The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040336	Bacillus luti strain FJ chromosome, complete genome	5202942	826679	834316	5202942		uncultured_Caudovirales_phage(16.67%)	10	NA	NA
WP_156573829.1|826679_827612_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.6	3.4e-16
WP_000403752.1|827601_828372_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.1	2.2e-13
WP_071710422.1|828404_829169_+	class B sortase	NA	NA	NA	NA	NA
WP_156573832.1|829237_829561_-	heme oxygenase	NA	NA	NA	NA	NA
WP_071710424.1|829860_831060_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.0	9.5e-72
WP_001014310.1|831099_831294_-	YwbE family protein	NA	NA	NA	NA	NA
WP_001293578.1|831294_831468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156573834.1|831637_832330_+	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	28.8	1.4e-06
WP_156573836.1|832331_833267_+	HAMP domain-containing histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	25.5	1.9e-11
WP_156573838.1|833392_834316_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.0	5.3e-46
>prophage 2
NZ_CP040336	Bacillus luti strain FJ chromosome, complete genome	5202942	889628	957556	5202942	integrase,tRNA,coat,protease	Klosneuvirus(22.22%)	55	909776:909796	937490:937510
WP_000472280.1|889628_890888_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	66.1	4.5e-149
WP_033665543.1|890994_892665_+|protease	ATP-dependent protease LonB	protease	E3T4F6	Cafeteria_roenbergensis_virus	32.8	9.6e-14
WP_156573883.1|892848_895179_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.9	1.0e-178
WP_000869114.1|895175_895772_+	ribosome biogenesis GTP-binding protein YsxC	NA	NA	NA	NA	NA
WP_000359771.1|895804_896221_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_071713328.1|896223_896676_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000547871.1|897091_898429_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_071713327.1|898446_899280_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_001226415.1|899295_900225_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_156573885.1|900227_900980_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_001087076.1|901000_901990_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_071713325.1|901989_903279_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	34.1	2.8e-05
WP_156573887.1|903363_904371_+	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_156573889.1|904430_905456_+|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_156573892.1|905851_908497_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	43.3	1.5e-165
WP_156573894.1|908588_909890_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
909776:909796	attL	GAAAGAGGCAATTGATACGAA	NA	NA	NA	NA
WP_156573896.1|910054_911014_+	stage II sporulation protein B	NA	NA	NA	NA	NA
WP_001226283.1|911234_911810_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_156573898.1|911856_912408_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_061535636.1|912961_913531_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_061535635.1|913549_915142_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	50.3	4.9e-124
WP_061535634.1|915131_916388_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	35.4	1.9e-59
WP_061535633.1|916410_919563_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_061535632.1|919639_921142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156573900.1|921160_921781_+	molecular chaperone Tir	NA	NA	NA	NA	NA
WP_061535629.1|923907_924606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061535628.1|924598_926314_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_156576914.1|926322_929613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061535627.1|929572_930922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000466737.1|931428_932448_+	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_001135469.1|932489_933341_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_071713319.1|933355_933901_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000391524.1|933936_934623_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_071713318.1|934625_935423_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000797470.1|935556_936303_+	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_000599062.1|936295_937156_+	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_098662578.1|937223_938612_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
937490:937510	attR	GAAAGAGGCAATTGATACGAA	NA	NA	NA	NA
WP_000270907.1|938781_939090_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_001993153.1|939101_939446_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000944957.1|939449_939740_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_071713316.1|939803_940352_+	sporulation protein	NA	NA	NA	NA	NA
WP_000497124.1|940351_941638_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_156573903.1|941777_942485_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_156576915.1|942474_943557_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000114530.1|943650_944427_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	1.6e-19
WP_156573905.1|944401_946324_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_156573908.1|946373_948287_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_071713311.1|948383_949235_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_156573910.1|949320_949968_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000812275.1|950047_950590_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_156573912.1|950589_951732_-	IscS subfamily cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	30.1	2.0e-31
WP_156573914.1|951884_953414_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_071713307.1|953433_954267_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_071713306.1|954297_955404_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_156573917.1|955630_957556_+|coat	spore coat assembly protein ExsA	coat	NA	NA	NA	NA
>prophage 3
NZ_CP040336	Bacillus luti strain FJ chromosome, complete genome	5202942	3230126	3239476	5202942		Bacillus_phage(71.43%)	9	NA	NA
WP_156576018.1|3230126_3230999_-	aminoglycoside 6-adenylyltransferase	NA	E4ZFP8	Streptococcus_phage	44.4	2.1e-65
WP_156576019.1|3231131_3231803_-	methyltransferase	NA	W8CYT3	Bacillus_phage	88.3	1.1e-61
WP_156576020.1|3231950_3232670_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	99.2	2.9e-60
WP_156576021.1|3232869_3233454_+	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_156576022.1|3233478_3234552_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	90.8	1.2e-174
WP_156576023.1|3234548_3235235_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	95.6	9.7e-122
WP_156576024.1|3235314_3237075_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	96.5	6.5e-271
WP_001194288.1|3237314_3238079_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_156576025.1|3238177_3239476_-	SH3 domain-containing protein	NA	A0A1V0DZX6	Clostridioides_phage	37.5	2.3e-10
>prophage 4
NZ_CP040336	Bacillus luti strain FJ chromosome, complete genome	5202942	4804062	4812433	5202942		Synechococcus_phage(50.0%)	8	NA	NA
WP_016089553.1|4804062_4804650_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	2.7e-27
WP_071710558.1|4804646_4805687_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.6	1.6e-67
WP_042981527.1|4805787_4807203_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_156576798.1|4807187_4809407_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.6e-163
WP_000666780.1|4809390_4810074_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000278823.1|4810070_4810325_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_001170544.1|4810317_4811037_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000625682.1|4811125_4812433_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
>prophage 5
NZ_CP040336	Bacillus luti strain FJ chromosome, complete genome	5202942	4853317	4861266	5202942		Bacillus_phage(33.33%)	6	NA	NA
WP_071710573.1|4853317_4854823_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.0	3.2e-32
WP_156576808.1|4854806_4855508_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.5e-40
WP_156576809.1|4855652_4856978_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.2	1.1e-44
WP_165613787.1|4857360_4858902_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.2	2.0e-21
WP_071710570.1|4859305_4860943_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.3	2.6e-157
WP_000917307.1|4860981_4861266_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.7	1.3e-19
