NA
WP_004306020.1|192947_193691_-	polyprenol monophosphomannose synthase	NA	A0A0N7A8R9	Sulfolobus_monocaudavirus	37.1	7.3e-30
>prophage 12
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	197538	199425	6571392		Pseudomonas_phage(100.0%)	1	NA	NA
WP_004306022.1|197538_199425_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	39.6	3.6e-49
>prophage 13
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	216171	220257	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004306035.1|216171_220257_+	response regulator	NA	W8CYM9	Bacillus_phage	29.1	4.6e-09
>prophage 14
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	250038	251340	6571392		Pasteurella_phage(100.0%)	1	NA	NA
WP_004307635.1|250038_251340_+	helicase	NA	A0A1L6BZE6	Pasteurella_phage	23.9	4.0e-07
>prophage 15
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	273977	276194	6571392		Catovirus(100.0%)	1	NA	NA
WP_004307613.1|273977_276194_-	patatin	NA	A0A1V0SCG0	Catovirus	26.6	5.2e-15
>prophage 16
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	284217	285111	6571392		Geobacillus_phage(100.0%)	1	NA	NA
WP_004307608.1|284217_285111_+	glycoside hydrolase family 25 protein	NA	A0A1U9WQS3	Geobacillus_phage	38.4	2.0e-26
>prophage 17
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	296415	296886	6571392		Pandoravirus(100.0%)	1	NA	NA
WP_004297398.1|296415_296886_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	44.3	8.7e-21
>prophage 18
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	348835	349552	6571392		Streptomyces_phage(100.0%)	1	NA	NA
WP_049703387.1|348835_349552_-	NUDIX hydrolase	NA	A0A0E3JJF3	Streptomyces_phage	39.1	2.7e-13
>prophage 19
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	364856	365282	6571392		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_004307289.1|364856_365282_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1INV7	uncultured_Mediterranean_phage	50.4	5.1e-28
>prophage 20
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	371732	379548	6571392		Streptococcus_phage(25.0%)	5	NA	NA
WP_004307282.1|371732_374153_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	34.0	1.1e-21
WP_004307281.1|374321_375869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004307280.1|375878_376862_+	glycosyltransferase	NA	A0A2P1ELT8	Moumouvirus	22.5	2.8e-05
WP_004307277.1|377957_378719_+	NTP transferase domain-containing protein	NA	A0A222YX14	Synechococcus_phage	32.2	8.2e-29
WP_004307276.1|378978_379548_+	HAD family phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	26.9	1.6e-13
>prophage 21
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	387240	388074	6571392		Tupanvirus(100.0%)	1	NA	NA
WP_008644072.1|387240_388074_+	hypothetical protein	NA	A0A2K9L639	Tupanvirus	24.6	1.2e-09
>prophage 22
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	392198	393627	6571392		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_004307260.1|392198_392735_+	hypothetical protein	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	44.3	2.4e-06
WP_004307259.1|392727_393627_+	glycosyltransferase family 2 protein	NA	A0A1V0SH65	Hokovirus	29.3	8.8e-06
>prophage 23
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	400195	403193	6571392		Freshwater_phage(50.0%)	3	NA	NA
WP_004297522.1|400195_400804_+	adenylyl-sulfate kinase	NA	A0A1B0XTK9	Freshwater_phage	33.0	1.4e-07
WP_004297523.1|400811_401720_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_004307251.1|401732_403193_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.0	5.4e-37
>prophage 24
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	407370	412739	6571392	tRNA	Stenotrophomonas_phage(33.33%)	4	NA	NA
WP_004307246.1|407370_407925_+	peptide deformylase	NA	A0A142EZU8	Stenotrophomonas_phage	37.9	2.8e-18
WP_004307245.1|408001_410032_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004297531.1|410114_412055_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	37.2	2.8e-121
WP_004307244.1|412127_412739_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	39.3	3.9e-13
>prophage 25
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	488433	492124	6571392		Catovirus(50.0%)	3	NA	NA
WP_004307195.1|488433_489618_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	24.1	1.1e-16
WP_004297892.1|489657_490239_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004297887.1|490504_492124_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.3	1.6e-45
>prophage 26
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	500118	502047	6571392		Feldmannia_irregularis_virus(100.0%)	1	NA	NA
WP_004306388.1|500118_502047_+	HAMP domain-containing histidine kinase	NA	Q6XLV6	Feldmannia_irregularis_virus	28.9	9.1e-16
>prophage 27
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	511160	512735	6571392		Aphanizomenon_phage(100.0%)	1	NA	NA
WP_032852162.1|511160_512735_-	AAA domain-containing protein	NA	A0A2H4PB07	Aphanizomenon_phage	30.0	7.6e-29
>prophage 28
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	519160	527612	6571392		Synechococcus_phage(40.0%)	6	NA	NA
WP_004297838.1|519160_520819_-	AMP-binding protein	NA	Q75ZG1	Hepacivirus	24.8	6.8e-28
WP_004306373.1|521072_522143_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	46.0	6.7e-85
WP_004297836.1|522162_523233_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.7	2.3e-130
WP_004297835.1|523326_524496_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_032846467.1|524605_526081_+	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	31.1	2.2e-33
WP_032852147.1|526115_527612_+	glucose-6-phosphate dehydrogenase	NA	E3SIC8	Synechococcus_phage	38.1	1.0e-83
>prophage 29
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	533030	533774	6571392		Planktothrix_phage(100.0%)	1	NA	NA
WP_004300330.1|533030_533774_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.8	1.7e-31
>prophage 30
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	539809	546170	6571392		Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
WP_004306363.1|539809_540766_-	D-2-hydroxyacid dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	29.4	5.5e-22
WP_004306362.1|540863_542135_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	43.8	2.2e-87
WP_004306361.1|542141_544718_-	membrane protein	NA	NA	NA	NA	NA
WP_004306359.1|545084_546170_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	28.0	2.4e-37
>prophage 31
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	549330	549834	6571392		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_004300346.1|549330_549834_+	RNA polymerase sigma factor	NA	A0A0F6TH34	Sinorhizobium_phage	31.1	1.2e-12
>prophage 32
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	554548	558378	6571392		Hokovirus(50.0%)	2	NA	NA
WP_004306351.1|554548_556420_+	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.4	1.3e-27
WP_004300352.1|556686_558378_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.5	1.9e-41
>prophage 33
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	563283	565953	6571392		Hokovirus(100.0%)	1	NA	NA
WP_004306348.1|563283_565953_-	response regulator	NA	A0A1V0SGX0	Hokovirus	31.1	2.3e-33
>prophage 34
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	574498	580069	6571392		Catovirus(50.0%)	5	NA	NA
WP_004306340.1|574498_575446_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	37.1	4.5e-08
WP_004306339.1|575485_576601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004306338.1|576675_577014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080564517.1|577156_578116_+	DUF4373 domain-containing protein	NA	NA	NA	NA	NA
WP_004306336.1|578275_580069_+	AAA family ATPase	NA	A0A218ML96	uncultured_virus	35.7	1.6e-86
>prophage 35
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	583294	584963	6571392		Haemophilus_phage(50.0%)	2	NA	NA
WP_004306332.1|583294_583741_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	40.5	1.8e-28
WP_004306331.1|583844_584963_-	glycosyltransferase family 4 protein	NA	J7Q7I8	Aeropyrum_coil-shaped_virus	29.6	4.2e-05
>prophage 36
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	593038	594433	6571392		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_004306323.1|593038_594433_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	34.2	1.3e-67
>prophage 37
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	601106	612871	6571392		Streptococcus_phage(60.0%)	9	NA	NA
WP_004306316.1|601106_602441_+	DEAD/DEAH box helicase	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	1.3e-40
WP_004300395.1|602871_603939_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	45.0	1.9e-76
WP_004306315.1|604046_604967_+	3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	30.8	4.2e-27
WP_004306314.1|605129_606377_+	DUF1015 domain-containing protein	NA	NA	NA	NA	NA
WP_004306313.1|606632_607250_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.4	7.4e-20
WP_004306311.1|607346_608096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004306309.1|608175_609261_+	HpaII family restriction endonuclease	NA	NA	NA	NA	NA
WP_004306306.1|609329_609899_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_004306304.1|610021_612871_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	50.5	4.2e-251
>prophage 38
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	620217	622428	6571392		uncultured_virus(100.0%)	1	NA	NA
WP_004306285.1|620217_622428_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.8	2.8e-101
>prophage 39
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	637490	640941	6571392		Escherichia_phage(33.33%)	5	NA	NA
WP_032852159.1|637490_637715_-	hypothetical protein	NA	O80281	Escherichia_phage	52.1	1.3e-06
WP_004306265.1|638166_638574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008647328.1|638686_639094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004306263.1|639097_640402_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	56.4	1.6e-152
WP_004300435.1|640398_640941_+	ParB-like nuclease domain-containing protein	NA	A0A068F3J9	Mycobacterium_phage	66.7	1.9e-59
>prophage 40
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	655800	657883	6571392		Tupanvirus(50.0%)	2	NA	NA
WP_004300450.1|655800_656730_+	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	50.5	3.8e-84
WP_004300451.1|656749_657883_+	hybrid sensor histidine kinase/response regulator	NA	W8CYM9	Bacillus_phage	34.7	7.7e-15
>prophage 41
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	702414	704154	6571392		Cellulophaga_phage(100.0%)	1	NA	NA
WP_004306227.1|702414_704154_+	hypothetical protein	NA	S0A0V0	Cellulophaga_phage	28.0	6.3e-24
>prophage 42
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	735750	736740	6571392		Geobacillus_phage(100.0%)	1	NA	NA
WP_004306207.1|735750_736740_-	site-specific DNA-methyltransferase	NA	W8EBG5	Geobacillus_phage	48.5	3.8e-58
>prophage 43
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	766029	768447	6571392		Vibrio_phage(50.0%)	2	NA	NA
WP_004306185.1|766029_766968_+	hypothetical protein	NA	A0A1B0Z0F0	Vibrio_phage	47.7	1.2e-34
WP_004306183.1|767697_768447_+	DUF5131 family protein	NA	A0A1B1IPP1	uncultured_Mediterranean_phage	27.9	4.9e-18
>prophage 44
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	785365	789192	6571392		Acanthamoeba_polyphaga_mimivirus(50.0%)	2	NA	NA
WP_004306167.1|785365_786244_+	endonuclease/exonuclease/phosphatase family protein	NA	A0A0G2Y8Z8	Acanthamoeba_polyphaga_mimivirus	27.4	1.7e-09
WP_004306165.1|786759_789192_-	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	34.3	2.9e-27
>prophage 45
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	797566	804152	6571392		Hokovirus(50.0%)	3	NA	NA
WP_004306157.1|797566_799069_-	PAS domain-containing protein	NA	A0A1V0SGX0	Hokovirus	35.8	2.0e-26
WP_004306155.1|799241_800771_-	AhpC/TSA family protein	NA	NA	NA	NA	NA
WP_080564515.1|800897_804152_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	33.1	2.1e-161
>prophage 46
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	807183	812006	6571392		Bacillus_phage(66.67%)	3	NA	NA
WP_004296049.1|807183_807870_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	7.6e-34
WP_004306149.1|807866_809234_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	27.2	2.7e-22
WP_004306147.1|809354_812006_+	magnesium-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.7	2.2e-44
>prophage 47
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	829217	829484	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004306125.1|829217_829484_+	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	44.2	5.4e-12
>prophage 48
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	841711	850674	6571392		Vaccinia_virus(33.33%)	3	NA	NA
WP_004306116.1|841711_844366_+	glycoside hydrolase family 2	NA	B9U1V4	Vaccinia_virus	30.4	4.3e-32
WP_080564513.1|844502_848933_+	response regulator	NA	A0A1V0SGX0	Hokovirus	21.8	5.1e-22
WP_004306114.1|848991_850674_+	hypothetical protein	NA	M4SNB6	Cellulophaga_phage	33.7	2.5e-22
>prophage 49
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	880991	887471	6571392		Acinetobacter_phage(50.0%)	3	NA	NA
WP_085929304.1|880991_882824_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	29.7	8.1e-06
WP_004306088.1|882837_883350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004306087.1|883481_887471_-	hybrid sensor histidine kinase/response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.3	1.4e-07
>prophage 50
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	894068	899572	6571392	tRNA	Tupanvirus(33.33%)	5	NA	NA
WP_004306082.1|894068_895562_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	37.2	9.9e-95
WP_004295994.1|895776_896454_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.9	3.2e-32
WP_004295993.1|896475_897750_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_004295992.1|897879_898836_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004295990.1|898828_899572_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	8.6e-31
>prophage 51
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	907104	912839	6571392	tRNA	Moraxella_phage(25.0%)	8	NA	NA
WP_004306076.1|907104_908124_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.9	7.3e-65
WP_004306075.1|908168_909401_+	competence/damage-inducible protein A	NA	B5TK85	Pseudomonas_phage	48.4	7.3e-19
WP_004295983.1|909523_909784_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002560155.1|909805_909994_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_004295982.1|910010_910169_+	DUF4295 domain-containing protein	NA	NA	NA	NA	NA
WP_004295981.1|910307_911267_+	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	39.0	1.4e-17
WP_004306074.1|911263_912574_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_004306073.1|912566_912839_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	32.2	5.9e-06
>prophage 52
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	926198	999006	6571392	portal,tail,protease,transposase,tRNA,terminase	Catovirus(15.0%)	60	NA	NA
WP_004306067.1|926198_928775_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.1	9.7e-114
WP_004306066.1|929132_931661_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	40.6	2.4e-125
WP_004306065.1|931795_933841_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	27.9	2.1e-47
WP_085929303.1|934054_936310_+	patatin	NA	A0A1V0SCG0	Catovirus	26.3	5.8e-14
WP_156202074.1|936956_938522_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_004295958.1|938608_938959_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_032845207.1|938946_939351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303039.1|939726_940620_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_004303042.1|940679_942680_-	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	35.5	2.2e-105
WP_004295953.1|942755_943433_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004295952.1|943649_944561_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_004295951.1|944548_945325_-	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_004295950.1|945401_945872_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004303045.1|947084_948104_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_004303046.1|948127_948904_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_004295946.1|948967_949417_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004303047.1|949589_952739_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_085929236.1|952879_954001_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004303049.1|954045_955443_-	TolC family protein	NA	NA	NA	NA	NA
WP_004295942.1|955604_956435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303050.1|956440_957535_-	Nif3-like dinuclear metal center hexameric protein	NA	A0A1E1EXH0	Acanthamoeba_castellanii_mimivirus	44.7	1.2e-17
WP_004303051.1|957813_958317_+	RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	30.3	3.8e-06
WP_004303052.1|958549_958963_+	DUF4891 domain-containing protein	NA	NA	NA	NA	NA
WP_004303053.1|959014_959293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303054.1|959289_960084_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004303055.1|960135_960756_-	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	26.5	5.9e-09
WP_004303057.1|961082_961625_+	ferredoxin	NA	NA	NA	NA	NA
WP_004303058.1|961708_962830_+	agmatine deiminase family protein	NA	M1HES8	Acanthocystis_turfacea_Chlorella_virus	32.4	8.1e-41
WP_004303059.1|962897_963782_+	carbon-nitrogen hydrolase	NA	M1I3K9	Paramecium_bursaria_Chlorella_virus	40.8	5.0e-54
WP_032851895.1|963903_964293_-	GtrA family protein	NA	NA	NA	NA	NA
WP_004303061.1|964289_966053_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	25.2	2.3e-13
WP_008647567.1|966161_967175_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	26.6	5.8e-14
WP_004303063.1|967407_968592_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	V5LQ39	Emiliania_huxleyi_virus	34.3	2.6e-50
WP_004303066.1|970331_970526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303067.1|971429_972179_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	61.5	1.5e-88
WP_004303068.1|972731_973988_+|transposase	transposase	transposase	H7BVW5	unidentified_phage	37.3	3.6e-37
WP_004303069.1|974153_975269_+	DNA polymerase III subunit beta	NA	NA	NA	NA	NA
WP_004303070.1|975273_975666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303071.1|975662_976946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303072.1|976988_977681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303073.1|977775_978273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118391755.1|978311_979814_+	replicative DNA helicase	NA	O80281	Escherichia_phage	33.3	4.2e-61
WP_004303075.1|979979_980543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303078.1|981331_982183_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	52.1	1.7e-75
WP_004303079.1|982265_982760_+	helix-turn-helix domain-containing protein	NA	A0A2R4ALD0	Vibrio_phage	57.7	2.2e-38
WP_085929229.1|982737_984186_+|terminase	phage terminase large subunit	terminase	A0A1S5SAP0	Streptococcus_phage	30.2	3.0e-48
WP_004303081.1|984303_984744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303082.1|984861_986310_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_032851897.1|988269_988977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303086.1|988995_989580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303087.1|989599_990721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303088.1|990727_991060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303089.1|991053_991365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303090.1|991361_991817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303091.1|991819_992203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303092.1|992205_992820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032851899.1|993001_993529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032851937.1|993570_993771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303094.1|993871_994066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118391754.1|994332_999006_+|tail	phage tail tape measure protein	tail	A0A1V0DYA9	Dinoroseobacter_phage	30.8	1.4e-33
>prophage 53
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1005017	1010547	6571392		Bacillus_phage(50.0%)	5	NA	NA
WP_004303103.1|1005017_1008971_+	hypothetical protein	NA	S6B1G6	Bacillus_phage	54.2	9.9e-09
WP_004303104.1|1008984_1009308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303105.1|1009304_1009571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118391707.1|1009597_1010056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303107.1|1010052_1010547_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0Z0F0	Vibrio_phage	46.1	2.8e-30
>prophage 54
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1017036	1022097	6571392		Methylophilaceae_phage(20.0%)	9	NA	NA
WP_004303115.1|1017036_1017441_-	hypothetical protein	NA	A0A2H4FS77	Methylophilaceae_phage	39.6	5.5e-08
WP_004303116.1|1017514_1017757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303117.1|1017825_1018221_-	hypothetical protein	NA	A0A0F7L658	uncultured_marine_virus	35.3	1.6e-07
WP_004303118.1|1018242_1018458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115484621.1|1018614_1018800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303121.1|1018821_1019256_-	hypothetical protein	NA	R9U4A4	Rhizobium_phage	47.6	3.8e-31
WP_004303122.1|1019712_1020087_-	hypothetical protein	NA	T1S9H7	Salmonella_phage	33.9	4.9e-11
WP_004303123.1|1020163_1020406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303124.1|1020429_1022097_-	DEAD/DEAH box helicase	NA	B3GAN0	uncultured_virus	35.8	9.5e-62
>prophage 55
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1033082	1036675	6571392	tRNA	Moraxella_phage(50.0%)	2	NA	NA
WP_004303147.1|1033082_1035548_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	41.1	4.0e-157
WP_004295910.1|1035544_1036675_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.5	7.5e-79
>prophage 56
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1040054	1044097	6571392		uncultured_Mediterranean_phage(33.33%)	4	NA	NA
WP_004295906.1|1040054_1041323_+	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	30.5	7.5e-51
WP_004295905.1|1041374_1042172_-	DUF4738 domain-containing protein	NA	NA	NA	NA	NA
WP_004295904.1|1042208_1043522_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.5	8.8e-79
WP_004303149.1|1043548_1044097_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.1	4.7e-42
>prophage 57
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1054128	1069000	6571392	integrase	Mycobacterium_virus(22.22%)	23	1059771:1059785	1071880:1071894
WP_004303159.1|1054128_1054914_+	DNA (cytosine-5-)-methyltransferase	NA	G8I9T0	Mycobacterium_virus	34.0	8.5e-29
WP_004303160.1|1054931_1055693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303161.1|1055689_1057726_+	DUF87 domain-containing protein	NA	G1D482	Mycobacterium_virus	32.4	2.2e-28
WP_004303162.1|1057727_1057922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303163.1|1058041_1058647_+	DUF4494 domain-containing protein	NA	NA	NA	NA	NA
WP_004303165.1|1059448_1060201_+	hypothetical protein	NA	NA	NA	NA	NA
1059771:1059785	attL	CAGATGAAACGCAAA	NA	NA	NA	NA
WP_004303166.1|1060295_1060793_+	ATP-binding protein	NA	S0A4B2	Cellulophaga_phage	28.8	4.0e-08
WP_004303167.1|1060904_1061660_+	site-specific DNA-methyltransferase	NA	X2KR14	Campylobacter_phage	71.6	8.0e-109
WP_032851902.1|1061667_1062423_+	site-specific DNA-methyltransferase	NA	A0A0H3UZL7	Geobacillus_virus	54.7	1.7e-74
WP_004303169.1|1062442_1062919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303170.1|1062915_1063803_+	radical SAM protein	NA	A0A0A7S0B8	Clostridium_phage	41.3	3.0e-54
WP_004303171.1|1063869_1064364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303172.1|1064381_1064567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303174.1|1064869_1065295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303176.1|1065338_1065701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303178.1|1065702_1065897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303180.1|1065899_1066073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303182.1|1066075_1066426_+	hypothetical protein	NA	M9MUN3	Rhodococcus_phage	42.1	5.1e-10
WP_004303185.1|1066428_1066857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303187.1|1066858_1067278_+	hypothetical protein	NA	A8ASP1	Listeria_phage	26.3	2.6e-08
WP_032851903.1|1067279_1067570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303191.1|1067581_1067956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303193.1|1068013_1069000_+|integrase	site-specific integrase	integrase	R9ZYY8	Cellulophaga_phage	25.6	2.3e-15
1071880:1071894	attR	CAGATGAAACGCAAA	NA	NA	NA	NA
>prophage 58
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1075232	1082222	6571392		Morganella_phage(20.0%)	7	NA	NA
WP_004303211.1|1075232_1075673_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	43.5	2.9e-26
WP_032851905.1|1075672_1076923_+	Y-family DNA polymerase	NA	A0A218MNF2	uncultured_virus	41.4	2.0e-88
WP_004303215.1|1076924_1077623_+	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	44.2	1.4e-22
WP_004303218.1|1078444_1078954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303220.1|1078950_1079445_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0Z0F0	Vibrio_phage	45.4	1.8e-29
WP_004303222.1|1079441_1079828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303223.1|1079855_1082222_-	collagen-like protein	NA	B5TR91	Bacteroides_phage	38.0	7.7e-09
>prophage 59
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1091428	1121913	6571392		unidentified_phage(40.0%)	17	NA	NA
WP_004303234.1|1091428_1093495_+	hypothetical protein	NA	A0A1B1IT91	uncultured_Mediterranean_phage	26.5	8.8e-33
WP_004303235.1|1093506_1093998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032851907.1|1094032_1095982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303237.1|1096080_1107777_-	hypothetical protein	NA	Q6NE18	Leptospira_phage	49.4	5.1e-37
WP_004303238.1|1107791_1108031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303239.1|1108414_1108690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303240.1|1108655_1110077_-	RNA-directed DNA polymerase	NA	H7BUL0	unidentified_phage	37.9	3.3e-71
WP_004303241.1|1110091_1110472_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_004303242.1|1110617_1111430_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_004303243.1|1111451_1112243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303244.1|1112244_1118541_-	hypothetical protein	NA	H7BUR7	unidentified_phage	62.9	5.8e-03
WP_004303245.1|1118545_1119319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303246.1|1119311_1119800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303247.1|1119789_1120638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303248.1|1120637_1120916_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004303249.1|1120912_1121416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303250.1|1121415_1121913_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7QYZ5	Vibrio_phage	45.7	1.6e-28
>prophage 60
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1130303	1139988	6571392	protease	Microbacterium_phage(25.0%)	10	NA	NA
WP_004303262.1|1130303_1131365_-|protease	Clp protease ClpP	protease	A6N1Z7	Microbacterium_phage	26.4	1.1e-10
WP_004303263.1|1131567_1132083_+	DUF1804 family protein	NA	NA	NA	NA	NA
WP_004303264.1|1132082_1133621_+	hypothetical protein	NA	H7BVH1	unidentified_phage	23.9	1.0e-25
WP_004303265.1|1133623_1134049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156202076.1|1134081_1136628_+	DUF935 family protein	NA	A0A219VH73	Ochrobactrum_phage	25.3	9.5e-05
WP_004303268.1|1136714_1137293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303269.1|1137304_1137904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303270.1|1137912_1138170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303271.1|1138399_1138642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303273.1|1138833_1139988_+	hypothetical protein	NA	A4JWM1	Burkholderia_virus	55.1	7.4e-114
>prophage 61
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1143042	1143429	6571392		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004303281.1|1143042_1143429_-	hypothetical protein	NA	A0A2H4JDQ6	uncultured_Caudovirales_phage	41.7	5.3e-16
>prophage 62
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1152575	1156987	6571392	integrase	unidentified_phage(33.33%)	4	1150699:1150711	1155788:1155800
1150699:1150711	attL	TTTTCCTTCACCT	NA	NA	NA	NA
WP_004303296.1|1152575_1153712_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	49.7	4.8e-81
WP_004295897.1|1154193_1154997_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ36	Paenibacillus_phage	36.2	6.4e-32
WP_004303297.1|1155079_1156468_-	peptide MFS transporter	NA	NA	NA	NA	NA
1155788:1155800	attR	TTTTCCTTCACCT	NA	NA	NA	NA
WP_004295895.1|1156564_1156987_+	hypothetical protein	NA	A0A2H4JDQ6	uncultured_Caudovirales_phage	44.7	1.1e-14
>prophage 63
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1165406	1168895	6571392	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_004311814.1|1165406_1168895_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	31.6	8.7e-158
>prophage 64
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1198805	1199612	6571392		Catovirus(100.0%)	1	NA	NA
WP_004295848.1|1198805_1199612_+	patatin-like phospholipase family protein	NA	A0A1V0SCG0	Catovirus	27.7	4.6e-14
>prophage 65
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1206126	1222279	6571392	integrase	unidentified_phage(66.67%)	9	1205329:1205347	1226637:1226655
1205329:1205347	attL	AAAAGGACATAAAAAAAGC	NA	NA	NA	NA
WP_004308911.1|1206126_1207134_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.0	2.9e-13
WP_004295839.1|1207263_1207998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303351.1|1208516_1209662_+|integrase	site-specific integrase	integrase	Q9T1Z2	Lactococcus_phage	25.3	5.4e-08
WP_004303353.1|1209711_1210206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032851954.1|1210207_1211503_-	hypothetical protein	NA	H7BUR8	unidentified_phage	99.3	8.5e-244
WP_004303356.1|1211934_1218723_-	hypothetical protein	NA	H7BUR7	unidentified_phage	96.9	0.0e+00
WP_004303358.1|1218732_1219899_-	hypothetical protein	NA	H7BUR5	unidentified_phage	87.1	5.6e-194
WP_004303360.1|1219895_1220105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303362.1|1220149_1222279_-	hypothetical protein	NA	H7BUR3	unidentified_phage	96.5	0.0e+00
1226637:1226655	attR	AAAAGGACATAAAAAAAGC	NA	NA	NA	NA
>prophage 66
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1228785	1233031	6571392		unidentified_phage(75.0%)	5	NA	NA
WP_004303375.1|1228785_1229220_-	lysozyme	NA	A0A2I7S753	Vibrio_phage	50.4	4.4e-27
WP_004303376.1|1229216_1230029_-	hypothetical protein	NA	H7BUR0	unidentified_phage	94.8	5.3e-151
WP_004303377.1|1230038_1230989_-	hypothetical protein	NA	H7BUQ9	unidentified_phage	96.5	3.0e-169
WP_004303378.1|1230972_1231674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303379.1|1231666_1233031_-	hypothetical protein	NA	H7BUQ7	unidentified_phage	99.3	3.2e-257
>prophage 67
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1237365	1250761	6571392	protease	unidentified_phage(85.71%)	12	NA	NA
WP_004303390.1|1237365_1239087_-	hypothetical protein	NA	H7BUT1	unidentified_phage	97.6	0.0e+00
WP_004303391.1|1239046_1239727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303392.1|1239707_1240052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303393.1|1240026_1240701_-	site-specific DNA-methyltransferase	NA	H9YP98	environmental_Halophage	33.6	1.5e-26
WP_004303394.1|1240857_1241805_-	hypothetical protein	NA	H7BUS8	unidentified_phage	96.2	6.6e-161
WP_004303395.1|1241919_1242726_-	hypothetical protein	NA	H7BUS7	unidentified_phage	97.8	2.4e-148
WP_004303396.1|1242784_1244989_-	hypothetical protein	NA	H7BUS6	unidentified_phage	97.3	0.0e+00
WP_004303397.1|1245013_1245880_-|protease	protease	protease	H7BUS5	unidentified_phage	97.2	2.9e-163
WP_017142804.1|1245941_1246343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303399.1|1246463_1246952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303400.1|1247546_1247861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303401.1|1247857_1250761_-	hypothetical protein	NA	H7BUS3	unidentified_phage	99.0	0.0e+00
>prophage 68
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1261636	1265056	6571392		Norovirus(100.0%)	1	NA	NA
WP_085929230.1|1261636_1265056_-	TonB-dependent receptor	NA	Q2PGD7	Norovirus	31.8	6.8e-14
>prophage 69
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1273698	1274616	6571392		Hokovirus(100.0%)	1	NA	NA
WP_085929231.1|1273698_1274616_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	33.3	2.1e-42
>prophage 70
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1285297	1287739	6571392		Streptococcus_phage(100.0%)	1	NA	NA
WP_004303424.1|1285297_1287739_-	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	33.8	1.7e-22
>prophage 71
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1290849	1299135	6571392		Yellowstone_lake_phycodnavirus(25.0%)	8	NA	NA
WP_004303428.1|1290849_1291815_-	NAD(P)-dependent oxidoreductase	NA	A0A0P0YMS6	Yellowstone_lake_phycodnavirus	23.8	8.6e-07
WP_004303429.1|1291924_1293055_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_004303430.1|1293064_1293376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303432.1|1293654_1294968_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.8	5.0e-82
WP_004303433.1|1294979_1296089_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004303434.1|1296099_1297410_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	I7I009	Enterobacteria_phage	29.4	9.5e-09
WP_004303435.1|1297428_1298073_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_004303436.1|1298076_1299135_-	dehydrogenase	NA	A0A222YW25	Synechococcus_phage	38.1	1.2e-62
>prophage 72
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1309698	1314841	6571392		Enterococcus_phage(33.33%)	6	NA	NA
WP_004303446.1|1309698_1310478_+	DUF4373 domain-containing protein	NA	D2IZY0	Enterococcus_phage	35.0	5.7e-17
WP_004303447.1|1310590_1311532_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	41.8	9.4e-59
WP_004303448.1|1311528_1311990_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_004303449.1|1312099_1312669_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_004303450.1|1312685_1313426_+	PorT family protein	NA	NA	NA	NA	NA
WP_004303451.1|1313560_1314841_+	serine hydroxymethyltransferase	NA	G9I092	Helicoverpa_zea_nudivirus	46.8	2.4e-89
>prophage 73
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1324321	1325017	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004295780.1|1324321_1325017_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.0	5.9e-26
>prophage 74
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1331569	1337714	6571392		Bordetella_phage(33.33%)	5	NA	NA
WP_004303459.1|1331569_1332739_-	RtcB family protein	NA	A0A291L9X2	Bordetella_phage	42.5	5.8e-74
WP_004303460.1|1332878_1333790_+	SDR family oxidoreductase	NA	A0A291LA50	Escherichia_phage	30.4	6.2e-23
WP_004303461.1|1334192_1334471_+	DUF340 domain-containing protein	NA	NA	NA	NA	NA
WP_004295766.1|1334467_1335088_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_004303462.1|1335116_1337714_-	AAA family ATPase	NA	H7BUJ6	unidentified_phage	40.6	4.4e-82
>prophage 75
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1348528	1352417	6571392		Salmonella_virus(50.0%)	4	NA	NA
WP_004303469.1|1348528_1349680_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	24.2	1.1e-08
WP_004295749.1|1349777_1350341_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_004303470.1|1350365_1351760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303471.1|1351793_1352417_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	28.6	2.2e-19
>prophage 76
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1356535	1358224	6571392		Serratia_phage(100.0%)	1	NA	NA
WP_004303475.1|1356535_1358224_-	hypothetical protein	NA	A0A1S6UB21	Serratia_phage	27.7	1.5e-09
>prophage 77
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1361624	1362260	6571392		Bacteroides_phage(100.0%)	1	NA	NA
WP_004303487.1|1361624_1362260_-	helix-turn-helix domain-containing protein	NA	H2A0H0	Bacteroides_phage	25.7	4.8e-06
>prophage 78
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1366668	1368303	6571392	integrase	Cellulophaga_phage(100.0%)	1	1362687:1362699	1370138:1370150
1362687:1362699	attL	TCCACATACTTAT	NA	NA	NA	NA
WP_070612896.1|1366668_1368303_-|integrase	tyrosine-type recombinase/integrase	integrase	R9ZYY8	Cellulophaga_phage	25.1	1.6e-13
WP_070612896.1|1366668_1368303_-|integrase	tyrosine-type recombinase/integrase	integrase	R9ZYY8	Cellulophaga_phage	25.1	1.6e-13
1370138:1370150	attR	ATAAGTATGTGGA	NA	NA	NA	NA
>prophage 79
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1371967	1372789	6571392		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_004295743.1|1371967_1372789_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0P0BXC9	Ostreococcus_lucimarinus_virus	34.0	6.8e-37
>prophage 80
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1377593	1378268	6571392		Planktothrix_phage(100.0%)	1	NA	NA
WP_004303508.1|1377593_1378268_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	1.2e-36
>prophage 81
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1387722	1396745	6571392		Bacillus_phage(50.0%)	6	NA	NA
WP_032851919.1|1387722_1388907_-	uracil-xanthine permease	NA	Q9KX94	Enterobacteria_phage	38.5	2.0e-61
WP_004295729.1|1389073_1390540_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_004295728.1|1390821_1392486_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	26.1	6.6e-31
WP_004303522.1|1392584_1394597_-	glycoside hydrolase family 97 protein	NA	NA	NA	NA	NA
WP_004303523.1|1394715_1395390_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.2	6.4e-33
WP_004303524.1|1395413_1396745_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.9	2.5e-17
>prophage 82
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1402593	1402956	6571392		Bradyrhizobium_phage(100.0%)	1	NA	NA
WP_004295721.1|1402593_1402956_+	thiol reductase thioredoxin	NA	A0A1X9SH79	Bradyrhizobium_phage	25.6	6.7e-05
>prophage 83
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1410853	1417953	6571392		Bacillus_phage(33.33%)	4	NA	NA
WP_004303534.1|1410853_1413232_-	AAA family ATPase	NA	A7KV33	Bacillus_phage	39.5	3.7e-120
WP_004303535.1|1413378_1415118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004295710.1|1415193_1415811_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	43.2	1.4e-42
WP_085929233.1|1415958_1417953_+	HAMP domain-containing histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	33.0	7.2e-24
>prophage 84
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1422733	1423426	6571392		Indivirus(100.0%)	1	NA	NA
WP_004303541.1|1422733_1423426_+	HesA/MoeB/ThiF family protein	NA	A0A1V0SCZ9	Indivirus	30.3	1.8e-14
>prophage 85
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1427431	1430749	6571392		Helicobacter_phage(100.0%)	1	NA	NA
WP_004303543.1|1427431_1430749_+	DNA primase	NA	G9CU58	Helicobacter_phage	29.3	3.8e-30
>prophage 86
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1436886	1441842	6571392		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_004295683.1|1436886_1441842_+	DEAD/DEAH box helicase	NA	A0A2H4UTW8	Bodo_saltans_virus	27.2	1.3e-50
>prophage 87
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1449471	1450950	6571392		Streptococcus_phage(100.0%)	1	NA	NA
WP_004295675.1|1449471_1450950_+	DNA methylase	NA	D0R0A3	Streptococcus_phage	28.2	6.9e-32
>prophage 88
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1457541	1458879	6571392		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_004295663.1|1457541_1458879_-	DUF1738 domain-containing protein	NA	A0A1B1IWW8	uncultured_Mediterranean_phage	28.8	9.1e-23
>prophage 89
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1484350	1488689	6571392		Vibrio_phage(50.0%)	2	NA	NA
WP_004303557.1|1484350_1487071_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	37.6	1.1e-88
WP_032851963.1|1487324_1488689_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	31.8	1.8e-58
>prophage 90
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1496268	1500525	6571392		Tupanvirus(50.0%)	7	NA	NA
WP_004295604.1|1496268_1498050_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	40.0	1.1e-23
WP_004295603.1|1498178_1498379_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004295602.1|1498392_1498536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004295601.1|1498532_1498991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004295600.1|1499083_1499350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303566.1|1499361_1499769_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_004303567.1|1499763_1500525_-	exodeoxyribonuclease III	NA	A0A0N9QXX6	Chrysochromulina_ericina_virus	37.4	2.2e-37
>prophage 91
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1505656	1510348	6571392		uncultured_marine_virus(33.33%)	5	NA	NA
WP_004295592.1|1505656_1507216_-	replicative DNA helicase	NA	A0A0F7L6J1	uncultured_marine_virus	43.9	1.5e-98
WP_004303568.1|1507454_1508285_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_004295590.1|1508317_1508680_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004295589.1|1508690_1508990_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	41.9	3.8e-14
WP_004295588.1|1509313_1510348_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	44.4	9.3e-76
>prophage 92
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1520838	1521267	6571392		uncultured_virus(100.0%)	1	NA	NA
WP_004303579.1|1520838_1521267_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218MLJ9	uncultured_virus	52.9	7.3e-35
>prophage 93
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1538136	1540336	6571392		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_004303596.1|1538136_1538712_-	acyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	46.6	2.1e-05
WP_004303597.1|1539013_1540336_-	UDP-glucose dehydrogenase	NA	M1IB49	Acanthocystis_turfacea_Chlorella_virus	48.3	1.7e-101
>prophage 94
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1548489	1550115	6571392		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_004303604.1|1548489_1550115_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	46.6	1.2e-133
>prophage 95
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1561967	1564793	6571392		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_004303626.1|1561967_1564793_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	50.4	1.1e-267
>prophage 96
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1576328	1577135	6571392		Staphylococcus_virus(100.0%)	1	NA	NA
WP_004303638.1|1576328_1577135_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	57.1	4.1e-79
>prophage 97
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1580711	1582181	6571392		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004303642.1|1580711_1582181_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	4.9e-22
>prophage 98
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1585453	1586500	6571392		Hokovirus(100.0%)	1	NA	NA
WP_004303646.1|1585453_1586500_-	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	28.5	3.0e-29
>prophage 99
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1600856	1624510	6571392		Tetraselmis_virus(33.33%)	13	NA	NA
WP_118032111.1|1600856_1602263_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	27.1	6.8e-29
WP_080564495.1|1602443_1604348_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.5	1.4e-08
WP_004303658.1|1604337_1606749_-	DUF4982 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	28.4	1.4e-26
WP_004303659.1|1606777_1608187_-	sulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	26.2	2.9e-19
WP_004303660.1|1608214_1609846_-	DUF4971 domain-containing protein	NA	NA	NA	NA	NA
WP_004303661.1|1609939_1614004_-	response regulator	NA	A0A1V0SGX0	Hokovirus	28.0	9.5e-23
WP_004303662.1|1615364_1617800_-	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	34.8	1.1e-21
WP_004303663.1|1617811_1618615_-	sugar transporter	NA	NA	NA	NA	NA
WP_004303664.1|1618660_1620067_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_004303665.1|1620193_1621279_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.6	3.4e-129
WP_117938032.1|1621292_1622030_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_004303667.1|1622136_1623450_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	39.1	5.3e-84
WP_004303668.1|1623475_1624510_-	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	30.9	5.0e-37
>prophage 100
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1633815	1637275	6571392		Escherichia_phage(50.0%)	4	NA	NA
WP_004303677.1|1633815_1634889_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D8EQC0	Escherichia_phage	49.7	1.1e-84
WP_004303678.1|1634896_1635763_-	dTDP-4-dehydrorhamnose reductase	NA	K7QJU0	Escherichia_phage	35.5	1.2e-36
WP_004303679.1|1635768_1636338_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	52.8	2.3e-44
WP_004303680.1|1636387_1637275_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.8	2.8e-105
>prophage 101
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1646287	1651217	6571392		Halovirus(33.33%)	3	NA	NA
WP_004303689.1|1646287_1647433_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	31.7	3.5e-47
WP_004303690.1|1647460_1649344_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	23.6	4.4e-15
WP_004303691.1|1649372_1651217_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HVL7	Paramecium_bursaria_Chlorella_virus	39.1	1.8e-106
>prophage 102
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1657811	1659479	6571392		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_004303694.1|1657811_1659479_+	asparagine synthase B	NA	I3UKG6	Ostreococcus_lucimarinus_virus	40.3	2.0e-88
>prophage 103
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1664980	1666423	6571392		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_004303702.1|1664980_1666423_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	41.5	2.2e-75
>prophage 104
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1676578	1677730	6571392	integrase	unidentified_phage(100.0%)	1	1668876:1668899	1677911:1677934
1668876:1668899	attL	TTGTTGGTTGTTTTAAGTTTGCGG	NA	NA	NA	NA
WP_004303712.1|1676578_1677730_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	31.8	6.4e-17
WP_004303712.1|1676578_1677730_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	31.8	6.4e-17
1677911:1677934	attR	TTGTTGGTTGTTTTAAGTTTGCGG	NA	NA	NA	NA
>prophage 105
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1688266	1689892	6571392		Hokovirus(100.0%)	1	NA	NA
WP_032848889.1|1688266_1689892_+	PAS domain-containing protein	NA	A0A1V0SGX0	Hokovirus	32.5	6.5e-23
>prophage 106
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1694381	1696779	6571392		Acinetobacter_phage(100.0%)	3	NA	NA
WP_008651733.1|1694381_1694948_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	43.2	5.3e-41
WP_004303721.1|1694952_1695948_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	31.2	3.3e-38
WP_004303722.1|1695996_1696779_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	37.8	8.1e-40
>prophage 107
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1702853	1703219	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004300114.1|1702853_1703219_+	response regulator	NA	W8CYM9	Bacillus_phage	33.1	4.8e-11
>prophage 108
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1708009	1709827	6571392		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_004303728.1|1708009_1709185_+	phosphoribosylaminoimidazolecarboxamide formyltransferase	NA	Q58MG4	Prochlorococcus_phage	45.2	2.9e-09
WP_004303729.1|1709320_1709827_+	flavodoxin FldA	NA	A7KUZ7	Bacillus_phage	27.5	9.4e-05
>prophage 109
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1720895	1730742	6571392		Bacillus_phage(50.0%)	5	NA	NA
WP_004303736.1|1720895_1722632_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	2.0e-38
WP_032851926.1|1722624_1724397_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.0	1.3e-32
WP_004303738.1|1724662_1726969_-	family 20 glycosylhydrolase	NA	A0A2H4UUW7	Bodo_saltans_virus	27.1	4.1e-07
WP_004300135.1|1727153_1728068_+	cation transporter	NA	NA	NA	NA	NA
WP_004303739.1|1728402_1730742_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	29.0	1.0e-05
>prophage 110
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1737116	1738340	6571392	integrase	unidentified_phage(100.0%)	1	1726339:1726351	1739305:1739317
1726339:1726351	attL	GGTATTTCTCGAT	NA	NA	NA	NA
WP_004303751.1|1737116_1738340_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	32.3	5.5e-35
WP_004303751.1|1737116_1738340_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	32.3	5.5e-35
1739305:1739317	attR	ATCGAGAAATACC	NA	NA	NA	NA
>prophage 111
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1769840	1782843	6571392	integrase	Virus_Rctr41k(25.0%)	7	1764530:1764544	1774041:1774055
1764530:1764544	attL	CGTGGACAACGAAAA	NA	NA	NA	NA
WP_004303812.1|1769840_1770959_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	30.5	4.2e-29
WP_004303814.1|1771272_1772730_+	DUF3945 domain-containing protein	NA	NA	NA	NA	NA
WP_004303815.1|1772733_1772949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303817.1|1772964_1775064_+	type IA DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	24.2	4.9e-23
1774041:1774055	attR	CGTGGACAACGAAAA	NA	NA	NA	NA
WP_007558955.1|1775147_1775657_+	DUF1896 domain-containing protein	NA	NA	NA	NA	NA
WP_004303818.1|1775643_1781766_+	N-6 DNA methylase	NA	I3PUW5	Vibrio_phage	25.1	1.6e-151
WP_004319206.1|1781829_1782843_-	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	32.6	2.0e-38
>prophage 112
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1789308	1791456	6571392		Acinetobacter_phage(100.0%)	1	NA	NA
WP_004303827.1|1789308_1791456_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	33.8	4.4e-11
>prophage 113
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1812397	1817308	6571392		Hokovirus(50.0%)	2	NA	NA
WP_004300169.1|1812397_1814002_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	34.2	8.9e-33
WP_004303843.1|1814149_1817308_+	response regulator	NA	A0A2K9L0Z8	Tupanvirus	26.1	2.0e-20
>prophage 114
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1833406	1834798	6571392		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004297652.1|1833406_1834798_-	polyamine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	41.4	6.3e-35
>prophage 115
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1858433	1863370	6571392		Synechococcus_phage(33.33%)	4	NA	NA
WP_002561589.1|1858433_1859294_-	RNA polymerase sigma factor RpoD/SigA	NA	G8CLC7	Synechococcus_phage	33.2	1.4e-32
WP_004296667.1|1859478_1861014_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	2.5e-24
WP_004296666.1|1861233_1862385_-	dipeptide epimerase	NA	NA	NA	NA	NA
WP_004303867.1|1862389_1863370_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	32.8	3.1e-12
>prophage 116
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1869990	1877332	6571392	tRNA	Orpheovirus(25.0%)	7	NA	NA
WP_004303876.1|1869990_1870593_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	37.6	1.1e-23
WP_004296659.1|1870968_1871658_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_004303877.1|1871713_1872472_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	6.1e-16
WP_004303878.1|1872480_1873356_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_004303879.1|1873357_1874554_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_004303880.1|1874731_1875544_+	PstS family phosphate ABC transporter substrate-binding protein	NA	E3SLK5	Synechococcus_phage	24.0	1.7e-08
WP_004303881.1|1875592_1877332_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	51.7	8.4e-162
>prophage 117
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1884366	1885692	6571392		Klebsiella_phage(100.0%)	1	NA	NA
WP_004296645.1|1884366_1885692_-	PhoH family protein	NA	A0A0A8JBQ2	Klebsiella_phage	30.0	4.0e-47
>prophage 118
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1893334	1894718	6571392		Rhodococcus_phage(50.0%)	2	NA	NA
WP_004296639.1|1893334_1893640_-	hypothetical protein	NA	A0A2P1JXV5	Rhodococcus_phage	53.5	6.0e-07
WP_004303893.1|1893650_1894718_-	hypothetical protein	NA	A0A1L7N0M6	Ralstonia_phage	26.7	5.2e-05
>prophage 119
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1902097	1905283	6571392		Vibrio_phage(50.0%)	4	NA	NA
WP_004303902.1|1902097_1902541_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7QYZ5	Vibrio_phage	43.0	2.6e-27
WP_004296628.1|1902600_1902834_-	DUF4248 domain-containing protein	NA	NA	NA	NA	NA
WP_004303906.1|1903221_1904355_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_004303908.1|1904359_1905283_-	NAD-dependent epimerase/dehydratase family protein	NA	G4W943	Tetrasphaera_phage	24.3	4.4e-08
>prophage 120
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1916774	1917068	6571392		Marinobacter_phage(100.0%)	1	NA	NA
WP_004303931.1|1916774_1917068_-	hypothetical protein	NA	A0A2D1GMI6	Marinobacter_phage	44.1	6.4e-06
>prophage 121
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1923933	1924524	6571392	integrase	Cellulophaga_phage(100.0%)	1	1923124:1923136	1927861:1927873
1923124:1923136	attL	ATTATGATTTACA	NA	NA	NA	NA
WP_004293659.1|1923933_1924524_-|integrase	tyrosine-type recombinase/integrase	integrase	R9ZX86	Cellulophaga_phage	32.2	1.0e-10
WP_004293659.1|1923933_1924524_-|integrase	tyrosine-type recombinase/integrase	integrase	R9ZX86	Cellulophaga_phage	32.2	1.0e-10
1927861:1927873	attR	TGTAAATCATAAT	NA	NA	NA	NA
>prophage 122
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1930964	1931549	6571392		Sphingobium_phage(100.0%)	1	NA	NA
WP_004303947.1|1930964_1931549_-	hypothetical protein	NA	A0A1W6DXE2	Sphingobium_phage	32.7	5.9e-19
>prophage 123
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1938636	1939722	6571392		Pseudomonas_phage(50.0%)	3	NA	NA
WP_004303957.1|1938636_1938957_-	hypothetical protein	NA	X5I381	Pseudomonas_phage	36.9	9.4e-11
WP_004293635.1|1938962_1939442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004293634.1|1939446_1939722_-	DUF3846 domain-containing protein	NA	A0A1B1IVI5	uncultured_Mediterranean_phage	42.5	2.4e-07
>prophage 124
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1950101	1951349	6571392		Oenococcus_phage(100.0%)	1	NA	NA
WP_004293619.1|1950101_1951349_+	ATP-binding protein	NA	V9QJ85	Oenococcus_phage	31.6	4.5e-08
>prophage 125
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1959309	1971769	6571392	tail	Verrucomicrobia_phage(20.0%)	12	NA	NA
WP_004293607.1|1959309_1960548_+	hypothetical protein	NA	A0A0E3M0W7	Verrucomicrobia_phage	28.1	5.1e-12
WP_004293606.1|1960674_1961724_+	hypothetical protein	NA	H7BVG8	unidentified_phage	28.8	1.1e-36
WP_004293605.1|1961799_1962147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303973.1|1962146_1963499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004293603.1|1963502_1963958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004293602.1|1963964_1964456_+	DNA methylase	NA	A0A223W0E9	Agrobacterium_phage	48.3	2.6e-36
WP_004293601.1|1964540_1965305_-	serine/threonine protein phosphatase	NA	A0A2I7SAC8	Vibrio_phage	30.6	1.6e-24
WP_004303974.1|1965301_1966084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004293599.1|1966077_1967061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008860783.1|1967279_1967636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004293597.1|1967647_1967833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004293596.1|1967926_1971769_+|tail	phage tail tape measure protein	tail	A0A219Y9T7	Aeromonas_phage	27.6	1.7e-26
>prophage 126
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1977935	1982370	6571392		Enterococcus_phage(66.67%)	3	NA	NA
WP_004293590.1|1977935_1980203_+	hypothetical protein	NA	A0A249XZM0	Enterococcus_phage	41.2	2.1e-11
WP_004293589.1|1980209_1981520_+	hypothetical protein	NA	A0A249XZH3	Enterococcus_phage	29.8	2.4e-28
WP_004293588.1|1981605_1982370_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.5	1.4e-12
>prophage 127
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	1993590	2001631	6571392		unidentified_phage(100.0%)	6	NA	NA
WP_004293579.1|1993590_1998360_+	hypothetical protein	NA	H7BUK9	unidentified_phage	22.8	3.2e-14
WP_004293578.1|1998411_1998699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004293577.1|1998704_1999028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004293576.1|1999138_1999816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004293575.1|1999808_2000741_+	hypothetical protein	NA	H7BUK8	unidentified_phage	40.4	8.0e-34
WP_004303980.1|2000737_2001631_+	hypothetical protein	NA	H7BUK7	unidentified_phage	52.6	2.5e-85
>prophage 128
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2005656	2021712	6571392		unidentified_phage(58.33%)	16	NA	NA
WP_004293566.1|2005656_2006916_+	hypothetical protein	NA	H7BUK1	unidentified_phage	43.3	1.4e-78
WP_004293565.1|2006990_2008058_+	phosphoesterase	NA	M4SN99	Cellulophaga_phage	25.6	1.4e-21
WP_004293564.1|2008045_2010370_+	hypothetical protein	NA	H7BUK0	unidentified_phage	42.7	3.3e-137
WP_004293563.1|2010344_2010830_+	hypothetical protein	NA	E9P621	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	28.5	1.1e-05
WP_004322848.1|2010974_2011577_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004303983.1|2011554_2012172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004293560.1|2012168_2013524_+	hypothetical protein	NA	H7BUJ9	unidentified_phage	51.8	2.9e-133
WP_004303984.1|2013540_2013903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008672751.1|2013906_2014098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004293559.1|2014158_2015199_+	hypothetical protein	NA	H7BUJ8	unidentified_phage	58.7	7.6e-118
WP_004293558.1|2015195_2016953_+	PHP domain-containing protein	NA	H7BUJ7	unidentified_phage	47.5	7.8e-115
WP_004293557.1|2016918_2017686_+	site-specific DNA-methyltransferase	NA	A0A2I7QM56	Vibrio_phage	50.6	3.6e-64
WP_004293556.1|2017678_2018221_+	HNH endonuclease	NA	E5DV63	Deep-sea_thermophilic_phage	44.6	1.2e-29
WP_004293555.1|2018220_2018757_+	hypothetical protein	NA	A0A1W6JNG3	Staphylococcus_phage	35.8	4.2e-19
WP_004293554.1|2018829_2020938_+	DNA polymerase III subunit alpha	NA	H7BUJ5	unidentified_phage	58.1	7.9e-247
WP_004293553.1|2020944_2021712_+	3'-5' exonuclease	NA	H7BUJ3	unidentified_phage	54.1	3.9e-71
>prophage 129
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2048146	2049352	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004293527.1|2048146_2049352_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	A0A127AXI2	Bacillus_phage	26.5	2.7e-26
>prophage 130
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2055980	2057141	6571392		Catovirus(100.0%)	1	NA	NA
WP_004293519.1|2055980_2057141_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.4	2.4e-27
>prophage 131
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2060146	2063211	6571392	portal	unidentified_phage(66.67%)	3	NA	NA
WP_004293514.1|2060146_2061166_-	hypothetical protein	NA	H7BUI9	unidentified_phage	54.0	1.0e-111
WP_004303996.1|2061181_2062771_-|portal	phage portal protein	portal	H7BUJ0	unidentified_phage	68.6	6.8e-219
WP_004293512.1|2062776_2063211_-	hypothetical protein	NA	A0A1B1IRB1	uncultured_Mediterranean_phage	41.1	3.0e-20
>prophage 132
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2067828	2068698	6571392		Synechococcus_phage(100.0%)	1	NA	NA
WP_004303999.1|2067828_2068698_-	alpha-1,2-fucosyltransferase	NA	E3SJA0	Synechococcus_phage	29.3	2.6e-23
>prophage 133
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2074033	2078148	6571392		uncultured_Mediterranean_phage(33.33%)	4	NA	NA
WP_004304004.1|2074033_2074936_-	NAD(P)-dependent oxidoreductase	NA	A0A1B1IU29	uncultured_Mediterranean_phage	23.6	9.8e-05
WP_004304005.1|2074935_2076012_-	CDP-glucose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	25.9	1.1e-18
WP_004304006.1|2076015_2076795_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004304007.1|2076801_2078148_-	lipopolysaccharide biosynthesis protein RfbH	NA	C7U074	Ostreococcus_tauri_virus	33.7	9.4e-52
>prophage 134
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2089618	2091606	6571392		Methanothermobacter_phage(50.0%)	2	NA	NA
WP_004297027.1|2089618_2090827_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.9	2.5e-35
WP_004297028.1|2090826_2091606_-	3'-5' exonuclease	NA	I6R9X8	Croceibacter_phage	39.1	5.6e-41
>prophage 135
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2095122	2102965	6571392		Bacillus_phage(33.33%)	7	NA	NA
WP_004304018.1|2095122_2095881_-	MBL fold metallo-hydrolase	NA	U5PU04	Bacillus_phage	44.1	9.7e-06
WP_004304019.1|2095891_2096884_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_004304020.1|2096931_2097780_-	DUF4348 domain-containing protein	NA	NA	NA	NA	NA
WP_004304021.1|2097779_2098733_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_004304022.1|2098869_2100063_+	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	26.0	4.0e-30
WP_004304023.1|2100261_2100669_+	DUF2721 domain-containing protein	NA	NA	NA	NA	NA
WP_004304024.1|2100700_2102965_-	two-component sensor histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	30.8	1.9e-20
>prophage 136
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2106314	2110871	6571392		Planktothrix_phage(50.0%)	6	NA	NA
WP_004304028.1|2106314_2107043_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.9	1.8e-28
WP_004304029.1|2107084_2107696_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_004297046.1|2107826_2108582_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_004304030.1|2108685_2109405_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_004297048.1|2109423_2110014_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_004297049.1|2110013_2110871_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	38.5	1.8e-16
>prophage 137
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2132368	2134462	6571392		Cronobacter_phage(100.0%)	1	NA	NA
WP_004297063.1|2132368_2134462_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A060AN10	Cronobacter_phage	48.7	7.7e-170
>prophage 138
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2188664	2191381	6571392		Streptococcus_phage(50.0%)	3	NA	NA
WP_004304106.1|2188664_2189261_+	3'-5' exonuclease	NA	M1PFD8	Streptococcus_phage	35.5	2.5e-25
WP_004304108.1|2189335_2190505_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_004304110.1|2190568_2191381_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.4	2.9e-16
>prophage 139
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2200940	2203355	6571392		Klosneuvirus(100.0%)	1	NA	NA
WP_004304124.1|2200940_2203355_+	bifunctional biotin synthase/adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.6	9.3e-18
>prophage 140
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2207052	2209410	6571392		Hokovirus(100.0%)	1	NA	NA
WP_004304128.1|2207052_2209410_-	PAS domain-containing protein	NA	A0A1V0SGX0	Hokovirus	32.6	1.9e-39
>prophage 141
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2220093	2225946	6571392		Xanthomonas_phage(25.0%)	5	NA	NA
WP_004304139.1|2220093_2220801_-	RNA ligase family protein	NA	A0A292GKV8	Xanthomonas_phage	35.9	1.4e-22
WP_004304141.1|2220843_2222241_-	RtcB family protein	NA	K4F7X0	Cronobacter_phage	33.4	8.5e-40
WP_008774630.1|2222774_2223251_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	38.4	1.3e-11
WP_004304144.1|2223467_2224685_+	radical SAM protein	NA	NA	NA	NA	NA
WP_004304146.1|2224704_2225946_+	glycosyltransferase family 1 protein	NA	A0A1Q1M959	Agaricus_bisporus_endornavirus	31.8	1.4e-09
>prophage 142
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2263343	2264060	6571392		Planktothrix_phage(100.0%)	1	NA	NA
WP_004304173.1|2263343_2264060_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.3	5.0e-36
>prophage 143
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2279108	2285853	6571392		Bacillus_phage(66.67%)	5	NA	NA
WP_004300627.1|2279108_2280977_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.9	4.2e-58
WP_004300628.1|2280978_2281779_-	DUF3805 domain-containing protein	NA	NA	NA	NA	NA
WP_004300629.1|2281919_2283113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004300631.1|2283354_2284044_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.1	2.9e-25
WP_004300632.1|2284071_2285853_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.6	1.6e-22
>prophage 144
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2297960	2299581	6571392		Burkholderia_virus(50.0%)	2	NA	NA
WP_004304191.1|2297960_2298440_-	single-stranded DNA-binding protein	NA	Q6V7S6	Burkholderia_virus	55.0	4.1e-26
WP_004304192.1|2298531_2299581_-	A/G-specific adenine glycosylase	NA	G3CB03	Aeropyrum_pernix_spindle-shaped_virus	29.9	1.5e-20
>prophage 145
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2314259	2317215	6571392		uncultured_marine_virus(50.0%)	4	NA	NA
WP_004304201.1|2314259_2315639_+	replicative DNA helicase	NA	A0A0F7L6J1	uncultured_marine_virus	36.6	1.4e-66
WP_004304202.1|2315826_2316333_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004304203.1|2316453_2316747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004304204.1|2316765_2317215_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	40.5	5.0e-26
>prophage 146
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2352658	2373130	6571392		Planktothrix_phage(14.29%)	17	NA	NA
WP_004300704.1|2352658_2353324_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	5.1e-35
WP_004304229.1|2353341_2354589_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004304230.1|2354770_2356147_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004304231.1|2356228_2357134_-	LysM peptidoglycan-binding domain-containing protein	NA	S5M9Y4	Brevibacillus_phage	42.9	3.7e-20
WP_004304232.1|2357244_2357727_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_004304233.1|2357729_2358569_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004304234.1|2358657_2359239_+	DUF417 domain-containing protein	NA	NA	NA	NA	NA
WP_004304235.1|2359338_2360712_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	39.6	4.8e-96
WP_004304236.1|2360829_2361318_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004304237.1|2361687_2363388_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	29.8	3.3e-17
WP_004304239.1|2363824_2364613_+	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_004304240.1|2364620_2365184_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_004304241.1|2365264_2366314_+	acyltransferase	NA	G9L6E5	Escherichia_phage	30.9	2.8e-35
WP_004304242.1|2366323_2367499_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_004304243.1|2367859_2369605_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	42.4	5.5e-121
WP_004304244.1|2369814_2371452_-	peptidase C69	NA	NA	NA	NA	NA
WP_032852033.1|2371477_2373130_-	M23 family metallopeptidase	NA	A0A2K9VGT1	Pontimonas_phage	32.4	7.3e-06
>prophage 147
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2390146	2394173	6571392	integrase	Pneumococcus_phage(25.0%)	5	2386954:2386967	2395418:2395431
2386954:2386967	attL	AATTCGGCAATAAA	NA	NA	NA	NA
WP_004304260.1|2390146_2390602_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	64.4	4.0e-47
WP_004300765.1|2391181_2391841_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	50.7	2.1e-57
WP_004304261.1|2391849_2392530_-	queuosine precursor transporter	NA	A0A1W7AG82	Streptococcus_virus	37.6	6.4e-33
WP_085929253.1|2392582_2392822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004291422.1|2392937_2394173_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	31.7	2.6e-24
2395418:2395431	attR	TTTATTGCCGAATT	NA	NA	NA	NA
>prophage 148
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2397831	2411241	6571392		Streptococcus_phage(50.0%)	5	NA	NA
WP_004291456.1|2397831_2399919_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	31.7	4.2e-43
WP_004291461.1|2399946_2400534_+	DUF1896 domain-containing protein	NA	NA	NA	NA	NA
WP_004291462.1|2400523_2406340_+	N-6 DNA methylase	NA	A0A223W0B5	Agrobacterium_phage	25.5	3.0e-155
WP_004291466.1|2406997_2408923_+	tetracycline resistance ribosomal protection protein Tet(Q)	NA	A0A1S5SF82	Streptococcus_phage	41.0	4.5e-140
WP_004291467.1|2408922_2411241_+	hybrid sensor histidine kinase/response regulator	NA	B5LWN0	Feldmannia_species_virus	25.1	1.6e-19
>prophage 149
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2437423	2437732	6571392		Rhodobacter_phage(100.0%)	1	NA	NA
WP_004304290.1|2437423_2437732_-	hypothetical protein	NA	A0A0K1LL53	Rhodobacter_phage	44.6	4.8e-12
>prophage 150
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2441944	2442451	6571392		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_004300768.1|2441944_2442451_-	RNA polymerase sigma factor	NA	A0A0F6TH34	Sinorhizobium_phage	30.0	2.1e-12
>prophage 151
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2445601	2446603	6571392		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_004304300.1|2445601_2446603_+	2-hydroxyacid dehydrogenase	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	44.8	6.9e-60
>prophage 152
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2467075	2477429	6571392	transposase	Bacillus_phage(20.0%)	7	NA	NA
WP_004304328.1|2467075_2468926_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.0	1.2e-20
WP_004304329.1|2468922_2470878_+	HAMP domain-containing histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	33.3	9.6e-05
WP_004300795.1|2470917_2472240_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_004300796.1|2472344_2473667_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_004304330.1|2473823_2474705_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	32.3	4.3e-29
WP_004304331.1|2474701_2475850_+	CapA family protein	NA	A0A2H4JG01	uncultured_Caudovirales_phage	34.5	7.0e-40
WP_032852014.1|2476133_2477429_+|transposase	transposase	transposase	H7BVW5	unidentified_phage	49.8	1.3e-71
>prophage 153
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2481910	2482798	6571392		Myxococcus_phage(100.0%)	1	NA	NA
WP_004304336.1|2481910_2482798_+	AAA family ATPase	NA	Q94MN8	Myxococcus_phage	38.3	1.3e-33
>prophage 154
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2489597	2491463	6571392		Streptococcus_virus(100.0%)	1	NA	NA
WP_004304345.1|2489597_2491463_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	43.7	3.0e-48
>prophage 155
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2507488	2514669	6571392		Herpes_simplex_virus(50.0%)	3	NA	NA
WP_085929260.1|2507488_2510563_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	34.5	4.3e-153
WP_004304360.1|2510742_2513067_-	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_004304361.1|2513085_2514669_-	sulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	32.4	3.1e-06
>prophage 156
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2525887	2535415	6571392		Hokovirus(33.33%)	5	NA	NA
WP_004300820.1|2525887_2527870_-	response regulator	NA	A0A1V0SGX0	Hokovirus	30.5	9.6e-37
WP_085929262.1|2527978_2528719_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_004300822.1|2528764_2530195_-	phosphotransferase	NA	NA	NA	NA	NA
WP_004300823.1|2530703_2534651_+	hybrid sensor histidine kinase/response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.5	1.2e-11
WP_004300824.1|2534758_2535415_-	fructose-6-phosphate aldolase	NA	H8ZMU3	Synechococcus_phage	44.6	1.2e-47
>prophage 157
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2547337	2550633	6571392		Tupanvirus(50.0%)	2	NA	NA
WP_032849299.1|2547337_2549143_+	PAS domain-containing hybrid sensor histidine kinase/response regulator	NA	A0A2K9L0Z8	Tupanvirus	33.7	5.9e-25
WP_004304375.1|2549178_2550633_-	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	24.9	6.2e-09
>prophage 158
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2567413	2571547	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004304384.1|2567413_2571547_+	response regulator	NA	W8CYM9	Bacillus_phage	37.1	5.3e-13
>prophage 159
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2579547	2580567	6571392	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_004300862.1|2579547_2580567_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	33.2	1.0e-26
>prophage 160
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2592126	2592663	6571392		Clostridioides_phage(100.0%)	1	NA	NA
WP_004304401.1|2592126_2592663_-	NAD(P)H nitroreductase	NA	A0A1V0E011	Clostridioides_phage	33.9	3.5e-18
>prophage 161
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2613860	2615660	6571392		uncultured_marine_virus(100.0%)	1	NA	NA
WP_004304414.1|2613860_2615660_+	AAA family ATPase	NA	A0A0F7L6A5	uncultured_marine_virus	33.9	1.5e-84
>prophage 162
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2629075	2646737	6571392		Erysipelothrix_phage(20.0%)	10	NA	NA
WP_004304425.1|2629075_2630650_-	peptide chain release factor 3	NA	A0A2K5B2A5	Erysipelothrix_phage	26.5	5.5e-35
WP_004304426.1|2630740_2631607_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	37.6	2.5e-34
WP_004304427.1|2631607_2632153_-	DUF4924 family protein	NA	NA	NA	NA	NA
WP_004310295.1|2632164_2632818_-	LysE family transporter	NA	NA	NA	NA	NA
WP_009040525.1|2633076_2636781_+	phosphoribosylformylglycinamidine synthase	NA	A0A0S0BVK5	Lymphocryptovirus	25.6	2.3e-36
WP_004304430.1|2637049_2641060_+	hybrid sensor histidine kinase/response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.9	5.9e-09
WP_004300957.1|2641056_2641599_+	chromate transporter	NA	NA	NA	NA	NA
WP_004300958.1|2641717_2642266_+	chromate transporter	NA	NA	NA	NA	NA
WP_032852024.1|2642362_2643871_-	family 10 glycosylhydrolase	NA	NA	NA	NA	NA
WP_004304432.1|2643965_2646737_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	44.6	1.0e-225
>prophage 163
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2664273	2665500	6571392		Bacillus_virus(100.0%)	1	NA	NA
WP_004307077.1|2664273_2665500_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	41.1	3.5e-29
>prophage 164
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2678955	2680791	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004307086.1|2678955_2680791_-	DUF4980 domain-containing protein	NA	S6ATV4	Bacillus_phage	35.3	6.3e-67
>prophage 165
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2743720	2744449	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004301008.1|2743720_2744449_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	25.0	4.6e-05
>prophage 166
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2778745	2779711	6571392		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_004307143.1|2778745_2779711_-	J domain-containing protein	NA	A0A0N9QPY2	Chrysochromulina_ericina_virus	21.3	7.3e-06
>prophage 167
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2784424	2786164	6571392		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_032852211.1|2784424_2786164_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	27.1	2.7e-35
>prophage 168
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2797767	2799721	6571392		uncultured_virus(100.0%)	2	NA	NA
WP_004301061.1|2797767_2799405_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	62.5	2.5e-184
WP_004301062.1|2799448_2799721_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	46.1	3.1e-15
>prophage 169
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2808435	2813521	6571392	tRNA	Tupanvirus(50.0%)	4	NA	NA
WP_004301086.1|2808435_2809800_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	31.9	4.0e-50
WP_004301089.1|2810040_2810721_-	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_004307183.1|2810841_2812140_-	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_004301093.1|2812249_2813521_-	adenylosuccinate synthase	NA	A0A0B5J049	Pandoravirus	31.5	2.9e-55
>prophage 170
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2817634	2821446	6571392		Acanthamoeba_polyphaga_lentillevirus(50.0%)	3	NA	NA
WP_032849097.1|2817634_2819443_+	DNA helicase RecQ	NA	J2YAJ8	Acanthamoeba_polyphaga_lentillevirus	38.7	1.7e-93
WP_004307188.1|2819649_2820468_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004307189.1|2820495_2821446_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	52.6	2.4e-78
>prophage 171
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2829045	2830542	6571392		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_004301125.1|2829045_2830542_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	30.6	1.4e-08
>prophage 172
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2838218	2839325	6571392		Pectobacterium_phage(100.0%)	1	NA	NA
WP_004306902.1|2838218_2839325_+	AAA family ATPase	NA	A0A1L2CVN9	Pectobacterium_phage	33.7	2.5e-10
>prophage 173
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2848407	2849583	6571392		Agrobacterium_phage(100.0%)	1	NA	NA
WP_004296833.1|2848407_2849583_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	29.6	1.9e-32
>prophage 174
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2866266	2868294	6571392		Enterobacteria_phage(50.0%)	2	NA	NA
WP_004296806.1|2866266_2867136_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.0	4.4e-95
WP_004296805.1|2867157_2868294_+	dTDP-glucose 4,6-dehydratase	NA	K7QJG5	Escherichia_phage	43.0	1.5e-74
>prophage 175
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2882805	2888458	6571392		environmental_halophage(33.33%)	4	NA	NA
WP_004306876.1|2882805_2883894_+	2-aminoethylphosphonate--pyruvate transaminase	NA	Q2XUY6	environmental_halophage	29.2	5.7e-07
WP_004296786.1|2883994_2885398_-	MFS transporter	NA	NA	NA	NA	NA
WP_004296782.1|2885603_2886062_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	K4F5U2	Cronobacter_phage	42.8	1.1e-28
WP_004296781.1|2886064_2888458_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A0A8WEK0	Clostridium_phage	46.1	9.7e-185
>prophage 176
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2912095	2913724	6571392		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_004306862.1|2912095_2913724_-	beta-N-acetylhexosaminidase	NA	A0A2H4UUW7	Bodo_saltans_virus	27.7	2.6e-08
>prophage 177
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2928945	2930406	6571392		Tupanvirus(100.0%)	1	NA	NA
WP_004297668.1|2928945_2930406_+	catalase	NA	A0A2K9L0T1	Tupanvirus	46.9	7.2e-98
>prophage 178
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2951042	2953160	6571392		Klosneuvirus(100.0%)	1	NA	NA
WP_004326065.1|2951042_2953160_+	S9 family peptidase	NA	A0A1V0SHT0	Klosneuvirus	35.1	1.1e-75
>prophage 179
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2957785	2961570	6571392		Tetraselmis_virus(50.0%)	3	NA	NA
WP_004306830.1|2957785_2959312_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	27.8	9.0e-35
WP_004306829.1|2959479_2959923_+	VOC family protein	NA	NA	NA	NA	NA
WP_004297989.1|2960136_2961570_-	HD domain-containing protein	NA	A0A249XS88	Mycobacterium_phage	35.4	1.7e-27
>prophage 180
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2977830	2984478	6571392		Tupanvirus(50.0%)	4	NA	NA
WP_004306815.1|2977830_2979468_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	27.5	6.7e-52
WP_004306814.1|2979566_2979977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004306813.1|2980065_2981301_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004306812.1|2981379_2984478_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	24.8	9.3e-87
>prophage 181
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	2991620	2992915	6571392		Geobacillus_virus(50.0%)	2	NA	NA
WP_004297955.1|2991620_2992415_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	65.9	1.5e-102
WP_004297954.1|2992420_2992915_+	dihydrofolate reductase	NA	J9PU01	Bacillus_phage	41.5	1.6e-25
>prophage 182
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3040268	3041963	6571392		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_004306746.1|3040268_3041963_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	28.4	1.2e-56
>prophage 183
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3049112	3058921	6571392		Pandoravirus(33.33%)	6	NA	NA
WP_004306728.1|3049112_3050189_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	49.7	1.5e-89
WP_004299465.1|3050188_3051553_+	dipeptidase	NA	NA	NA	NA	NA
WP_004306725.1|3051663_3052722_-	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_004306721.1|3052972_3053839_+	formylglycine-generating enzyme family protein	NA	A0A075BUR2	Microcystis_phage	42.3	1.7e-22
WP_004306718.1|3053920_3055960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004306716.1|3056746_3058921_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	34.0	1.3e-47
>prophage 184
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3089731	3090487	6571392		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_004306689.1|3089731_3090487_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.5	3.7e-13
>prophage 185
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3128165	3129893	6571392	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_004306657.1|3128165_3129893_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	38.9	7.0e-92
>prophage 186
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3133970	3134654	6571392		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_004306653.1|3133970_3134654_+	HAD family hydrolase	NA	M1H491	Acanthocystis_turfacea_Chlorella_virus	23.0	3.0e-06
>prophage 187
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3138942	3140649	6571392		Heterosigma_akashiwo_virus(50.0%)	2	NA	NA
WP_004306648.1|3138942_3139980_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.0	3.2e-52
WP_004306646.1|3139986_3140649_+	uracil-DNA glycosylase	NA	U5U481	Elephant_endotheliotropic_herpesvirus	44.6	1.5e-47
>prophage 188
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3152201	3161601	6571392		Acanthamoeba_polyphaga_mimivirus(25.0%)	7	NA	NA
WP_004306632.1|3152201_3152927_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.1	1.9e-19
WP_032852169.1|3152972_3153917_-	transporter	NA	NA	NA	NA	NA
WP_032852178.1|3153998_3155258_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	30.0	3.8e-15
WP_004306627.1|3155267_3156161_+	MCE family protein	NA	NA	NA	NA	NA
WP_004299347.1|3156512_3157925_+	chromosomal replication initiator protein DnaA	NA	A0A1B1IQK0	uncultured_Mediterranean_phage	32.4	6.2e-06
WP_004306625.1|3158029_3158773_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004306623.1|3159057_3161601_+	adenosylcobalamin-dependent ribonucleoside-diphosphate reductase	NA	A0A0A0UZT5	uncultured_virus	41.4	3.2e-93
>prophage 189
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3170170	3171844	6571392		Catovirus(100.0%)	1	NA	NA
WP_004306616.1|3170170_3171844_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	26.2	1.6e-32
>prophage 190
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3217272	3217587	6571392		Streptomyces_phage(100.0%)	1	NA	NA
WP_004306576.1|3217272_3217587_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	47.8	5.1e-17
>prophage 191
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3237169	3240976	6571392		Saccharomonospora_phage(100.0%)	1	NA	NA
WP_004307927.1|3237169_3240976_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	33.7	2.2e-186
>prophage 192
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3252641	3255305	6571392		Herpes_simplex_virus(100.0%)	1	NA	NA
WP_004306546.1|3252641_3255305_-	DUF4982 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	26.0	1.3e-23
>prophage 193
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3262275	3266307	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004306539.1|3262275_3266307_-	response regulator	NA	W8CYF6	Bacillus_phage	28.4	3.8e-16
>prophage 194
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3270443	3273476	6571392		Leptospira_phage(100.0%)	1	NA	NA
WP_004306531.1|3270443_3273476_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.3	1.3e-77
>prophage 195
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3306746	3308914	6571392		Streptococcus_phage(50.0%)	3	NA	NA
WP_004299177.1|3306746_3307421_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.3	8.0e-52
WP_004306490.1|3307433_3308174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004299175.1|3308314_3308914_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	46.7	3.5e-35
>prophage 196
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3314934	3315435	6571392		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_004306470.1|3314934_3315435_+	RNA polymerase sigma factor	NA	A0A0F6TH34	Sinorhizobium_phage	32.9	1.4e-13
>prophage 197
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3330676	3338554	6571392		Acanthamoeba_polyphaga_mimivirus(40.0%)	6	NA	NA
WP_004306442.1|3330676_3331531_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.7	4.7e-17
WP_004306441.1|3331527_3332058_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	42.3	5.9e-18
WP_004306440.1|3332493_3334587_-	helicase	NA	I6R9L9	Nonlabens_phage	27.9	6.8e-25
WP_004306439.1|3334934_3335585_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_032852166.1|3335798_3336878_-	choloylglycine hydrolase family protein	NA	A0A1J0F9I3	Only_Syngen_Nebraska_virus	28.4	1.5e-23
WP_004306437.1|3337045_3338554_-	GAF domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	35.2	1.4e-27
>prophage 198
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3354988	3357622	6571392		Brazilian_cedratvirus(50.0%)	3	NA	NA
WP_004306418.1|3354988_3355615_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	40.7	1.2e-22
WP_004299136.1|3355686_3356157_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004299135.1|3356335_3357622_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	28.2	9.3e-17
>prophage 199
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3377864	3383728	6571392		Phage_TP(50.0%)	5	NA	NA
WP_004306403.1|3377864_3379694_-	U32 family peptidase	NA	Q6DW11	Phage_TP	27.2	1.9e-23
WP_004299113.1|3379690_3380608_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_002559159.1|3380788_3380959_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_004306402.1|3381234_3382428_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_004299085.1|3382510_3383728_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.1	3.2e-99
>prophage 200
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3388107	3394286	6571392		Hokovirus(50.0%)	5	NA	NA
WP_032852173.1|3388107_3389547_-	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	28.6	2.0e-15
WP_004299029.1|3389567_3390698_-	sensor protein KdpD	NA	NA	NA	NA	NA
WP_004306399.1|3390780_3391545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004306397.1|3391663_3392236_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_004306396.1|3392252_3394286_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.4	4.0e-38
>prophage 201
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3426477	3430509	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004307058.1|3426477_3430509_-	hybrid sensor histidine kinase/response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.6	4.5e-09
>prophage 202
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3459176	3462758	6571392		Herpes_simplex_virus(100.0%)	1	NA	NA
WP_004307038.1|3459176_3462758_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	33.3	1.5e-144
>prophage 203
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3481974	3488952	6571392		Vibrio_phage(33.33%)	7	NA	NA
WP_004307027.1|3481974_3483753_+	signal peptide peptidase SppA	NA	A0A2I7QTH6	Vibrio_phage	27.9	3.2e-07
WP_004307026.1|3483763_3484894_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004298940.1|3484850_3485660_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	41.3	4.2e-55
WP_004298938.1|3485676_3486714_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_004307025.1|3487032_3487239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004307024.1|3487288_3487774_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004296138.1|3487827_3488952_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.9	6.9e-48
>prophage 204
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3518213	3518930	6571392		Planktothrix_phage(100.0%)	1	NA	NA
WP_004296202.1|3518213_3518930_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	7.5e-32
>prophage 205
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3533699	3535658	6571392		Streptococcus_phage(100.0%)	1	NA	NA
WP_085929314.1|3533699_3535658_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.1	1.1e-98
>prophage 206
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3539969	3540479	6571392		Tetraselmis_virus(100.0%)	1	NA	NA
WP_004296231.1|3539969_3540479_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.8	2.3e-27
>prophage 207
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3551637	3557180	6571392		Ectocarpus_siliculosus_virus(33.33%)	4	NA	NA
WP_050541644.1|3551637_3552813_+	two-component sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	31.0	8.8e-22
WP_004306968.1|3552903_3555609_+	calcium-translocating P-type ATPase, PMCA-type	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	34.6	3.5e-114
WP_004296245.1|3555598_3556222_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_004306965.1|3556232_3557180_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	27.3	2.1e-05
>prophage 208
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3560593	3561397	6571392		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_004306949.1|3560593_3561397_-	glycoside hydrolase family 16 protein	NA	A0A0F6SIT8	Sinorhizobium_phage	32.1	2.8e-11
>prophage 209
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3583225	3584494	6571392		Hokovirus(100.0%)	1	NA	NA
WP_004306927.1|3583225_3584494_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	35.8	3.9e-31
>prophage 210
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3591294	3595711	6571392	integrase	unidentified_phage(50.0%)	5	3584989:3585002	3600785:3600798
3584989:3585002	attL	AGCAGTAGCTTCTT	NA	NA	NA	NA
WP_004306918.1|3591294_3592527_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	33.8	6.6e-28
WP_004306917.1|3592810_3593617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004306916.1|3593627_3593996_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004306915.1|3594007_3594859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004306914.1|3594865_3595711_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.8e-15
3600785:3600798	attR	AGCAGTAGCTTCTT	NA	NA	NA	NA
>prophage 211
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3610908	3618267	6571392		Pseudomonas_phage(50.0%)	5	NA	NA
WP_004307510.1|3610908_3612396_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	43.4	1.2e-68
WP_085929330.1|3612382_3613252_-	lipase	NA	NA	NA	NA	NA
WP_004307512.1|3613286_3614687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004307513.1|3614802_3615096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004307514.1|3615108_3618267_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	26.0	3.8e-104
>prophage 212
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3621851	3623351	6571392		Catovirus(100.0%)	1	NA	NA
WP_004307519.1|3621851_3623351_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.2	1.1e-82
>prophage 213
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3629793	3631608	6571392		Phaeocystis_pouchetii_virus(100.0%)	1	NA	NA
WP_004307525.1|3629793_3631608_+	hypothetical protein	NA	F2QAF8	Phaeocystis_pouchetii_virus	23.1	4.3e-07
>prophage 214
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3647857	3659844	6571392		Streptococcus_phage(33.33%)	6	NA	NA
WP_004307538.1|3647857_3649975_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	25.0	8.1e-50
WP_004307540.1|3650020_3650497_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_002558078.1|3650640_3651051_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_004307542.1|3651187_3651496_-	DUF3467 domain-containing protein	NA	NA	NA	NA	NA
WP_004296356.1|3651643_3655927_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	61.0	3.0e-03
WP_004307544.1|3656031_3659844_-	DNA-directed RNA polymerase subunit beta	NA	A0A2P0VMZ3	Tetraselmis_virus	30.9	1.0e-26
>prophage 215
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3663061	3668251	6571392		Klosneuvirus(33.33%)	5	NA	NA
WP_004307553.1|3663061_3664246_-	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	26.2	5.2e-14
WP_004296365.1|3664819_3665119_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_004307555.1|3665134_3666016_-	tyrosine recombinase XerC	NA	A0A1P8DJJ6	Virus_Rctr41k	27.0	1.1e-13
WP_002558090.1|3666089_3666281_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004307557.1|3666469_3668251_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	40.7	2.0e-126
>prophage 216
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3698631	3700416	6571392		Tupanvirus(100.0%)	1	NA	NA
WP_004302372.1|3698631_3700416_-	AAA family ATPase	NA	A0A2K9L1J2	Tupanvirus	31.3	3.0e-21
>prophage 217
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3710588	3713795	6571392		Leptospira_phage(100.0%)	1	NA	NA
WP_004302385.1|3710588_3713795_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	20.9	1.0e-48
>prophage 218
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3720853	3725525	6571392		Staphylococcus_phage(50.0%)	4	NA	NA
WP_004296397.1|3720853_3722503_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	24.0	3.2e-30
WP_004296396.1|3722538_3723114_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004296393.1|3723300_3723570_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_004302390.1|3723725_3725525_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	41.4	6.7e-21
>prophage 219
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3730788	3732396	6571392		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004302393.1|3730788_3732396_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	48.2	5.4e-123
>prophage 220
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3742252	3746886	6571392		Pandoravirus(33.33%)	3	NA	NA
WP_004296427.1|3742252_3743683_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	31.8	2.0e-52
WP_004302402.1|3743854_3745057_+	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.4	3.2e-27
WP_004302403.1|3745197_3746886_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	28.7	1.3e-21
>prophage 221
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3777225	3778368	6571392		Streptococcus_phage(100.0%)	1	NA	NA
WP_004302424.1|3777225_3778368_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	36.6	9.7e-42
>prophage 222
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3812601	3819245	6571392		Bacillus_phage(50.0%)	3	NA	NA
WP_032851825.1|3812601_3816549_+	hybrid sensor histidine kinase/response regulator	NA	W8CYM9	Bacillus_phage	27.3	6.2e-11
WP_004302474.1|3816736_3817444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004302476.1|3817694_3819245_-	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	32.8	3.0e-33
>prophage 223
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3829607	3831953	6571392		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_004302491.1|3829607_3831953_+	type I DNA topoisomerase	NA	A0A0G2Y787	Acanthamoeba_polyphaga_mimivirus	39.3	3.2e-140
>prophage 224
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3835537	3845891	6571392	protease,tRNA	Orpheovirus(25.0%)	7	NA	NA
WP_156202079.1|3835537_3837355_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	29.3	1.4e-47
WP_004296482.1|3837438_3837711_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	52.2	1.2e-14
WP_085929215.1|3837932_3838610_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_004296484.1|3838590_3839496_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_004302497.1|3839500_3840586_+	endonuclease	NA	NA	NA	NA	NA
WP_085929216.1|3840617_3842702_+	M3 family metallopeptidase	NA	A0A1V0SD92	Indivirus	23.5	3.1e-38
WP_004302499.1|3842867_3845891_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	32.5	1.1e-28
>prophage 225
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3863548	3865342	6571392		Vaccinia_virus(100.0%)	1	NA	NA
WP_004302510.1|3863548_3865342_-	glycoside hydrolase family 2	NA	B9U1V4	Vaccinia_virus	25.9	1.6e-46
>prophage 226
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3895746	3899136	6571392		Norovirus(100.0%)	1	NA	NA
WP_004302528.1|3895746_3899136_-	TonB-dependent receptor	NA	Q2PGD7	Norovirus	44.4	1.4e-32
>prophage 227
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3905494	3906454	6571392		Brevibacillus_phage(100.0%)	1	NA	NA
WP_004302532.1|3905494_3906454_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	32.3	2.5e-35
>prophage 228
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3911117	3912671	6571392		Feldmannia_irregularis_virus(100.0%)	1	NA	NA
WP_032851828.1|3911117_3912671_+	HAMP domain-containing histidine kinase	NA	Q6XM27	Feldmannia_irregularis_virus	30.2	3.6e-07
>prophage 229
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3958335	3962352	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004302562.1|3958335_3962352_-	response regulator	NA	W8CYM9	Bacillus_phage	39.0	1.1e-12
>prophage 230
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3965448	3970976	6571392	tRNA	Tupanvirus(50.0%)	4	NA	NA
WP_004302564.1|3965448_3967488_+|tRNA	methionine--tRNA ligase	tRNA	A0A2K9KZR3	Tupanvirus	35.2	1.2e-85
WP_004302565.1|3967560_3969015_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_004302566.1|3969004_3970057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004302567.1|3970112_3970976_+	LicD family protein	NA	A0A1V0SD50	Indivirus	37.7	3.4e-07
>prophage 231
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3980329	3981028	6571392		Vibrio_phage(100.0%)	1	NA	NA
WP_004302577.1|3980329_3981028_-	NAD-dependent deacylase	NA	A0A126HHA0	Vibrio_phage	32.9	1.4e-27
>prophage 232
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3984267	3990041	6571392	integrase	unidentified_phage(33.33%)	9	3984080:3984093	3994824:3994837
3984080:3984093	attL	CCAGGCTGGTCCAC	NA	NA	NA	NA
WP_004302582.1|3984267_3985533_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	26.5	2.5e-22
WP_004302583.1|3985529_3985784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004302584.1|3985810_3986107_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004302585.1|3986103_3987156_+	DUF4373 domain-containing protein	NA	A0A0H4TKJ7	Bacillus_phage	30.2	2.9e-08
WP_004302586.1|3987176_3987410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004302587.1|3987406_3987676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147294915.1|3987979_3988312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004302588.1|3989153_3989405_+	DUF4248 domain-containing protein	NA	NA	NA	NA	NA
WP_004302589.1|3989567_3990041_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7RGA4	Vibrio_phage	45.3	2.4e-26
3994824:3994837	attR	CCAGGCTGGTCCAC	NA	NA	NA	NA
>prophage 233
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	3996018	3996522	6571392		Rhizobium_phage(100.0%)	1	NA	NA
WP_004302598.1|3996018_3996522_-	RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	31.8	4.9e-06
>prophage 234
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4035571	4044444	6571392		Bacillus_phage(33.33%)	5	NA	NA
WP_004302623.1|4035571_4037449_+	type IIA DNA topoisomerase subunit B	NA	A0A172JHT4	Bacillus_phage	33.0	1.0e-64
WP_004298426.1|4037445_4037904_+	pantetheine-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_004302624.1|4037941_4039519_+	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	26.8	1.3e-20
WP_004302625.1|4039674_4041903_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_032851832.1|4041918_4044444_-	DUF4982 domain-containing protein	NA	B9U1V4	Vaccinia_virus	26.9	1.7e-22
>prophage 235
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4047470	4051511	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_032851833.1|4047470_4051511_-	hybrid sensor histidine kinase/response regulator	NA	W8CYF6	Bacillus_phage	30.6	1.2e-22
>prophage 236
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4083205	4086406	6571392		Norovirus(100.0%)	1	NA	NA
WP_004302646.1|4083205_4086406_-	TonB-dependent receptor	NA	Q2PGD7	Norovirus	27.6	2.6e-07
>prophage 237
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4100408	4104527	6571392		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_004302655.1|4100408_4104527_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.7	1.1e-23
>prophage 238
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4121240	4125431	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_032851868.1|4121240_4125431_-	response regulator	NA	W8CYM9	Bacillus_phage	33.6	9.2e-13
>prophage 239
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4135145	4138109	6571392		Herpes_simplex_virus(100.0%)	1	NA	NA
WP_004302672.1|4135145_4138109_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	21.8	1.5e-09
>prophage 240
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4157959	4159249	6571392		Phage_TP(100.0%)	1	NA	NA
WP_004302691.1|4157959_4159249_-	U32 family peptidase	NA	Q6DW11	Phage_TP	28.2	1.4e-20
>prophage 241
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4175443	4177600	6571392		Lactococcus_phage(100.0%)	1	NA	NA
WP_004302715.1|4175443_4177600_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.3	4.4e-59
>prophage 242
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4194638	4198610	6571392		Feldmannia_irregularis_virus(100.0%)	1	NA	NA
WP_004302732.1|4194638_4198610_+	response regulator	NA	Q6XLV6	Feldmannia_irregularis_virus	22.4	9.9e-17
>prophage 243
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4208884	4209832	6571392		Streptococcus_phage(100.0%)	1	NA	NA
WP_004302743.1|4208884_4209832_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	58.5	1.9e-91
>prophage 244
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4222536	4224114	6571392		Aeromonas_phage(100.0%)	1	NA	NA
WP_004302755.1|4222536_4224114_-	sodium/solute symporter	NA	A0A240F3J2	Aeromonas_phage	28.7	5.8e-45
>prophage 245
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4231281	4233060	6571392		Lactobacillus_phage(100.0%)	1	NA	NA
WP_004302759.1|4231281_4233060_-	cycloisomaltooligosaccharide glucanotransferase	NA	G4U401	Lactobacillus_phage	29.4	2.8e-56
>prophage 246
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4252486	4256497	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004302772.1|4252486_4256497_+	response regulator	NA	W8CYF6	Bacillus_phage	28.2	8.2e-19
>prophage 247
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4279069	4279951	6571392		Bacillus_virus(100.0%)	1	NA	NA
WP_032851874.1|4279069_4279951_+	AAA family ATPase	NA	G3MAX6	Bacillus_virus	43.5	7.2e-53
>prophage 248
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4283943	4286532	6571392		Klosneuvirus(100.0%)	1	NA	NA
WP_032846723.1|4283943_4286532_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	27.2	7.6e-42
>prophage 249
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4304775	4309275	6571392	tRNA	Staphylococcus_phage(50.0%)	3	NA	NA
WP_004302801.1|4304775_4307610_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.1	5.5e-203
WP_004302802.1|4307725_4308643_+	YitT family protein	NA	NA	NA	NA	NA
WP_032851877.1|4308693_4309275_+	non-canonical purine NTP diphosphatase	NA	A0A0P0A1X5	Cassava_brown_streak_virus	35.1	2.4e-20
>prophage 250
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4316557	4320616	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004302808.1|4316557_4320616_-	response regulator	NA	W8CYM9	Bacillus_phage	33.6	2.3e-08
>prophage 251
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4355177	4359149	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004302828.1|4355177_4359149_-	hybrid sensor histidine kinase/response regulator transcription factor	NA	W8CYF6	Bacillus_phage	25.8	1.1e-15
>prophage 252
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4380977	4387720	6571392		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_004302841.1|4380977_4382657_-	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	26.3	2.4e-36
WP_004302842.1|4382906_4383485_+	rubrerythrin family protein	NA	NA	NA	NA	NA
WP_004302843.1|4383766_4387720_-	hybrid sensor histidine kinase/response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	8.7e-13
>prophage 253
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4411134	4413365	6571392		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_004302869.1|4411134_4412004_+	DUF4373 domain-containing protein	NA	A0A2H4JAR8	uncultured_Caudovirales_phage	31.4	1.2e-10
WP_004302871.1|4412208_4412727_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004302872.1|4412828_4413365_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	44.0	1.2e-31
>prophage 254
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4428278	4429571	6571392		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004298895.1|4428278_4429571_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	49.2	1.4e-108
>prophage 255
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4440777	4443095	6571392	tRNA	Staphylococcus_phage(50.0%)	3	NA	NA
WP_032846610.1|4440777_4440999_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	60.3	1.9e-18
WP_004302916.1|4441023_4441716_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_004302917.1|4441802_4443095_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	39.5	1.0e-71
>prophage 256
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4477472	4485576	6571392	integrase	Acanthamoeba_polyphaga_mimivirus(50.0%)	10	4476117:4476133	4493156:4493172
4476117:4476133	attL	AGTCAAGCATAACTTTC	NA	NA	NA	NA
WP_004302936.1|4477472_4478324_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	47.1	2.3e-16
WP_004302937.1|4478326_4479049_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	43.3	7.3e-19
WP_004302938.1|4479008_4479695_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_004302939.1|4479698_4480550_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004302940.1|4481051_4481504_-	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_004302941.1|4481557_4481956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004302942.1|4481990_4483223_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	29.7	1.5e-27
WP_004302944.1|4483961_4484279_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004302945.1|4484387_4484729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004302946.1|4484802_4485576_-	metal ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.7	2.0e-14
4493156:4493172	attR	AGTCAAGCATAACTTTC	NA	NA	NA	NA
>prophage 257
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4499552	4502402	6571392		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_032851850.1|4499552_4502402_-	DNA polymerase I	NA	A0A1B1IST8	uncultured_Mediterranean_phage	30.4	1.9e-62
>prophage 258
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4508383	4508914	6571392		Klosneuvirus(100.0%)	1	NA	NA
WP_004302961.1|4508383_4508914_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.5	1.3e-28
>prophage 259
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4533552	4534584	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004298040.1|4533552_4534584_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.8	5.2e-10
>prophage 260
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4544185	4548238	6571392		Hokovirus(100.0%)	1	NA	NA
WP_004302972.1|4544185_4548238_-	response regulator	NA	A0A1V0SGX0	Hokovirus	23.4	1.3e-16
>prophage 261
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4552511	4556768	6571392		Herpes_simplex_virus(100.0%)	1	NA	NA
WP_004302974.1|4552511_4556768_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	32.2	9.3e-138
>prophage 262
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4566554	4569725	6571392		Norovirus(100.0%)	1	NA	NA
WP_004302981.1|4566554_4569725_-	TonB-dependent receptor	NA	Q2PGD7	Norovirus	37.0	3.6e-17
>prophage 263
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4575696	4577631	6571392		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_004302985.1|4575696_4577631_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.8	1.1e-53
>prophage 264
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4584490	4590733	6571392		Escherichia_phage(25.0%)	6	NA	NA
WP_004298060.1|4584490_4585096_-	SIS domain-containing protein	NA	A0A060BMQ0	Escherichia_phage	35.8	2.5e-20
WP_004302991.1|4585102_4585636_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	25.8	1.9e-08
WP_004302992.1|4585741_4586962_+	insulinase family protein	NA	A0A2K9L1M6	Tupanvirus	26.1	3.7e-39
WP_004302993.1|4587047_4588616_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_004298064.1|4588629_4589727_+	hydrolase	NA	NA	NA	NA	NA
WP_004298066.1|4589833_4590733_-	glycerophosphodiester phosphodiesterase family protein	NA	A0A173GBD0	Staphylococcus_phage	41.3	1.6e-10
>prophage 265
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4655550	4661438	6571392		Tetraselmis_virus(50.0%)	2	NA	NA
WP_004307484.1|4655550_4657086_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	24.6	8.5e-25
WP_004307483.1|4657379_4661438_-	hybrid sensor histidine kinase/response regulator transcription factor	NA	W8CYF6	Bacillus_phage	28.1	1.4e-18
>prophage 266
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4669275	4672383	6571392		Herpes_simplex_virus(100.0%)	1	NA	NA
WP_004307477.1|4669275_4672383_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	32.7	2.0e-137
>prophage 267
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4714933	4716415	6571392	tRNA	Catovirus(100.0%)	1	NA	NA
WP_004307451.1|4714933_4716415_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	26.2	1.6e-36
>prophage 268
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4725201	4728042	6571392		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_004307446.1|4725201_4728042_-	DEAD/DEAH box helicase	NA	M1HJI9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.7e-39
>prophage 269
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4731322	4736691	6571392		Ostreococcus_tauri_virus(20.0%)	6	NA	NA
WP_004307443.1|4731322_4732333_+	6-phosphofructokinase	NA	H8ZJH0	Ostreococcus_tauri_virus	28.7	8.4e-13
WP_004307442.1|4732274_4733339_-	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	34.2	8.5e-24
WP_004307441.1|4733304_4734567_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_004291965.1|4734582_4734819_-	acyl carrier protein	NA	A0A1P8VWH3	Flavobacterium_phage	35.6	7.4e-05
WP_004307440.1|4734917_4735544_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	32.1	6.8e-21
WP_004307439.1|4735650_4736691_-	4-phosphoerythronate dehydrogenase PdxB	NA	Q89388	Paramecium_bursaria_Chlorella_virus	30.1	3.0e-21
>prophage 270
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4743740	4748337	6571392	holin	Emiliania_huxleyi_virus(33.33%)	5	NA	NA
WP_004307433.1|4743740_4744553_-	LicD family protein	NA	G8DGF1	Emiliania_huxleyi_virus	30.0	1.0e-05
WP_004298295.1|4744568_4745300_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_004298294.1|4745296_4746346_-	histidinol-phosphate aminotransferase family protein	NA	A0A1X6WGT4	Pacmanvirus	27.6	8.2e-11
WP_004298293.1|4746347_4747157_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_004307432.1|4747353_4748337_+	glycosyltransferase	NA	A0A0F7L2F7	uncultured_marine_virus	36.1	2.3e-07
>prophage 271
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4769063	4776084	6571392		Croceibacter_phage(33.33%)	5	NA	NA
WP_004307416.1|4769063_4771145_+	helicase	NA	W8CQP1	Croceibacter_phage	24.6	6.8e-09
WP_004307415.1|4771223_4772357_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_004307414.1|4772477_4774313_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.8	2.6e-52
WP_004307413.1|4774327_4775131_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_004307412.1|4775127_4776084_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	38.9	4.9e-47
>prophage 272
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4780301	4780937	6571392		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004298269.1|4780301_4780937_-	ribonuclease H	NA	A0A2H4JH24	uncultured_Caudovirales_phage	51.2	6.9e-05
>prophage 273
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4785087	4786854	6571392		Catovirus(100.0%)	1	NA	NA
WP_004307406.1|4785087_4786854_+	HSP90 family protein	NA	A0A1V0SAD6	Catovirus	20.2	1.6e-19
>prophage 274
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4796104	4805488	6571392		Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_004298254.1|4796104_4799203_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	31.5	8.0e-22
WP_004307400.1|4799404_4799935_+	CvpA family protein	NA	NA	NA	NA	NA
WP_004307399.1|4799936_4801415_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_004307398.1|4801529_4802282_+	Fe-S cluster assembly ATPase SufC	NA	A0A1M7XV31	Cedratvirus	31.5	5.1e-07
WP_004307397.1|4802295_4803639_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_004307396.1|4803658_4804870_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	43.3	2.6e-101
WP_004307395.1|4805161_4805488_+	heavy metal-binding domain-containing protein	NA	M4STD1	Rhodobacter_phage	41.9	7.6e-16
>prophage 275
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4812568	4813171	6571392		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_004298244.1|4812568_4813171_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	44.4	3.4e-30
>prophage 276
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4821434	4823393	6571392		Bacillus_virus(100.0%)	1	NA	NA
WP_004298236.1|4821434_4823393_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	45.3	1.6e-140
>prophage 277
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4842665	4843115	6571392	tRNA	Salicola_phage(100.0%)	1	NA	NA
WP_004298215.1|4842665_4843115_-|tRNA	aspartyl-tRNA amidotransferase subunit B	tRNA	A0A248SJP2	Salicola_phage	28.6	2.5e-09
>prophage 278
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4859594	4860098	6571392		Rhizobium_phage(100.0%)	1	NA	NA
WP_004298201.1|4859594_4860098_-	RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	31.6	1.0e-06
>prophage 279
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4863661	4864093	6571392		Tokyovirus(100.0%)	1	NA	NA
WP_004307331.1|4863661_4864093_+	dUTP diphosphatase	NA	A0A146JCY5	Tokyovirus	55.6	6.7e-44
>prophage 280
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4867783	4874956	6571392		Tetraselmis_virus(66.67%)	3	NA	NA
WP_004307327.1|4867783_4871800_+	response regulator	NA	Q6XLV6	Feldmannia_irregularis_virus	24.6	3.2e-15
WP_004307326.1|4871896_4873582_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	28.1	1.7e-13
WP_004307325.1|4873594_4874956_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	29.8	9.2e-31
>prophage 281
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4892868	4895982	6571392		Norovirus(100.0%)	1	NA	NA
WP_004307642.1|4892868_4895982_+	TonB-dependent receptor	NA	Q2PGD7	Norovirus	36.9	1.5e-23
>prophage 282
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4903277	4906382	6571392		Norovirus(100.0%)	1	NA	NA
WP_004305244.1|4903277_4906382_+	TonB-dependent receptor	NA	Q2PGD7	Norovirus	37.6	1.3e-24
>prophage 283
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4909706	4912782	6571392		Tetraselmis_virus(100.0%)	2	NA	NA
WP_004305241.1|4909706_4911059_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	27.9	8.3e-32
WP_004305240.1|4911096_4912782_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	33.8	1.3e-13
>prophage 284
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4961226	4966317	6571392		Catovirus(50.0%)	2	NA	NA
WP_004305211.1|4961226_4963041_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.3	2.2e-43
WP_085929272.1|4963230_4966317_-	insulinase family protein	NA	A0A2K9LA15	Tupanvirus	22.7	3.8e-08
>prophage 285
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	4998285	5000931	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004299586.1|4998285_5000931_-	DNA gyrase/topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	34.1	5.2e-38
>prophage 286
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5025831	5027373	6571392	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_004305141.1|5025831_5027373_+|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	30.8	1.0e-46
>prophage 287
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5056023	5058858	6571392		Norovirus(100.0%)	1	NA	NA
WP_004305124.1|5056023_5058858_+	SusC/RagA family TonB-linked outer membrane protein	NA	Q2PGD7	Norovirus	34.7	4.3e-06
>prophage 288
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5068790	5072810	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004305116.1|5068790_5072810_-	hybrid sensor histidine kinase/response regulator transcription factor	NA	W8CYF6	Bacillus_phage	28.5	1.5e-20
>prophage 289
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5093411	5094299	6571392		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_004305101.1|5093411_5094299_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	23.4	2.5e-05
>prophage 290
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5106521	5107920	6571392	tRNA	Pandoravirus(50.0%)	2	NA	NA
WP_032852075.1|5106521_5107256_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	37.3	1.0e-23
WP_004305089.1|5107263_5107920_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.6	1.3e-35
>prophage 291
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5136737	5138033	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004305061.1|5136737_5138033_+	hypothetical protein	NA	A0A0S2SXR0	Bacillus_phage	34.0	3.3e-54
>prophage 292
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5148983	5152919	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004305050.1|5148983_5152919_-	response regulator	NA	W8CYM9	Bacillus_phage	29.8	1.2e-09
>prophage 293
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5188529	5189603	6571392		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_004299766.1|5188529_5189603_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	36.3	5.4e-10
>prophage 294
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5193989	5195246	6571392		Streptococcus_phage(100.0%)	1	NA	NA
WP_004299772.1|5193989_5195246_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.9	1.7e-92
>prophage 295
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5205411	5210948	6571392		Flavobacterium_phage(33.33%)	6	NA	NA
WP_004299782.1|5205411_5206146_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	47.4	3.1e-25
WP_004305028.1|5206172_5207681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004305027.1|5207823_5208879_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	6.4e-40
WP_004305026.1|5208915_5209752_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004299786.1|5209748_5210231_+	RecX family transcriptional regulator	NA	NA	NA	NA	NA
WP_004299787.1|5210309_5210948_+	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	31.8	2.4e-05
>prophage 296
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5225400	5229462	6571392		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_004305018.1|5225400_5229462_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.5	1.6e-30
>prophage 297
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5236603	5246542	6571392		Salmonella_phage(33.33%)	7	NA	NA
WP_004305014.1|5236603_5238001_+	DUF4979 domain-containing protein	NA	A0A140XG62	Salmonella_phage	30.4	3.9e-16
WP_004305013.1|5238035_5239325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004305012.1|5239367_5240621_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004305011.1|5240801_5242886_-	helicase	NA	I6R9Q6	Nonlabens_phage	30.3	3.4e-24
WP_004305010.1|5243921_5244356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004299812.1|5244533_5244734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004305009.1|5244901_5246542_-	hypothetical protein	NA	A0A1B1IPS8	uncultured_Mediterranean_phage	34.1	2.5e-38
>prophage 298
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5259459	5263839	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004305003.1|5259459_5263839_-	hybrid sensor histidine kinase/response regulator transcription factor	NA	W8CYF6	Bacillus_phage	29.6	7.1e-24
>prophage 299
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5268872	5269994	6571392		Klosneuvirus(100.0%)	1	NA	NA
WP_004304998.1|5268872_5269994_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	A0A1V0SKB7	Klosneuvirus	30.8	5.3e-32
>prophage 300
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5280529	5284555	6571392		Feldmannia_irregularis_virus(100.0%)	1	NA	NA
WP_004304984.1|5280529_5284555_+	hybrid sensor histidine kinase/response regulator transcription factor	NA	Q6XLV6	Feldmannia_irregularis_virus	25.2	3.6e-14
>prophage 301
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5301671	5304392	6571392		Gordonia_phage(50.0%)	3	NA	NA
WP_004304962.1|5301671_5302469_+	sialate O-acetylesterase	NA	A0A1B3AZ08	Gordonia_phage	30.5	2.2e-08
WP_004299903.1|5303038_5303629_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004299904.1|5303645_5304392_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.6	2.1e-21
>prophage 302
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5329845	5333634	6571392		Clostridium_phage(50.0%)	3	NA	NA
WP_004304940.1|5329845_5331417_+	LamG domain-containing protein	NA	A0A0A7RU14	Clostridium_phage	43.8	3.1e-06
WP_004299920.1|5331536_5331803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004304938.1|5332077_5333634_-	sulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	24.9	1.3e-17
>prophage 303
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5338877	5341208	6571392		Hokovirus(100.0%)	1	NA	NA
WP_004304930.1|5338877_5341208_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.1	9.3e-31
>prophage 304
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5348333	5351135	6571392		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_004304924.1|5348333_5351135_+	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	22.1	1.1e-06
>prophage 305
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5362618	5368494	6571392		Tupanvirus(33.33%)	3	NA	NA
WP_004304918.1|5362618_5364574_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.8	5.0e-54
WP_004304917.1|5364782_5366819_+	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	33.1	4.4e-93
WP_004304916.1|5366970_5368494_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	S4VT61	Pandoravirus	39.6	5.1e-54
>prophage 306
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5379303	5381400	6571392		Nonlabens_phage(100.0%)	1	NA	NA
WP_004304905.1|5379303_5381400_-	helicase	NA	I6R9Q6	Nonlabens_phage	28.1	1.9e-22
>prophage 307
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5394269	5404693	6571392	protease	Staphylococcus_phage(16.67%)	9	NA	NA
WP_004297152.1|5394269_5395031_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	2.6e-22
WP_004297154.1|5395106_5395850_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004297155.1|5395846_5396617_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.7	1.3e-10
WP_004297160.1|5396683_5396929_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_004297162.1|5397370_5398726_+	trigger factor	NA	NA	NA	NA	NA
WP_004297164.1|5398869_5399532_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	46.1	2.4e-40
WP_004297166.1|5399534_5400779_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	52.9	1.9e-115
WP_004305598.1|5400947_5403128_+	DNA helicase RecQ	NA	A0A0G2Y8K9	Acanthamoeba_polyphaga_mimivirus	38.7	2.6e-88
WP_004297169.1|5403214_5404693_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	4.3e-98
>prophage 308
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5410737	5412639	6571392		Wolbachia_phage(100.0%)	1	NA	NA
WP_004297175.1|5410737_5412639_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	26.7	1.1e-53
>prophage 309
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5425887	5436688	6571392	tRNA	Bodo_saltans_virus(33.33%)	6	NA	NA
WP_004305589.1|5425887_5427234_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	57.2	1.2e-144
WP_004305584.1|5427307_5428789_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_004297192.1|5428894_5430298_+|tRNA	asparagine--tRNA ligase	tRNA	H2EDM5	Moumouvirus	40.0	1.0e-93
WP_004305582.1|5430437_5430929_+	DUF4488 domain-containing protein	NA	NA	NA	NA	NA
WP_004305581.1|5431186_5432395_+	glucuronyl hydrolase	NA	NA	NA	NA	NA
WP_004305580.1|5432590_5436688_+	hybrid sensor histidine kinase/response regulator transcription factor	NA	A0A1V0SGX0	Hokovirus	25.0	5.2e-21
>prophage 310
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5461920	5463165	6571392		Gordonia_phage(100.0%)	1	NA	NA
WP_085929291.1|5461920_5463165_+	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	31.6	9.4e-14
>prophage 311
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5488927	5490285	6571392		Anguillid_herpesvirus(50.0%)	2	NA	NA
WP_004305483.1|5488927_5489392_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	40.5	7.7e-22
WP_004297256.1|5489412_5490285_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	48.5	1.4e-19
>prophage 312
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5493752	5496454	6571392		Pandoravirus(50.0%)	2	NA	NA
WP_004297261.1|5493752_5494343_+	GTP cyclohydrolase I FolE	NA	S4VV34	Pandoravirus	54.7	5.4e-44
WP_004305478.1|5494372_5496454_-	DNA primase	NA	A0A218MKR7	uncultured_virus	31.7	6.5e-44
>prophage 313
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5501941	5507819	6571392		Acanthamoeba_polyphaga_lentillevirus(33.33%)	5	NA	NA
WP_004305475.1|5501941_5503852_-	RecQ family ATP-dependent DNA helicase	NA	J2YAJ8	Acanthamoeba_polyphaga_lentillevirus	37.5	2.1e-65
WP_004305474.1|5503844_5505563_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.4	5.9e-75
WP_004297270.1|5505768_5505999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004305471.1|5506473_5506695_-	DUF3791 domain-containing protein	NA	NA	NA	NA	NA
WP_008650496.1|5506958_5507819_+	phosphodiester glycosidase family protein	NA	A0A291LB83	Escherichia_phage	35.9	7.7e-07
>prophage 314
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5517795	5518986	6571392		Oenococcus_phage(100.0%)	1	NA	NA
WP_032852097.1|5517795_5518986_-	DUF2062 domain-containing protein	NA	V9QJB1	Oenococcus_phage	24.3	2.8e-07
>prophage 315
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5538238	5538802	6571392		Pandoravirus(100.0%)	1	NA	NA
WP_004297304.1|5538238_5538802_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	31.2	9.7e-11
>prophage 316
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5569587	5570655	6571392		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004305424.1|5569587_5570655_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.7	2.5e-15
>prophage 317
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5588322	5589741	6571392		Roseobacter_phage(100.0%)	1	NA	NA
WP_004305408.1|5588322_5589741_+	AAA family ATPase	NA	A0A1B0UY03	Roseobacter_phage	24.8	3.0e-16
>prophage 318
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5609044	5625797	6571392	tRNA	uncultured_Mediterranean_phage(25.0%)	13	NA	NA
WP_004305396.1|5609044_5611663_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	42.5	1.5e-98
WP_004305395.1|5611841_5612810_+	M23 family metallopeptidase	NA	A8ATH6	Listeria_phage	40.1	4.4e-19
WP_004301384.1|5612830_5613175_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004305394.1|5613329_5615570_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	38.0	1.2e-11
WP_004301388.1|5615642_5616938_-	lytic transglycosylase domain-containing protein	NA	A0A0S2SXN2	Bacillus_phage	42.5	5.7e-14
WP_004301390.1|5616972_5617860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004301392.1|5617860_5618751_-	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	36.3	3.3e-13
WP_004301394.1|5618766_5619531_-	ParA family protein	NA	Q8JL10	Natrialba_phage	34.3	7.5e-22
WP_004305393.1|5619887_5620655_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	33.1	3.0e-31
WP_004305392.1|5620667_5621804_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_004301399.1|5621896_5622679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004305391.1|5622781_5623630_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_032852107.1|5623646_5625797_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	G9E4U6	Ostreococcus_lucimarinus_virus	42.8	2.1e-109
>prophage 319
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5663063	5665874	6571392		Hokovirus(100.0%)	1	NA	NA
WP_032852095.1|5663063_5665874_+	PAS domain-containing protein	NA	A0A1V0SGX0	Hokovirus	36.0	1.5e-30
>prophage 320
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5726422	5727250	6571392		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_085929286.1|5726422_5727250_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	34.9	1.6e-17
>prophage 321
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5739878	5749367	6571392		Bacillus_phage(33.33%)	4	NA	NA
WP_004305297.1|5739878_5744414_+	response regulator	NA	W8CYF6	Bacillus_phage	28.6	9.0e-22
WP_004305295.1|5744558_5746055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004305294.1|5746090_5747752_-	pectate lyase	NA	A0A1B1IPS8	uncultured_Mediterranean_phage	29.9	5.1e-31
WP_004305293.1|5747783_5749367_-	hypothetical protein	NA	S0A183	Cellulophaga_phage	28.7	2.2e-28
>prophage 322
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5760339	5761869	6571392		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_004305287.1|5760339_5761869_+	pectate lyase	NA	A0A1B1IPS8	uncultured_Mediterranean_phage	33.4	1.8e-43
>prophage 323
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5787093	5791434	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004305274.1|5787093_5791434_-	response regulator	NA	W8CYF6	Bacillus_phage	28.3	1.9e-21
>prophage 324
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5800906	5802901	6571392		unidentified_phage(100.0%)	1	NA	NA
WP_004305269.1|5800906_5802901_-	AAA family ATPase	NA	H7BUJ6	unidentified_phage	42.4	1.5e-85
>prophage 325
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5825799	5827203	6571392		Streptomyces_phage(100.0%)	1	NA	NA
WP_004301550.1|5825799_5827203_-	glycoside hydrolase family 28 protein	NA	A0A0K1Y5U2	Streptomyces_phage	24.3	5.6e-07
>prophage 326
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5876969	5881262	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004304451.1|5876969_5881262_+	response regulator	NA	W8CYM9	Bacillus_phage	36.1	8.0e-12
>prophage 327
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5886994	5888680	6571392		Cellulophaga_phage(100.0%)	1	NA	NA
WP_004304458.1|5886994_5888680_+	hypothetical protein	NA	S0A0V0	Cellulophaga_phage	35.4	2.8e-21
>prophage 328
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5921798	5926085	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004304509.1|5921798_5926085_+	response regulator	NA	W8CYM9	Bacillus_phage	32.8	3.7e-09
>prophage 329
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5950077	5951307	6571392		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_004304531.1|5950077_5951307_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	34.0	2.1e-26
>prophage 330
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5963508	5965541	6571392		Mollivirus(50.0%)	2	NA	NA
WP_004301731.1|5963508_5964453_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	27.3	2.0e-24
WP_004304546.1|5964524_5965541_-	AAA family ATPase	NA	W8D063	Erwinia_phage	45.9	1.2e-43
>prophage 331
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	5992991	5996300	6571392		Herpes_simplex_virus(100.0%)	1	NA	NA
WP_085929269.1|5992991_5996300_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	31.3	5.2e-128
>prophage 332
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6000663	6001158	6571392		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004301766.1|6000663_6001158_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	39.7	4.7e-25
>prophage 333
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6006560	6007010	6571392		Cyanophage(100.0%)	1	NA	NA
WP_004301773.1|6006560_6007010_-	dCMP deaminase family protein	NA	H6WFU3	Cyanophage	48.1	1.4e-31
>prophage 334
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6027077	6028352	6571392	tRNA	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_004301791.1|6027077_6028352_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	39.9	5.0e-63
>prophage 335
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6031612	6038597	6571392		Staphylococcus_phage(25.0%)	5	NA	NA
WP_004301798.1|6031612_6032320_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.2	3.9e-17
WP_004309866.1|6032358_6033849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004304602.1|6033875_6036713_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	25.0	6.0e-08
WP_004304603.1|6036794_6037595_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	44.8	7.3e-52
WP_004301802.1|6037670_6038597_-	YegS/Rv2252/BmrU family lipid kinase	NA	A0A1V0SBJ0	Catovirus	27.3	7.9e-18
>prophage 336
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6050930	6065851	6571392		Orpheovirus(33.33%)	11	NA	NA
WP_004304613.1|6050930_6052109_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	27.4	5.3e-27
WP_004301815.1|6052172_6052832_-	3'-5' exonuclease domain-containing protein 2	NA	L7Y4A9	Megavirus	29.7	8.7e-11
WP_004304614.1|6052834_6053500_-	DUF5063 domain-containing protein	NA	NA	NA	NA	NA
WP_004301818.1|6053625_6056112_+	DNA translocase FtsK	NA	Q853W3	Mycobacterium_phage	41.2	2.3e-67
WP_004304615.1|6056131_6056776_+	membrane protein	NA	NA	NA	NA	NA
WP_004304616.1|6056812_6057763_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	47.0	1.1e-67
WP_004304617.1|6057932_6060362_-	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_004304618.1|6060520_6061810_-	thioredoxin fold domain-containing protein	NA	A0A2I2L415	Orpheovirus	35.0	9.1e-12
WP_032852049.1|6061830_6062991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004304620.1|6062992_6064135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004304621.1|6064144_6065851_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.8	2.0e-14
>prophage 337
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6097700	6102353	6571392	tRNA	Klosneuvirus(50.0%)	2	NA	NA
WP_004304638.1|6097700_6100337_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	1.1e-149
WP_004304639.1|6100454_6102353_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	33.2	1.3e-27
>prophage 338
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6156233	6157778	6571392		Acinetobacter_phage(100.0%)	1	NA	NA
WP_004304674.1|6156233_6157778_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.3	3.0e-70
>prophage 339
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6161828	6162467	6571392		Listeria_phage(100.0%)	1	NA	NA
WP_004304684.1|6161828_6162467_+	M23 family metallopeptidase	NA	A8ATH6	Listeria_phage	36.2	2.4e-13
>prophage 340
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6173138	6174401	6571392		Orpheovirus(100.0%)	1	NA	NA
WP_118032156.1|6173138_6174401_-	DUF4419 domain-containing protein	NA	A0A2I2L4E9	Orpheovirus	33.2	4.1e-41
>prophage 341
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6221804	6222839	6571392		Synechococcus_phage(100.0%)	1	NA	NA
WP_004304753.1|6221804_6222839_+	zinc-binding dehydrogenase	NA	E3SJ82	Synechococcus_phage	21.8	6.0e-14
>prophage 342
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6256925	6257282	6571392		uncultured_phage(100.0%)	1	NA	NA
WP_004304787.1|6256925_6257282_+	6-carboxytetrahydropterin synthase	NA	S4U060	uncultured_phage	58.9	1.2e-33
>prophage 343
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6269786	6270140	6571392		Streptococcus_phage(100.0%)	1	NA	NA
WP_004304798.1|6269786_6270140_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	45.8	2.1e-19
>prophage 344
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6276540	6277854	6571392		environmental_Halophage(100.0%)	1	NA	NA
WP_004304803.1|6276540_6277854_+	purine permease	NA	H9YQ34	environmental_Halophage	49.2	1.5e-22
>prophage 345
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6286089	6290641	6571392		Bacillus_virus(33.33%)	5	NA	NA
WP_004304809.1|6286089_6286758_-	methyltransferase	NA	G3MA03	Bacillus_virus	47.0	6.1e-20
WP_032852055.1|6286933_6287302_+	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_004304811.1|6287307_6288177_-	ion transporter	NA	NA	NA	NA	NA
WP_032852056.1|6288215_6289196_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	39.5	1.8e-07
WP_004304813.1|6289327_6290641_+	TIGR01777 family protein	NA	A0A1W6JNX6	Morganella_phage	42.5	2.5e-25
>prophage 346
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6300939	6301920	6571392		Tupanvirus(100.0%)	1	NA	NA
WP_004304821.1|6300939_6301920_-	linear amide C-N hydrolase	NA	A0A2K9L5Y5	Tupanvirus	27.1	1.3e-15
>prophage 347
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6315681	6323850	6571392		Nonlabens_phage(50.0%)	3	NA	NA
WP_080564506.1|6315681_6317772_+	helicase	NA	I6R9Q6	Nonlabens_phage	28.1	3.4e-24
WP_004304839.1|6317872_6318307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004304842.1|6318642_6323850_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	23.1	4.6e-38
>prophage 348
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6329539	6340615	6571392	integrase	Liberibacter_phage(40.0%)	9	6307675:6307693	6340287:6340305
6307675:6307693	attL	GACTGATAGAGAAAGAAAA	NA	NA	NA	NA
WP_004304853.1|6329539_6332671_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.0	1.1e-71
WP_004304855.1|6332651_6333302_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_004304857.1|6333320_6333869_-	type I restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	37.5	2.3e-20
WP_004304858.1|6333879_6334968_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004304860.1|6334980_6336225_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_004304863.1|6336235_6337306_-	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	38.7	9.7e-68
WP_004304865.1|6337302_6338067_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_004304867.1|6338068_6339061_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	28.0	6.1e-32
WP_004304868.1|6339109_6340615_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	30.4	9.8e-58
6340287:6340305	attR	TTTTCTTTCTCTATCAGTC	NA	NA	NA	NA
>prophage 349
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6343887	6349766	6571392	tRNA	Synechococcus_phage(50.0%)	5	NA	NA
WP_032852069.1|6343887_6344928_+	Zn-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	22.4	3.8e-08
WP_004304876.1|6344943_6345420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004304878.1|6345431_6346274_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_004304880.1|6346326_6347724_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_004304882.1|6347858_6349766_+	PAS domain-containing hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	31.6	1.2e-36
>prophage 350
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6354776	6366063	6571392	integrase	Staphylococcus_phage(33.33%)	9	6355208:6355222	6366086:6366100
WP_004304890.1|6354776_6355523_+	adenine nucleotide alpha hydrolase family protein	NA	A0A0U2S5Z2	Escherichia_phage	32.9	2.4e-25
6355208:6355222	attL	TTTGGAAACTTTATT	NA	NA	NA	NA
WP_004304892.1|6355538_6355910_+	DMT family protein	NA	NA	NA	NA	NA
WP_004304893.1|6355978_6356905_-|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	29.3	2.4e-22
WP_004304894.1|6357008_6358118_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_004304895.1|6358110_6359244_-	hypothetical protein	NA	A0A2H4PQP5	Staphylococcus_phage	22.5	4.8e-09
WP_004304896.1|6359249_6360284_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	53.5	1.9e-92
WP_004304897.1|6360289_6361915_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	2.1e-106
WP_004304898.1|6361917_6363078_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_004304899.1|6363093_6366063_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	24.5	7.7e-22
6366086:6366100	attR	AATAAAGTTTCCAAA	NA	NA	NA	NA
>prophage 351
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6371873	6376123	6571392		Cronobacter_phage(50.0%)	4	NA	NA
WP_004302041.1|6371873_6372824_-	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	31.0	2.4e-22
WP_015532571.1|6372856_6373414_-	DUF4199 domain-containing protein	NA	NA	NA	NA	NA
WP_004305616.1|6373968_6374442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004302046.1|6374842_6376123_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	73.2	4.6e-173
>prophage 352
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6395249	6397838	6571392		Agrobacterium_phage(100.0%)	1	NA	NA
WP_004305638.1|6395249_6397838_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.5	3.3e-122
>prophage 353
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6401916	6405005	6571392		Bodo_saltans_virus(50.0%)	4	NA	NA
WP_004305671.1|6401916_6402348_+	DUF1810 domain-containing protein	NA	A0A2H4UVK5	Bodo_saltans_virus	51.0	1.8e-20
WP_004305673.1|6402366_6402741_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_004305675.1|6402861_6403854_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_004302078.1|6403970_6405005_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.4	1.4e-116
>prophage 354
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6409353	6411267	6571392		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_004302085.1|6409353_6411267_+	molecular chaperone DnaK	NA	A0A0G2Y5Y2	Acanthamoeba_polyphaga_mimivirus	45.7	1.1e-135
>prophage 355
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6433122	6433956	6571392		Catovirus(100.0%)	1	NA	NA
WP_004305712.1|6433122_6433956_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	31.2	3.2e-26
>prophage 356
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6440907	6442530	6571392		Tetraselmis_virus(100.0%)	1	NA	NA
WP_085929293.1|6440907_6442530_-	sulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.9	2.5e-14
>prophage 357
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6458266	6462328	6571392		Bacillus_phage(100.0%)	1	NA	NA
WP_004305732.1|6458266_6462328_-	hybrid sensor histidine kinase/response regulator	NA	W8CYF6	Bacillus_phage	31.7	8.0e-22
>prophage 358
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6483777	6487302	6571392		Feldmannia_species_virus(100.0%)	1	NA	NA
WP_004305748.1|6483777_6487302_-	helix-turn-helix domain-containing protein	NA	B5LWN0	Feldmannia_species_virus	24.3	1.5e-11
>prophage 359
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6498210	6502095	6571392		Acanthocystis_turfacea_Chlorella_virus(33.33%)	5	NA	NA
WP_032852128.1|6498210_6498948_+	hypothetical protein	NA	M1I080	Acanthocystis_turfacea_Chlorella_virus	34.6	9.1e-33
WP_004305759.1|6498941_6499520_+	HAD-IA family hydrolase	NA	A0A1D8KPI1	Synechococcus_phage	30.9	9.0e-12
WP_004305760.1|6499509_6500373_+	phosphotransferase	NA	NA	NA	NA	NA
WP_004305761.1|6500362_6501067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004305762.1|6501063_6502095_+	SDR family NAD(P)-dependent oxidoreductase	NA	M1NML0	Moumouvirus	24.4	6.3e-24
>prophage 360
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6507926	6508679	6571392		Catovirus(100.0%)	1	NA	NA
WP_004305768.1|6507926_6508679_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	34.4	1.8e-07
>prophage 361
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6512841	6519101	6571392		Pyramimonas_orientalis_virus(50.0%)	2	NA	NA
WP_004305773.1|6512841_6515343_-	endonuclease MutS2	NA	F2QAF7	Pyramimonas_orientalis_virus	21.1	1.7e-14
WP_004305776.1|6517196_6519101_-	hypothetical protein	NA	A0A2H4J2R8	uncultured_Caudovirales_phage	42.8	1.9e-135
>prophage 362
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6541171	6542275	6571392		Tupanvirus(100.0%)	1	NA	NA
WP_004305790.1|6541171_6542275_+	AMP-binding protein	NA	A0A2K9L3I8	Tupanvirus	21.2	4.1e-05
>prophage 363
NZ_CP046397	Bacteroides ovatus strain FDAARGOS_733 chromosome, complete genome	6571392	6548383	6550375	6571392		Microcystis_phage(100.0%)	1	NA	NA
WP_004305798.1|6548383_6550375_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	38.6	4.3e-29
