The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041352	Casimicrobium huifangae strain SJ-1 chromosome, complete genome	4465898	2286087	2364365	4465898	integrase,transposase,plate,tRNA	Bacillus_phage(27.27%)	53	2280158:2280182	2306920:2306944
2280158:2280182	attL	GTTTTTCGTGCTATTTGTGGCGCTT	NA	NA	NA	NA
WP_156862697.1|2286087_2288421_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_139235525.1|2288424_2288757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054257790.1|2288832_2291835_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	25.6	1.3e-80
WP_156862698.1|2291841_2293125_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_156862699.1|2293142_2295368_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_156862700.1|2295368_2296541_-	AAA family ATPase	NA	A0A1B0Z0Q4	Vibrio_phage	30.0	4.0e-06
WP_156862701.1|2296966_2298484_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_156862702.1|2298498_2299614_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_156862703.1|2299619_2300750_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_156862704.1|2300746_2302546_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.8	1.8e-18
WP_156862705.1|2302542_2303544_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_156862706.1|2303659_2304322_+	CerR family C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_156862707.1|2304502_2305579_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_156862708.1|2305672_2306443_+	UPF0489 family protein	NA	NA	NA	NA	NA
WP_156862709.1|2306534_2306888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156862710.1|2307782_2308538_+	(d)CMP kinase	NA	NA	NA	NA	NA
2306920:2306944	attR	AAGCGCCACAAATAGCACGAAAAAC	NA	NA	NA	NA
WP_156862711.1|2308778_2310476_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_156862712.1|2310542_2310872_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	38.9	1.4e-09
WP_156862713.1|2310952_2312113_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_156862714.1|2312168_2313506_+	nucleotide sugar dehydrogenase	NA	M1HEJ3	Acanthocystis_turfacea_Chlorella_virus	27.9	8.5e-29
WP_156862715.1|2313636_2315013_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_156862716.1|2315156_2316551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156864655.1|2316732_2317338_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_162527488.1|2317381_2317783_+	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
WP_156864656.1|2317779_2318886_+	PilW family protein	NA	NA	NA	NA	NA
WP_156862718.1|2318900_2319509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162527489.1|2319513_2323155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156864657.1|2323154_2323556_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_156862720.1|2323580_2324594_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_156862721.1|2324683_2325181_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_156862722.1|2325491_2328314_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.7	2.5e-75
WP_156862723.1|2328653_2330282_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.9	6.3e-18
WP_156862724.1|2330300_2331293_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_162527490.1|2331506_2335013_-	UvrD-helicase domain-containing protein	NA	A0A068EQC7	Bacillus_phage	22.7	2.4e-06
WP_156862726.1|2335002_2337651_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_156862727.1|2337749_2338430_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_156862728.1|2338439_2342021_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_156862729.1|2342017_2343361_-	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_156862730.1|2343357_2344692_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_156862731.1|2344709_2345099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156862732.1|2345111_2346233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156862733.1|2346246_2348622_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	3.7e-35
WP_156862734.1|2348656_2349133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156862735.1|2349244_2350054_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_156862736.1|2350400_2351564_-	protein kinase	NA	NA	NA	NA	NA
WP_156862737.1|2351830_2354167_+	protein kinase	NA	A0A2I2L395	Orpheovirus	23.7	1.7e-08
WP_156862738.1|2354198_2355404_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_156862739.1|2355628_2356705_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_156862740.1|2356701_2358063_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_156862741.1|2358070_2358526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156862742.1|2358617_2361296_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	32.5	3.7e-76
WP_156862743.1|2361335_2362478_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_156862744.1|2362490_2364365_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
